[Salmonella Minnesota poultry origin has virulence factors and potential risk to human]

Melo, R.T.; Resende, A.R.; Mendonça, E.P.; Nalevaiko, P.C.; Monteiro, G.P.; Buiatte, A.B.G.; Rossi, D.A.

doi:10.1590/1678-4162-10884

Acessibilidade / Reportar erro

Brasil

Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Medicina Veterinária • Arq. Bras. Med. Vet. Zootec. 72 (04) • Jul-Aug 2020 • https://doi.org/10.1590/1678-4162-10884 copy

[Salmonella Minnesota poultry origin has virulence factors and potential risk to human]

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

The aim of this study was to evaluate virulence characteristics, antimicrobial resistance profile and the pattern of genetic similarity of 71 strains of Salmonella Minnesota isolated in the production chain of broilers between 2009 and 2010, into two units of a company (A and B). Isolates were serotyped and submitted to antimicrobial susceptibility by disk diffusion test. Using PCR, the presence of genes invA, lpfA, agfA and sefA and the genes conferring resistance to beta-lactam (bla_TEM, bla_SHV and bla_CTX-M) were evaluated. The phylogenetic relationship was determined by the RAPD-PCR method. The highest percentages of resistance were to tetracycline and sulfonamide. Eight antimicrobial resistance profiles were recognized among strains isolated in industry A, and 11 resistance profiles in industry B. Of all strains of both industries, 100% were positive for the invA gene, 98.6% to agfA gene, 49.3% for lpfA gene, and no strain showed the sefA gene. Three strains were positive for the gene bla_TEM (4.2%), 11 (15.5%) for the bla_CTX-M gene. Phylogenetic evaluation showed the presence of seven clusters with similarity greater than 80% and three distinct profiles. Based on the dendrogram we observed the spread with similar profiles in both companies.

Keywords:
pathogenicity factors; antimicrobial resistance; salmonellosis

Universidade Federal de Minas Gerais, Escola de Veterinária Caixa Postal 567, 30123-970 Belo Horizonte MG - Brazil, Tel.: (55 31) 3409-2041, Tel.: (55 31) 3409-2042 - Belo Horizonte - MG - Brazil
E-mail: abmvz.artigo@gmail.com

Acompanhe os números deste periódico no seu leitor de RSS

[1] E-mail: roberta-melo@hotmail.com

Gene	Primers	Peso molecular	Referência
invA	F:5’GTGAAATTATCGCCACGTTCGGGCAA3’ R:5’TCATCGCACCGTCAAAGGAACC3’	284pb	*Oliveira et al. (2003*OLIVEIRA, S.D.; RODENBUSCH, C.R.; MICHAEL, G.B. et al. Detection of virulence genes in Salmonella Enteritidis isolates from different sources. Braz. J. Microbiol., v.34, p.123-124, 2003.)
sefA	F:5’GATACTGCTGAACGTAGAAGG3’ R:5’GCGTAAATCAGGATCTGCAGTAGC3’	488pb	*Oliveira et al. (2003*OLIVEIRA, S.D.; RODENBUSCH, C.R.; MICHAEL, G.B. et al. Detection of virulence genes in Salmonella Enteritidis isolates from different sources. Braz. J. Microbiol., v.34, p.123-124, 2003.)
agfA	F:5’TCCACAATGGGGCGGCGGCG3’ R:5’CCTGACGCACCATTACGCTG3’	350pb	*Collinson et al. (1993*COLLINSON, K.; DOIG, P.C.; DORAN, J.L. et al. Thin aggregative fimbriae mediate binding of Salmonella Enteritidis to fibronectin. J. Bacteriol., v.175, p.12-18, 1993.)
lpfA	F:5’CTTTCGCTGCTGAATCTGGT3’ R:5’CAGTGTTAACAGAAACCAGT3’	250pb	*Heuzenroeder et al. (2000*HEUZENROEDER, M.W.; MURRAY, C.J.; DALCIN, R.M. Molecular basis of benign colonization of Salmonella Sofia in chickens. Kingston: Rural Ind. R&D Corporation, 2000. v.1, 106p.)

Gene	Primers	Peso molecular	Referência
bla _TEM	F: 5’CAGCGGTAAGATCCTTGAGA3’ R: 5’ACTCCCCGTCGTGTAGATAA3’	643pb	*Chen et al. (2004*CHEN, S.; ZHAO, S.; WHITE, D.G. et al. Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats. Appl. Environ. Microbiol., v.70, p.1-7, 2004.)
bla _SHV	F: 5’GGCCGCGTAGGCATGATAGA3’ R: 5’CCCGGCGATTTGCTGATTTC3’	714pb	*Chen et al. (2004*CHEN, S.; ZHAO, S.; WHITE, D.G. et al. Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats. Appl. Environ. Microbiol., v.70, p.1-7, 2004.)
bla _CTX-M	F: 5’ATGTGCAGYACCAGTAARGTKATGGC3’ R: 5’TGGGTRAARTARGTSACCAGAAYCAGCGG3’	593pb	*Monstein et al., (2007*MONSTEIN, H.J.; ÖSTHOLM-BALKHED, Å.; NILSSON, N.V. et al. Multiplex PCR amplification assay for rapid detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS, v.115, p.1400-1408, 2007.)

Perfis	Resistência antimicrobiana*	Número de classes¹	Número de cepas (%)
A1	SUL TET	2	16 (50,0)
A2	SUL TET (AMO)	3	1 (3,1)
A3	SUL TET GEN	3	2 (6,2)
A4	SUL TET AMO	3	7 (21,9)
A5	SUL TET AMO (CAZ)	3	1 (3,1)
A6	SUL TET TRI (AMO)	4	2 (6,2)
A7	SUL TET AMO CAZ	3	1 (3,1)
A8	Multissensíveis	-	2 (6,2)
	Total		32 (100,0)

Perfis	Resistência antimicrobiana*	Número de classes¹	Número de cepas (%)
B1	SUL TET	2	10 (25,6)
B2	SUL TET (NEO)	3	10 (25,6)
B3	SUL TET (AMO)	3	1 (2,6)
B4	SUL TET (AMO) (NEO)	4	2 (5,1)
B5	SUL TET TRI	3	2 (5,1)
B6	SUL TET TRI (NEO)	4	3 (7,6)
B7	SUL TET TRI (AMO)	4	1 (2,6)
B8	SUL TET AMO	3	1 (2,6)
B9	SUL TET AMO (NEO)	4	4 (10,3)
B10	SUL TET TRI CLO (AMO) (NEO)	6	1 (2,6)
B11	Multissensíveis	-	4 (10,3)
	Total		39 (100,0)