Resumen Los fitoplasmas del grupo 16SrIV causan enfermedades tipo amarillamiento letal (STAL) en palmas a nivel mundial. El fitoplasma del amarillamiento letal del cocotero (ALC) se conoce como ‘Candidatus Phytoplasma palmae’ (16SrIV-A). Al igual que en el ALC, muchas enfermedades causadas por fitoplasma a nivel mundial, sus vectores no han sido identificados. El único vector del fitoplasma del ALC incriminado es Haplaxius crudus (Hemiptera: Cixiidae). El objetivo del presente estudio fue determinar la presencia del fitoplasma 16SrIV en cíxiidos y dérbidos asociados a palmas (Adonidia merrillii y Cocos nucifera) positivas a fitoplasmas. Se realizaron capturas de insectos asociados a estas palmas durante la mañana y tarde. La presencia de fitoplasma fue determinada por PCR en tiempo real, empleando los cebadores TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) y LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT); sonda LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). No se detectó la presencia de fitoplasma del grupo 16SrIV en H. crudus aunque sí se mostró su presencia en H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) y Persis foveatis (Hemiptera: Derbidae). Estos resultados sugieren que estas tres especies pueden ser potenciales vectores del fitoplasma del grupo 16 SrIV en palmas.

Abstract The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.

Pachycoris torridus (Scopoli) tem sido registrada sobre dez espécies de plantas no Brasil, sendo uma praga comum da cultura do pinhão (Jatropha curcas). Neste trabalho registra-se pela primeira vez a ocorrência deste percevejo sugando frutos de acerola (Malpighia glabra).

Pachycoris torridus (Scopoli) has been recorded on ten species of plants in Brazil, where is a common pest of purging-nut plant (Jatropha curcas). In this work, the occurrence of this bug, sucking fruits of the Barbados cherry plant (Malpighia glabra), is recorded for first time.