Estudos mostram que corticóides usados por longos períodos podem atrasar o processo de cicatrização, influenciando na reepitelização, na neovascularização e na síntese do colágeno. Os constituintes das nadadeiras dos peixes teleósteos contêm grande quantidade de colágeno e assim o objetivo do presente trabalho foi estudar o efeito da dexametasona (um antiinflamatório e glicocorticóide esteróide bastante utilizado no tratamento de doenças reumáticas) durante o processo regenerativo das nadadeiras caudais das carpas (Cyprinus carpio). Para isso, foram montados dois aquários de vidro, um para o grupo controle e outro para o grupo tratado com a dexametasona (Henrifarma) na concentração de 20mg/L. Os peixes distribuídos nesses aquários tiveram suas nadadeiras caudais amputadas transversalmente e permaneceram nos respectivos aquários para que ocorresse a regeneração. Foram feitas coletas das nadadeiras em regeneração em intervalos de 1, 2, 4, 6, 8 e 10 dias após a amputação. Foi observado que nos peixes do grupo controle, as nadadeiras regeneraram normalmente e cresceram o esperado em cada intervalo de tempo. No entanto, foi verificado que nos peixes do grupo tratado com dexametasona, em cada intervalo analisado, as nadadeiras regeneradas dos peixes expostos à droga eram menores que a medida das nadadeiras dos peixes do grupo controle. Assim, foi possível verificar que, nessa concentração de dexametasona, a regeneração das nadadeiras caudais foi mais lenta, mas não ocorreu a total inibição da regeneração. Dessa forma, os resultados comprovam que a nadadeira caudal é um bom modelo para estudos histológicos sobre a regeneração e a ação da toxicidade de drogas, mas, também, é de grande importância a interação com estudos mais aprofundados para se conhecer e compreender melhor todas as alterações em todas as fases.

Studies have demonstrated that the prolonged use of corticoids can delay the healing process, affecting re-epithelialization, neovascularization and collagen synthesis. As the fins of teleost fish contain a large amount of collagen, the aim of the present study was to investigate the effect of dexamethasone (anti-inflammatory and glucocorticoid steroid widely used in the treatment of rheumatic diseases) during the regeneration process in the caudal fin of specimens of carp (Cyprinus carpio). For such, two glass aquaria were used – one for a group of fish treated with dexamethasone (Henrifarma) in a 20 mg/L concentration and the other for the control group. The caudal fins were amputated transversally and fish remained in their respective aquaria until regeneration occurred. Samples of regenerating fins were collected on days 1, 2, 4, 6, 8 and 10 after amputation. The fins in the control group regenerated normally and grew within the expected in time course. The fins in the group treated with dexamethasone were significantly smaller in comparison to the control group at every evaluation time. Thus, it was possible to verify that, at this concentration of dexamethasone, the regeneration of the caudal fins was delayed, but not completely inhibited. The results show that the caudal fin is a good model for histological studies on regeneration and the action of drug toxicity, but it’s also of great importance the interaction with further studies for a better knowledge and understanding of all the changes in all the phases.

O fungo Metarhizium anisopliae é usado em larga escala no Brasil como um agente de controle microbiológico contra a cigarrinha da cana-de-açúcar, Mahanarva posticata e M. fimbriolata (Hemiptera, Cercopidae). Aplicou-se a linhagem E9 de M. anisopliae em bioensaio no solo, nas dosagens de campo, para se determinar se este poderia causar infecção, doença e morte a estágios imaturos de Anastrepha fraterculus, a mosca sul-americana das frutas. Todos os eventos foram estudados histologicamente e ao nível molecular durante o ciclo da doença, usando-se uma nova técnica de coloração, o corante light Green, associado com a microscopia de luz, e a técnica do PCR, usando-se primers específicos desenvolvidos para M. anisopliae linhagens brasileiras, entre elas a E9. O ciclo infectivo, que se inicia pela adesão do conídio sobre a cutícula do hospedeiro, seguido da germinação, com ou sem a formação de apressório, penetração através da cutícula, colonização, com desenvolvimento da fase dimórfica, corpos hifais na hemocela com a morte do hospedeiro, dura 96 horas, nas condições do bioensaio, similar às condições de campo. Durante o ciclo da doença, propágulos do fungo entomopatogênico foram detectados pela identificação do DNA com primer específico ITSMet: 5'TCTGAATTTTTTATAAGTAT3' com o ITS4 (5'TCCTCCGCTTATTGATATGC3') como primer reverso. Esta metodologia simples permite o estudo in situ do processo infectivo, contribuindo com o entendimento da relação entre patógeneo hospedeiro e permitindo o monitoramento da eficácia e sobrevivência deste fungo entomopatogênico em aplicações em larga escala no campo. Esta também permite e facilita o monitoramento do impacto de M. anisopliae sobre insetos não alvos.

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Quando parcialmente amputadas ou severamente injuriadas, as nadadeiras de teleósteos sofrem um processo de regeneração chamado de regeneração epimórfica, caracterizado pelas seguintes fases: formação de uma capa epidermal multiestratificada, desorganização e migração distal de células mesenquimais multipotentes, proliferação dessas células para formar o blastema, proliferação contínua do blastema distal para facilitar o crescimento e diferenciação do blastema proximal para restaurar as estruturas perdidas. A regeneração que a nadadeira sofre é extremamente sensível à ação de algumas drogas que podem interferir na reparação de suas estruturas. Em vista disso, e também pelo fato de que há relatos na literatura de que a indometacina pode interferir de alguma maneira na restauração tecidual de diversos organismos, o objetivo deste trabalho foi o de avaliar os possíveis efeitos desta droga, em três doses diferentes, na regeneração da nadadeira caudal de peixe teleósteo, considerando a síntese, deposição e organização dos componentes da matriz lepidotriquial, a regeneração da actinotriquia, bem como a área da nadadeira como um todo. Para isso, foram feitas análises histoquímica, ultraestrutural e morfométrica, e foi observado que a indometacina, nas doses de 20 e 30 mg.L-1, apresentou um atraso no processo de regeneração das unidades esqueléticas (lepidotriquias e actinotriquias) das nadadeiras caudais. Essas doses podem ter interferido, momentaneamente, no processo de diferenciação das células blastemais nas células responsáveis pela síntese e deposição das actinotriquias e das lepidotriquias ou, até mesmo, na sinalização necessária para que as células recém-diferenciadas dessem início à síntese dos componentes das unidades esqueléticas.

When partially amputated or severely injured, teleost fins suffer a regenerative process called epimorphic regeneration characterised by the following stages: the formation of a multistratified epidermal layer, the disorganisation and distal migration of multipotent mesenchymal cells, the proliferation of these cells in order to form the blastema, continuous proliferation of distal blastema to facilitate the growth, and differentiation of the proximal blastema in order to restore its lost structure. The regeneration of the fin is extremely sensitive to the action of some drugs that can interfere in its structure restoration. For this reason, and also based on papers relating that indomethacin can interfere somehow in the tissue restoration of many different organisms, the aim of this work is to evaluate the possible effects of this drug in three different doses in the regeneration of the teleost fish tail fin, taking into consideration the synthesis, the disposition and organisation of lepidotrichial matrix components, the restoration of actinotrichia, as well as the fin area itself. Therefore, histochemical, ultrastructural and morphometric analysis were done and it was observed that indomethacin in doses of 20 and 30 mg.L-1 caused a delay in the regenerative process of the dermal skeleton (lepidotrichia and actinotrichia) of the tail fins. These doses could have interfered, momentarily, in the process of blastemal cell differentiation in the cells responsible for the synthesis and disposition of actinotrichia and lepidotrichia or, even interfered in the signalling necessary for the recent differentiated cells to begin synthesising the components of the dermal skeleton.

As nadadeiras dos teleósteos, quando parcialmente amputadas, sofrem um processo de regeneração chamado de regeneração epimórfica, caracterizado pelas seguintes fases: cicatrização, a partir da formação de uma capa epidermal multiestratificada, formação de uma massa de células mesenquimais multipotentes chamada blastema, diferenciação dessas células, síntese e deposição de matriz extracelular, crescimento e restauração morfológica. A epiderme tem papel fundamental no processo regenerativo das nadadeiras dos peixes, uma vez que a velocidade de cicatrização dessa estrutura leva a um processo regenerativo mais rápido e, também, age como uma defesa contra o ambiente externo. Assim, devido à rápida regeneração que a epiderme apresenta, tivemos como objetivo, neste trabalho, estudar a histologia da dinâmica regenerativa da epiderme das nadadeiras caudais da carpa (Cyprinus carpio) ao microscópio de luz e eletrônico de transmissão. A regeneração da epiderme tem início já nas primeiras horas após a amputação das nadadeiras e continua durante todo o processo regenerativo. Após 24 horas, uma capa epidermal apical é estabelecida. Prolongamentos citoplasmáticos e junções intercelulares são observados e as células da camada basal da epiderme passam da forma cúbica para a cilíndrica, devido ao desenvolvimento das organelas citoplasmáticas responsáveis pela síntese da membrana basal perdida após a amputação da nadadeira. Estes resultados mostram a importância de estudos histológicos em processos regenerativos. Acreditamos que a associação da biologia molecular a estes estudos histológicos poderá elucidar ainda melhor esta dinâmica regenerativa.

Teleostean fins when partially amputated suffer a regenerative process called epimorphic regeneration, characterized by the following stages: healing, based on the formation of a multistratified epidermal layer, the formation of a mass of pluripotent cells known as blastema, the differentiation of these cells, the synthesis and disposition of the extracellular matrix, morphological growth and restoration. The epidermis has a fundamental role in the regenerative process of fish fins, as the healing time of this structure leads it to a faster regenerative process and it also works as a defense against the external environment. In this sense, due to the fast regeneration shown by the epidermis, the aim of this paper is to study the histology of the regenerative dynamics of the carp fin tail (Cyprinus carpio), under the light and transmission electron microscope. Epidermic regeneration begins right in the first hours after the fin amputation and it continues throughout the regenerative process. After 24 hours, an apical epidermal cap is established. Cytoplasmatic prolongations and intercellular junctions are observed and the cells of the basal layer of the epidermis change from the cubic form to the cylindrical, due to the development of the cytoplasmatic organelles responsible for the synthesis of the basal membrane, lost after amputation. These results show the importance of histological studies in regenerative processes. We believe that the association of molecular biology with histological studies can throw further light onto these regenerative dynamics.

A borda da nadadeira caudal de teleósteo é sustentada por um conglomerado de espículas pequenas, rígidas e fusiformes chamadas actinotriquias. Essas estruturas, após a amputação, apresentam uma capacidade regenerativa extremamente rápida. Neste trabalho estudamos o efeito de uma droga anti-inflamatória não esteroide, o naproxeno, utilizada no tratamento de doenças articulares degenerativas, durante o processo de regeneração da actinotriquia. Para isso foram feitas análises histoquímicas e ultraestruturais do tecido em regeneração de animais em contato com a droga comparada com animais em condições normais, ou seja, sem contato com a droga em questão. Os animais em contato com a droga apresentaram a regeneração da actinotriquia de modo semelhante ao dos animais mantidos em condições normais, indicando que o naproxeno, na dose utilizada neste trabalho, não interferiu na síntese das actinotriquias durante o processo regenerativo da nadadeira caudal. Isto talvez seja porque o naproxeno não tenha influenciado a expressão dos genes necessários para o processo de regeneração, tal como o gene Sonic hedgehog (Shh), que está envolvido na formação da actinotriquia.

A conglomerate of small, rigid, fusiform spicules known as actinotrichia sustains the edge of tail fins of teleost. After amputation, these structures show an extremely fast regenerative capacity. In this study we observed the effect of a nonsteroidal anti-inflammatory drug, naproxen, used in the treatment of degenerative articular diseases, during the process of actinotrichia regeneration. For this purpose, regenerating tissue from animals in contact with the drug was submitted to histochemical and ultrastructural analysis in comparison to tissue from animals under normal conditions, i.e., not in contact with the drug in question. Actinotrichia regeneration was similar in both animals, indicating that naproxen, at the dose used in the present study, did not interfere with actinotrichia synthesis during the regenerative process of the tail fin. This could be because naproxen did not influence the expression of the genes required for the regeneration process, such as the Sonic hedgehog (Shh) gene, which is involved in actinotrichia formation.