Molecular marker assisted selection for increasing inbreeding in S<sub>1</sub> populations of cassava

OLIVEIRA, PAULO HENRIQUE G.A. DE; BARBOSA, ANA CLAUDIA O.; DINIZ, RAFAEL P.; OLIVEIRA, EDER J. DE; FERREIRA, CLAUDIA F.

doi:10.1590/0001-3765201820180278

Acessibilidade / Reportar erro

Brasil

Anais da Academia Brasileira de Ciências

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Agrarian Sciences • An. Acad. Bras. Ciênc. 90 (04) • Oct-Dec 2018 • https://doi.org/10.1590/0001-3765201820180278 copy

Molecular marker assisted selection for increasing inbreeding in S₁ populations of cassava

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

The objective of the present work was to use MAS in self-pollinated cassava populations for obtaining individuals with high inbreeding (f) aimed at rapid development of partial inbred lines. Three progenies (F0222, F1378 and F1662) were self-pollinated, generating a total of 233 S₁ individuals. The progenies and the S₁ individuals were evaluated in the seedlings and clonal evaluation trials (CETs). In the CET, plants were evaluated for the following traits: plant height (PH), root dry matter content (DMC), above ground yield (AGY), root (RY) and starch yield (SY). Twenty-seven microsatellites and five minisatellites were used to determine the level of inbreeding of the S₁ individuals. Inbreeding (f) values varied from 0.15 to 0.89 within progenies, whereas most of the S₁ individuals presented f values above 0.50. In average, 25% of the S₁ individuals were selected, which resulted in a 38% inbreeding increase in the cassava progenies. In contrast, phenotypic selection showed no differences in inbreeding increase. Furthermore, there was no correlation between the level of inbreeding and agronomic traits. MAS was efficient for the identification and selection of cassava S₁ individuals, with higher inbreeding values contributing to the decrease in the breeding cycles necessary to obtain new cassava inbred lines.

Key words
partial inbred lines; Manihot esculenta Crantz; microsatellites; self-pollination

Markers	Reference	Forward	Reverse	bp	AT (ยบC)	Markers per S1 progeny
Markers	Reference	Forward	Reverse	bp	AT (ยบC)	F022	F1378	F166
SSRY101	Mba et al. (2001)MBA REC, STEPHENSON P, EDWARDS K, MELZER S, NKUMBIRA J, GULLBERG U, APEL K, GALE M, TOHME J and FREGENE M. 2001. Simple sequence repeat (SSR) markers survey of the cassava (Manihot esculenta Crantz) genome: towards an SSR-based molecular genetic map of cassava. Theor Appl Genet 102: 21-31.	ggagaataccaccgacagga	acagcagcaatcaccatttc	213	55		X
SSRY103	Mba et al. (2001)	tgagaaggaaactgcttgcac	cagcaagaccatcaccagttt	272	55		X	X
SSRY105	Mba et al. (2001)	caaacatctgcacttttggc	tcgagtggcttctggtcttc	225	55	X
SSRY106	Mba et al. (2001)	ggaaactgcttgcacaaaga	cagcaagaccatcaccagttt	270	55		X	X
SSRY13	Mba et al. (2001)	gcaagaattccaccaggaag	caatgatggtaagatggtgcag	234	55	X
SSRY143	Mba et al. (2001)	gctcatgaactgagccttca	agcagatccaaatcactgaaa	153	55	X
SSRY165	Mba et al. (2001)	aaatgagttgcaaaggccaa	ggtaaacaaatgatgtggtgttc	243	55			X
SSRY168	Mba et al. (2001)	acagccacacttgttctcca	ctgcaatctccaacagcaac	277	45	X	X
SSRY170	Mba et al. (2001)	tctcgatttggtttggttca	tcatccttgttgcagcgtta	299	55	X		X
SSRY175	Mba et al. (2001)	tgactagcagacacggtttca	gctaacagtccaataacgataagg	136	55		X
SSRY179	Mba et al. (2001)	caggctcaggtgaagtaaagg	gcgaaagtaagtctacaacttttctaa	226	55	X	X	X
SSRY182	Mba et al. (2001)	ggaattctttgcttatgatgcc	ttcctttacaattctggacgc	253	55		X
SSRY28	Mba et al. (2001)	ttgacatgagtgatattttcttgag	gctgcgtgcaaaactaaaat	180	55		X
SSRY30	Mba et al. (2001)	ccatccactagaaactttaaaagca	caactcagcggagctttttc	220	55		X
SSRY49	Mba et al. (2001)	tgaaaatctcactggcattattt	tgcaaccatagtgccaagc	300	55	X	X	X
SSRY68	Mba et al. (2001)	gctgcagaatttgaaagatgg	cagctggaggaccaaaaatg	287	55		X	X
SSRY8	Mba et al. (2001)	agtggtttgagaagactggtga	tttccaaaatggaacttcaaa	288	45	X		X
SSRY81	Mba et al. (2001)	ggcgatttcatgtcatgctt	tgattttctgcgtgatgagc	204	55	X
SSRY82	Mba et al. (2001)	tgtgacaattttcagatagcttca	caccatcggcattaaactttg	211	55			X
SSRY83	Mba et al. (2001)	tggctagatggtgattattgctt	tgcttactctttgattccacg	239	55	X
SSRY93	Mba et al. (2001)	tttgttgctcacatgaaaacg	cagatttcttgtggtgcgtg	289	55			X
SSRY94	Mba et al. (2001)	aggatggacttggagatgga	ggtggaagtaaggctgttagtg	268	55		X	X
EME189	Kunkeaw et al. (2011)KUNKEAW S, YOOCHA T, SRAPHET S, BOONCHAN AWIWAT A, BOONSENG O, LIGHTFOOT DA, TRIWITAYAKORN K and TANGPHATSORNRUANG S. 2011. Construction of a genetic linkage map using simple sequence repeat markers from expressed sequence tags for cassava (Manihot esculenta Crantz). Mol Breed 27: 67-75.	cagagcacatccagaaattgtt	gaaatagatcaagtgccccatc	180	60	X	X
EME205	Kunkeaw et al. (2011)	ccagagcgtataactggaac	tgcaggagtgtggatatggtt	250	55	X		X
EME260	Kunkeaw et al. (2011)	gttggagttgtagttgctgc	catgggctgtgaaaatgaact	160	58	X	X	X
EME395	Kunkeaw et al. (2011)	tcaaaggtatcggggaggtag	gtttaccccactaacatcgcat	200	58	X	X
EME425	Kunkeaw et al. (2011)	cctccacaaccttatcaatca	cggtagccatagccataaca	140	55			X
VNTR4	C.D. Carmo, Unpublished	aatcatatcaggggctggtg	cgagggaaatgctgacctt	220	58	X	X
VNTR5	C.D. Carmo, Unpublished	ttgcttccaatcttctcaca	gatcaaaacgggcttgaaat	233	58		X	X
VNTR71	C.D. Carmo, Unpublished	tgcagataaactccaaaagtaagaa	gcttcatggttgaggctctt	589	60	X	X	X
VNTR72	C.D. Carmo, Unpublished	gcttaggcgggaagaaaatg	tgttcaactgcctctctttgc	828	58	X
VNTR90	C.D. Carmo, Unpublished	gaaccgtgaacagtaaccgata	cccggctgtttcaataaaat	835	60	X

Progeny	Parameter	Minimum	Maximum	Average
F0222	Ho	0.17	0.78	0.51
	f	0.22	0.83	0.49
F1378	Ho	0.11	0.72	0.51
	f	0.25	0.89	0.49
F1662	Ho	0.25	0.81	0.52
	f	0.15	0.74	0.49

F0222				F1378				F1662
Primer	Ho	He	Cr	Primer	Ho	He	Cr	Primer	Ho	He	Cr
EME189	0.54	0.49	9	EME189	0.56	0.50	9	EME205	0.56	0.50	1
EME205	0.49	0.50	1	EME260	0.50	0.48	11	EME260	0.51	0.49	11
EME260	0.51	0.50	11	EME395	0.56	0.49	6	EME425	0.57	0.49	5
EME395	0.54	0.50	6	SSRY101	0.49	0.49	7	SSRY103	0.47	0.49	12
SSRY08	0.61	0.50	3	SSRY103	0.60	0.50	12	SSRY106	0.47	0.49	12
SSRY105	0.44	0.50	14	SSRY106	0.62	0.49	12	SSRY165	0.55	0.50	13
SSRY13	0.53	0.50	2	SSRY168	0.63	0.50	6	SSRY170	0.38	0.49	14
SSRY143	0.51	0.50	11	SSRY175	0.65	0.49	3	SSRY179	0.51	0.49	4
SSRY170	0.48	0.50	14	SSRY179	0.44	0.50	4	SSRY49	0.58	0.50	2
SSRY179	0.56	0.50	4	SSRY182	0.51	0.48	9	SSRY68	0.57	0.50	4
SSRY49	0.57	0.50	2	SSRY28	0.61	0.50	12	SSRY8	0.56	0.50	3
SSRY68	0.56	0.49	4	SSRY30	0.49	0.48	13	SSRY82	0.49	0.49	5
SSRY81	0.56	0.46	5	SSRY49	0.65	0.50	2	SSRY93	0.57	0.49	3
SSRY83	0.35	0.50	12	SSRY68	0.44	0.50	4	SSRY94	0.53	0.50	11
VNRT04	0.52	0.49	11	SSRY94	0.56	0.49	11	VNTR05	0.51	0.49	10
VNRT71	0.51	0.50	15	VNTR04	0.43	0.48	11	VNTR71	0.52	0.50	15
VNTR72	0.54	0.50	1	VNTR05	0.62	0.50	10
VNTR90	0.49	0.50	11	VNTR71	0.37	0.47	15
Average	0.51	0.49		Average	0.51	0.49		Average	0.52	0.49

Academia Brasileira de Ciências Rua Anfilófio de Carvalho, 29, 3º andar, 20030-060 Rio de Janeiro RJ Brasil, Tel: +55 21 3907-8100 - Rio de Janeiro - RJ - Brazil
E-mail: aabc@abc.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Correspondence to: Eder Jorge de Oliveira E-mail: eder.oliveira@embrapa.br

Brasil

Brasil

Molecular marker assisted selection for increasing inbreeding in S1 populations of cassava

Abstract

Molecular marker assisted selection for increasing inbreeding in S₁ populations of cassava