MOLECULAR ASSESSMENT OF FECAL LACTOBACILLI POPULATIONS IN CHILDREN WITH FUNCTIONAL CONSTIPATION

Avaliação molecular de populações fecais de lactobacilos em crianças com prisão de ventre funcional

ABSTRACT

Background:

Investigation of the gut-specific bacterial strains including lactobacilli is essential for understanding the bacterial etiology of constipation.

Objective:

This study aimed to compare the prevalence and quantity of intestinal lactobacilli in constipated children and healthy controls.

Methods:

Forty children fulfilling Rome IV criteria for functional constipation and 40 healthy controls were recruited. Fecal samples were analyzed using species-specific polymerase chain reaction followed by random amplified polymorphic DNA-PCR and quantitative real-time PCR.

Results:

Totally, seven different species of lactobacilli were detected. Out of 80 volunteers, 65 (81.3%) were culture and species-specific PCR positive from which 25 (38.46%) constipated children and 40 (61.54%) healthy subjects. The most prevalent species were L. paracasei 21 (32.3%) followed by L. plantarum 18 (27.7%) among both healthy and patient groups. Analysis of the RAPD dendrograms displayed that strains isolated from constipated and non-constipated children have similarity coefficients of more than 90%. The qPCR assays demonstrated constipated children had a lower amount of total lactobacilli population (per gram of feces) than healthy controls.

Conclusion:

Our findings showed that the mere existence of various species of Lactobacillus in the gut does not enough to prevent some gastrointestinal disorders such as functional constipation, and their quantity plays a more important role.

Keywords:
Constipation; feces; Lactobacillus; prevalence

RESUMO

Contexto:

A investigação das cepas bacterianas específicas do intestino, incluindo lactobacilos, é essencial para a compreensão da etiologia bacteriana da prisão de ventre.

Objetivo:

Este estudo teve como objetivo comparar a prevalência e a quantidade de lactobacilos intestinais em crianças constipadas e controles saudáveis.

Métodos:

Foram recrutadas quarenta crianças que preenchem os critérios de Roma IV para prisão de ventre funcional e 40 controles saudáveis. As amostras fecais foram analisadas utilizando-se uma reação da cadeia de polimerase específica da espécie, seguida por DNA polimórfico amplificado aleatório e PCR quantitativo em tempo real.

Resultados:

Foram detectadas sete espécies diferentes de lactobacilos. Dos 80 voluntários, 65 (81,3%) eram cultura em PCR específico de espécies, dos quais 25 (38,46%) crianças constipadas e 40 (61,54%) indivíduos saudáveis. As espécies mais prevalentes foram L. paracasei 21 (32,3%) seguidas por L. plantarum 18 (27,7%) entre grupos saudáveis e de pacientes. A análise dos dendrogramas do RAPD mostrou que cepas isoladas de crianças constipadas e não constipadas têm coeficientes de similaridade superiores a 90%. Os ensaios qPCR demonstraram que as crianças constipadas apresentavam uma quantidade menor de população total de lactobacilos (por grama de fezes) do que os controles saudáveis.

Conclusão:

Nossos achados mostraram que a mera existência de várias espécies de Lactobacillus no intestino não é suficiente para prevenir alguns distúrbios gastrointestinais, como a prisão de ventre funcional, e sua quantidade desempenha um papel mais importante.

Palavras-chave:
Prisão de ventre; fezes; Lactobacillus; prevalência

INTRODUCTION

Functional constipation is a common and annoying problem in children with an estimated prevalence of around 3% worldwide. Functional constipation is often associated with infrequent bowel movements, fecal incontinence, painful defecation, and abdominal pain¹. Currently, the diagnosis of this functional gastrointestinal disorder is performed using Rome IV diagnostic criteria². The prevalence of constipation in children ranges from 0.7% to 29.6%, which constitutes 3% of the pediatric clinicians’ visits and 30% of children’s gastroenterologist referrals³. Although constipation may possess a variety of etiologies, alterations in gut flora, comprising the increase or decline of some species of the colonic microbiota, have been considered as possible pathogenesis of functional constipation in pediatrics⁴. To evaluate which probiotic strain may be useful in therapeutic strategies for functional constipation, a detailed description of the gut microbiota composition is crucial⁵. So far, probiotics and particularly Lactobacillus species have been used in several randomized controlled trials to treat various gastrointestinal disorders, including functional constipation⁶. However, given the paucity of data, it is unclear which probiotic species is most effective in the treatment of functional constipation^7,8. The objective of this research was therefore to assess the prevalence, genetic heterogeneity and total amount of lactobacilli population in constipated children’s fecal samples as compared to healthy controls utilizing species-specific polymerase chain reaction (PCR), randomly amplified polymorphic DNA-PCR (RAPD-PCR), and quantitative real-time PCR (qPCR).

METHODS

Subjects and study design

In this case-control study, we recruited 40 constipated patients from the tertiary pediatric gastroenterology department of the Abuzar children’s hospital in Ahvaz between August 2018 and July 2019. The inclusion criteria were as follows: aged between 4 and 18 years and fulfilling diagnostic criteria for functional constipation based on the Rome IV definitions, which were examined and approved by a pediatrician. Participants with other metabolic and gastrointestinal diseases, a history of intestinal surgery, a history of receiving antibiotics within four weeks before enrollment, intake of oral laxatives four weeks ago, neurologic diseases (such as Hirschsprung’s disease), mental retardation, and consumption of probiotics within 14 days before enrollment were excluded. The procedure of the study was explained to all participants and written consent was obtained from the children’s parents. Additionally, 40 healthy subjects without any gastroenterological complaints were recruited as a control group.

Sample collection and bacterial isolation

Of all the subjects, the fresh stool samples were collected in a sterile plastic container and refrigerated at 4°C immediately until transferred to the laboratory within 24 hours. After transportation, all samples were homogenized and divided into two sterile tubes with 1.5 g of sample each. One portion of fecal samples was frozen at -80°C until DNA extraction and the other part were immediately cultured in man rogosa sharp (MRS) broth (Biolife, Milano, Italy) and incubated at 37°C for 48 hours under a microaerophilic condition (EZ-Campy System, Maryland, USA) with a gas mixture (5% O₂, 10% CO₂, and 85% N2). The samples were then s-cultured on MRS agar (Biolife, Milano, Italy) and incubated at 37°C for 48 hours for selective lactobacilli outgrowth under microaerophilic conditions. The bacterial colonies that developed on the plates were subjected to gram staining, morphology examination, and catalase activity, and only those that were catalase-negative and gram-positive rod-shaped morphology were considered as tentative the lactobacilli and selected for further studies.

Reference strains

The reference strains used to validate the study tests were composed of: L. reuteri ATCC 23272, L. acidophilus ATCC 4356, L. plantarum ATCC 8014, L. rhamnosus ATCC 7469, L. paracasei ATCC 25598, L. casei ATCC 39392, and L. fermentum ATCC 9338. All reference strains were grown in MRS broth (Biolife, Milano, Italy) for 24 hours at 37ºC under microaerophilic conditions (5% O₂, 10% CO₂, and 85% N2).

DNA isolation

As previously described⁹, bacterial DNA was extracted for species-specific PCR and RAPD tests, with some modifications: the bacterial isolates were freshly grown until an OD 600 nm about 1.0 in MRS broth, and one milliliters of each culture was centrifuged at 10,000 × g for 5 min. The bacterial pellets were washed twice with TE buffer (Tris-HCl [10 mM]: EDTA [1 mM]) and resuspended in 200 μl of TE buffer. The cells were then treated for 30 min at 37°C with lysozyme (2.5 mg/mL) (Qiagen, Hilden, Germany) and Proteinase K (250 mg/mL) (Qiagen, Hilden, Germany) to ensure complete degradation of bacterial cell walls. The suspension vortexed and subjected to a heating temperature of 100°C for 15 min using Incublock microtube incubators (Denville Scientific, USA). After boiling, the suspension was cooled immediately to -20°C for 15 minutes and then centrifuged for 5 minutes at 14,000 rpm. The supernatants were transferred to new microtubes and were used as DNA. The extracted DNA was then stored at -20 °C until analysis. Fecal DNA was extracted using a QIAamp DNA stool mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Genus-specific and species-specific qualitative PCR

The oligonucleotide primers specifications for lactobacilli detection are listed in Table 1 ^10-15. Molecular identification of isolates at the genus level was carried out by qualitative PCR amplification of 16S-23S ribosomal RNA intergenic spacer region (ISR) according to the protocol of Turková¹⁶. After confirming the genus, species-specific qualitative PCR was employed for the identification of seven different Lactobacillus species. PCR reactions were performed in a total volume 25 μl, containing 12.5 μl of 1X PCR Master Mix (Ampliqon, Denmark), 3 μL of DNA template, 10 pmol of each primer, and distilled water to complete the PCR reaction volume. The thermal cycler program comprising an initial denaturation step at 94°C for 4 min, followed by 35 cycles of 94°C for 1 min, primer annealing (temperatures are given in Table 1) for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 5 min. The amplification was performed in a C 1000 Bio-Rad Thermal Cycler (Bio-Rad Laboratories, Inc.). All amplification products were separated by electrophoresis on 2% agarose gel, stained with 0.5 μg/mL ethidium bromide (Sinaclon, Tehran, Iran) and visualized under a UV transilluminator (ProteinSimple, San Jose, CA, USA). In every PCR run, a reagent blank, which contained all components of the reaction mixture with the exception of the DNA template, was included as the negative control.

TABLE 1
Primers of genus and species-specific PCR.

Specificity	Primers	Sequence (5’-3’)	Annealing T (°C)	Amplicon length (bp)	Reference
Lactobacillus spp.	LbLMA 1rev R16-1	CTCAAAACTAAACAAAGTTTC CTTGTACACACCGCCCGTCA	55	250	[10]
L. casei	LcasF LcasR	TTTGAGGGGACGACCCTCAAGCA CGCCGACAAGCTATGAATTCACTTG	55	339	[11]
L. paracasei	LpacaF LpacaR	GATATTGCCTTCACGGTTTCAC TTGAARTCAACCATTGAGCG	65	125	[12]
L. rhamnosus	LrhamF LrhamR	GACTTCTCAACCAGCAGCGCAGA TGCATTTCCCCGCTTTCATGACT	68	801	[13]
L. fermentum	LFerF LFerR	GCCGCCTAAGGTGGGACAGAT CTGATCGTAGATCAGTCAAG	55	276	[14]
L. plantarum	Lpla-3 Lpla-4	ATTCATAGTCTAGTTGGAGGT CCTGAACTGAGAGAATTTGA	59	248	[15]
L. reuteri	Lreu-1 Lreu-4	GGCGGCTGTCTGGTCTGCAA GCTTGTTGGTTTGGGCTCTTC	55	303	[15]
L. acidophilus	LacidoF LacidoR	TGCAAAGTGGTAGCGTAAGC CCTTTCCCTCACGGTACTG	47	207	[15]

Strain typing by RAPD-PCR analyses

The primer M13 (GAGGGTGGCGGTTCT)¹⁷ was used for amplification. The PCR reaction was carried out in a total volume of 25 μL, containing 2 μL of primer M13 (10 pmol μL−1), 12.5 μl of 1X PCR Master Mix (Ampliqon, Denmark), 3 μL of genomic DNA (10 ng μL−1), 7.5 μL sterile deionized water. The amplification was carried out in the Eppendorf thermocycler 5530 (Roche, Mannheim, Germany) by using the following program: initial denaturation at 94°C for 5 min, followed by 40 cycles at 94°C for 1 min, primer annealing for 1 min at 45°C, and primer extension for 1 min at 72°C with a final extension period at 72°C for 10 min. PCR products were then separated by electrophoresis on 2% (w/v) agarose gel using 1x TBE buffer containing 0.5 μg /mL ethidium bromide (Sinaclon, Tehran, Iran) at 80 V for 2 h. A DNA marker 100bp ladder (Ampliqon, Denmark) was used as a molecular weight standard. RAPD-PCR fingerprints analysis and clustering were processed by the BioNumerics software version 6.6 (Applied Maths, Belgium). Similarities were calculated using the Pearson correlation coefficients. The dendrograms were acquired by means of the clustering algorithm of the Unweighted Pair Group Method using Arithmetic Average (UPGMA).

Sequencing and analysis of PCR products

To confirm the identification of the Lactobacillus isolates that investigated by using qualitative PCR, as well as to verification of strain specificity of the primers, purified amplicons were sequenced using the species-specific primers. From each cluster obtained by the RAPD method, one to five isolates were selected for sequencing. This analysis was conducted at the Genetics research laboratory of Rajaie Cardiovascular, Medical and Research Center, Tehran, using their standard protocol. All the obtained sequences were verified in the GenBank DNA database by using the BLAST algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (NCBI).

Quantitative real-time PCR

To measure the quantity of total lactobacilli in each fecal sample, qPCR was performed using genus-specific primer sets (Table 1). Amplifications were conducted in an ABI StepOne (Applied Biosystems, USA) according to the previously described protocol¹⁸. Standard curves were generated using serial 10-fold dilutions (10¹ to 10⁷ copies) of fecal bacterial DNA of known concentration. The lactobacilli copy numbers in fecal samples were determined from the values of the threshold cycle (Ct) and represented as the amount of bacteria/gram of feces.

Statistics

The qualitative variables were analyzed using the chi-square test and the exact Fisher test. The significance level was considered less than or equal to the test-wise error rate of 0.05 in all tests. All statistical test was done using SPSS software (version 24; SPSS, Inc., Chicago, IL, USA), version 2016 of Microsoft Office Excel, and version 8 of GraphPad Prism (GraphPad Software, Inc.).

Ethical consideration

The Institutional Review Board (IRB) and Research Ethics Committee of Medical Faculty of the University approved this project (Code: IR.AJUMS.REC.1397.433) and the necessary permission for collecting the sample was granted.

RESULTS

Lactobacillus profiling by qualitative PCR

In the present study, out of 80 stool samples, culture-positive 65 (81.3%) ones were analyzed by genus and species-specific qualitative PCR from which 25 (38.46%) and 40 (61.54%) samples were collected from constipated and non-constipated children, respectively. In total seven different Lactobacillus species were identified in both healthy and patient groups. The most prevalent species were L. paracasei 21 (32.3%) followed by L. plantarum 18 (27.7%) and the less prevalent species was L. acidophilus 3 (4.6%). There were no statistically significant differences in the prevalence of Lactobacillus species between constipated and non-constipated children (Table 2). Each of the twenty-five of constipated patients was colonized by only one Lactobacillus strain, whereas five out of all healthy subjects were colonized by two distinct genetic strains in the stool specimen.

TABLE 2
Prevalence of Lactobacillus species, detected by Genus and species-specific PCRs.

Non constipated N (%)		Constipated	Total	P -value
		N (%)	N (%)
Lactobacillus spp.	40 (61.5)	25 (38.5)	65 (81.3)	0.264*
L. plantarum	10 (15.4)	8 (12.3)	18 (27.7)	0.637*
L. paracasei	13 (20)	8 (12.3)	21 (32.3)	0.275*
L.rhamnosus	6 (9.2)	3 (4.6)	9 (13.8)	0.508€
L. reuteri	3 (3.1)	2 (4.6)	5 (7.7)	>0.999€
L. casei	2 (3.1)	2 (3.1)	4 (6.2)	>0.999€
L. fermentum	3 (4.6)	2 (3.1)	5 (7.7)	>0.999€
L. acidophilus	3 (4.6)	0	3 (4.6)	>0.999€

• *Pearson’s chi-square test; €: Fisher’s exact test.

RAPD-PCR analysis

After initial identification of Lactobacillus using species-specific PCR method, the genetic heterogeneity of strains belonging to each of seven distinct species was determined by the numerical evaluation of DNA profiles obtained with RAPD-PCR technique in both groups of patients and healthy subjects. Cluster analysis was performed similarly with UPGMA estimates, and the determined dendrograms obtained revealed the genetic relationships between lactobacilli isolates and reference strains. In total, seven main clusters were determined at an arbitrarily chosen similarity level of 45% or above (Figure 1) and were allocated to each of the seven intended species in the study. The clusters of L. paracasei and L. plantarum species composed of three and four sub-cluster, respectively, whereas clusters of L. fermentum, L. rhamnosus, L. casei, L. reuteri, and L. acidophilus species have only two sub-clusters, each of them has an internal correlation coefficient of about 60% to 98%. As shown in Figure 1, strains isolated from constipated patients with strains obtained from the control group were genotypically closely related and have a similarity coefficient of more than 90%.

FIGURE 1
Dendrogram generated from RAPD-PCR patterns using the M13 primer from clinical and reference Lactobacillus species. Strains belonging to each of seven Lactobacillus species formed single specific clusters at similarity levels exceeding 60%.

DNA sequencing and accession numbers

Sequencing of the target gene of selected Lactobacillus isolates of each species was done to confirm the species as indicated by species-specific PCR. Totally 22 isolates were sequenced and submitted to the GenBank database under the accession numbers MN190691 - MN190699, MN184661 - MN184668 and MN186307 - MN186311.

Quantification of lactobacilli in feces

Using genus-specific qPCR assay, the amount of Lactobacillus spp. in the feces of both constipated and healthy children was further assessed. The results of genus-specific quantitative PCR showed that in healthy controls, the total counts of lactobacilli were significantly higher in comparison with constipated children (mean 6.26 (SD 0.3) log₁₀ CFU/gram of feces versus mean 4.33 (SD 0.63) log₁₀ CFU/gram of feces; P<0·0001) (Figure 2).

FIGURE 2
Box and whiskers plots presenting the amounts of Lactobacillus spp. in constipated children and healthy controls by real-time PCR. The results of Mann Whitney test showed that there was a significant difference between log10 CFU/gram feces in both groups.

DISCUSSION

The potential association between functional gastrointestinal disorder and probiotics is attractive and opens interesting therapeutic and preventive strategies in the probiotic and gastrointestinal researches⁶. Improved gastrointestinal motility with some type of Lactobacillus (especially L. reuteri and L. acidophilus) and B. bifidum were observed in some experiments^19-22. In the present study, based on species-specific PCR analysis, no significant differences were observed in the prevalence of intestinal Lactobacillus species in healthy and constipated children. Moreover, in agreement with previous results^23,24, we found that in the healthy subjects and constipated group, L. paracasei and L. planetarium species were predominant types of lactobacilli (prevalence of these species, 32.3% and 27.7%, respectively).

Several systematic reviews and meta-analyisis do not recommend routine use of probiotics in the treatment of constipation^25-28.

Even though many useful genotyping techniques have been applied for differentiating and genetic diversity of lactobacilli strains, these methods have pitfalls and limitations such as cost, complexity, and time-consuming²⁹. RAPD PCR, by contrast, is rapid, simple, and cost-effective and has been found useful for differentiation between species of Lactobacillus. In this study, RAPD-PCR with M13 primer was employed for differentiation between strains and assessment of intraspecies variability. Analysis of the consensus dendrograms (Figure 1) displayed that very closely genetically related strains of the same species, presumably belonging to the same clonal generation, which sorted at a similarity coefficient >90%. This was similar to the earlier findings reported by other authors^30,31.

Until now, the 16S rRNA gene sequencing has been widely used as a valuable tool for identifying bacteria at the species level due to its universality and technical easiness³². In a recent study, 98.65% was proposed by Kim et al. as the species demarcation cut-off value for 16S rRNA gene sequence similarity⁸. On the other hand, since the similarity of 16S rRNA gene sequences between closely related species, such as different Lactobacillus species can reach more than 99%, may not be the suitable target to design a very specific primer sets for this gene³³. To resolve this problem, protein-encoding genes, as well as intergenic sequences of the 16S-23S rRNA spacer region, have been proposed as two alternatives to 16S rRNA gene sequence^12,34. In this study, it has been shown that 16S-23S rRNA and protein-encoding genes are suitable targets for the specific quantification of Lactobacillus species. It was also found that all the seven primer pairs used in our study are capable to identify corresponding genes from closely related Lactobacillus species in the fecal sample.

In recent years, many researchers have been using the SYBR green qPCR approach to identify various non-predominant organisms in stool specimens^18,35-37. In this research, the fecal lactobacilli flora colonizing the intestines of both healthy and patient groups was examined using genus-specific qPCR primers. In the present study, lactobacilli were detected by the culture and conventional PCR methods in 65 (81%) of the fecal samples, and by quantitative PCR in all samples. The present results confirm the previous reports^38,39, which indicates the qPCR technique’s higher diagnostic capability than the other two approaches in complex samples. Following our study, Štšepetova et al.³⁹ used the real-time PCR approach for quantification of total lactobacilli, as well as conventional PCR for assessing intended Lactobacillus species in the human feces. Furthermore, they also showed that there was no correlation distinguished between the type and number of species and the count of lactobacilli. Overall, based on the qPCR results, we observed a significantly lower quantity of lactobacilli in patients with functional constipation compared to healthy controls, which was in agreement with previous studies that showed low quantities of lactobacilli in constipated children using culture methods⁴⁰ and SYBR green qPCR⁴¹.

CONCLUSION

Finally, we found that children suffering from functional constipation had a smaller quantity of total lactobacilli per milligram of stool compared to healthy controls. It can be concluded from our findings that the mere existence of lactobacilli in the colon is not sufficient to impact and prevent certain gastrointestinal disorders such as childhood functional constipation, and their amounts plays a more pivotal role. Our future studies will focus on quantifying the Lactobacillus species in the gut of healthy subjects compared with constipated children by qPCR assay, as well as on elucidating their probiotic properties to prevent functional constipation.

ACKNOWLEDGMENTS

The authors of this manuscript would like to acknowledge the laboratory and nursing personnel of the children and infants ward in teaching hospitals in Ahvaz, who assisted to collect the clinical specimens. We also would like to acknowledge Dr. Ali Teimoori for his collaboration. This work was a part of PhD thesis of Nabi Jomehzadeh, which was approved in Cellular and Molecular Research Centre, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

REFERENCES

• ¹
  Tabbers MM, DiLorenzo C, Berger MY, Faure C, Langendam MW, Nurko S, et al. Evaluation and treatment of functional constipation in infants and children: evidence-based recommendations from ESPGHAN and NASPGHAN. J Pediatr Gastroenterol Nutr. 2014;58:258-74.
• ²
  Benninga MA, Nurko S, Faure C, Hyman PE, Roberts ISJ, Schechter NL. Childhood functional gastrointestinal disorders: neonate/toddler. Gastroenterology. 2016;150:1443-55. e1442.
• ³
  Huang R, Hu J. Positive effect of probiotics on constipation in children: a systematic review and meta-analysis of six randomized controlled trials Front Cell Infect Microbiol. 2017;7:153.
• ⁴
  Ohkusa T, Koido S, Nishikawa Y, Sato N. Gut microbiota and chronic constipation: a review and update. Front Med. 2019;6:19.
• ⁵
  de Meij TG, de Groot EF, Eck A, Budding AE, Kneepkens CF, Benninga MA, et al. Characterization of microbiota in children with chronic functional constipation. PloS one. 2016;11:e0164731.
• ⁶
  Pärtty A, Rautava S, Kalliomäki M. Probiotics on pediatric functional gastrointestinal disorders. Nutrients. 2018;10:1836.
• ⁷
  Lee HJ, Choi JK, Ryu HS, Choi CH, Kang EH, Park KS, et al. Therapeutic modulation of gut microbiota in functional bowel disorders. J Neurogastroenterol Motil. 2017;23:9.
• ⁸
  Kim S-E, Choi SC, Park KS, Park MI, Shin JE, Lee TH, et al. Change of fecal flora and effectiveness of the short-term VSL# 3 probiotic treatment in patients with functional constipation. J Neurogastroenterol Motil . 2015;21:111.
• ⁹
  Pospiech A. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 1995;11:217-8.
• ¹⁰
  Dubernet S, Desmasures N, Guéguen M. A PCR-based method for identification of lactobacilli at the genus level. FEMS Microbiol Lett. 2002;214:271-5.
• ¹¹
  Jomehzadeh N, Javaherizadeh H, Amin M, Rashno M, Teimoori A. Quantification of intestinal lactobacillus species in children with functional constipation by quantitative real-time PCR. Clin Exp Gastroenterol. 2020;13:141.
• ¹²
  Huang C-H, Huang L. Rapid species-and subspecies-specific level classification and identification of Lactobacillus casei group members using MALDI Biotyper combined with ClinProTools. J Dairy Sci. 2018;101:979-91.
• ¹³
  Bottari B, Felis GE, Salvetti E, Castioni A, Campedelli I, Torriani S, et al. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay. Microbiology. 2017;163:950-60.
• ¹⁴
  Walter J, Tannock G, Tilsala-Timisjarvi A, Rodtong S, Loach D, Munro K, Alatossava T. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers. Appl Environ Microbiol. 2000;66:297-303.
• ¹⁵
  Garg KB, Ganguli I, Das R, Talwar G. Spectrum of Lactobacillus species present in healthy vagina of Indian women. Indian J Pediatr. 2009;129:652-7.
• ¹⁶
  Turková K, Rittich B, Španová A. Identification and determination of relatedness of lactobacilli using different DNA amplification methods. Chemical Papers. 2012;66:842-51.
• ¹⁷
  Rossetti L, Giraffa G. Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases. J Microbiol Methods. 2005;63:135-44.
• ¹⁸
  Junick J, Blaut M. Quantification of human fecal bifidobacterium species by use of quantitative real-time PCR analysis targeting the groEL gene. Appl Environ Microbiol . 2012;78:2613-22.
• ¹⁹
  Husebye E, Hellström PM, Sundler F, Chen J, Midtvedt T. Influence of microbial species on small intestinal myoelectric activity and transit in germ-free rats. Am J Physiol Gastrointest Liver Physiol. 2001;280:G368-80.
• ²⁰
  Ma X, Mao Y-K, Wang B, Huizinga JD, Bienenstock J, Kunze W. Lactobacillus reuteri ingestion prevents hyperexcitability of colonic DRG neurons induced by noxious stimuli. Am J Physiol Gastrointest Liver Physiol . 2009;296:G868-75.
• ²¹
  Wang B, Mao Yk, Diorio C, Wang L, Huizinga J, Bienenstock J, Kunze W. Lactobacillus reuteri ingestion and IKCa channel blockade have similar effects on rat colon motility and myenteric neurones. Neurogastroenterol Motil. 2010;22:98-e33.
• ²²
  Guarino MPL, Altomare A, Stasi E, Marignani M, Severi C, Alloni R, et al. Effect of acute mucosal exposure to Lactobacillus rhamnosus GG on human colonic smooth muscle cells. J Clin Gastroenterol. 2008;42:S185-90.
• ²³
  Tulumoglu S, Yuksekdag ZN, Beyatli Y, Simsek O, Cinar B, Yaşar E. Probiotic properties of lactobacilli species isolated from children’s feces. Anaerobe. 2013;24:36-42.
• ²⁴
  Mikelsaar M, Annuk H, Shchepetova J, Mändar R, Sepp E, Björkstén B. Intestinal lactobacilli of Estonian and Swedish children. Microb Ecol Health Dis. 2002;14:75-80.
• ²⁵
  Koppen IJ, Benninga MA, Tabbers MM. Is There A Role for Pre-, Pro- and Synbiotics in the Treatment of Functional Constipation in Children? A Systematic Review. J Pediatr Gastroenterol Nutr . 2016;63:(Suppl 1):S27-35.
• ²⁶
  Gomes D, Morais MB. GUT Microbiota and the use of probiotics in constipation in children and adolescents: systematic review. Rev Paul Pediatr. 2020;38:e2018123.
• ²⁷
  Wojtyniak K, Szajewska H. Systematic review: probiotics for functional constipation in children. Eur J Pediatr. 2017;176:1155-62.
• ²⁸
  Depoorter L, Vandenplas Y. Probiotics in pediatrics. Probiotics. 2022:425-50.
• ²⁹
  Mohania D, Nagpal R, Kumar M, Bhardwaj A, Yadav M, Jain S, et al. Molecular approaches for identification and characterization of lactic acid bacteria. J Dig Dis. 2008;9:190-8.
• ³⁰
  Sánchez I, Seseña S, Palop LL. Polyphasic study of the genetic diversity of lactobacilli associated with ‘Almagro’ eggplants spontaneous fermentation, based on combined numerical analysis of randomly amplified polymorphic DNA and pulsed-field gel electrophoresis patterns. J Appl Microbiol. 2004;97:446-58.
• ³¹
  Mercanti DJ, Carminati D, Reinheimer JA, Quiberoni A. Widely distributed lysogeny in probiotic lactobacilli represents a potentially high risk for the fermentative dairy industry. Int J Food Microbiol. 2011;144:503-0.
• ³²
  Srinivasan R, Karaoz U, Volegova M, MacKichan J, Kato-Maeda M, Miller S, et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS one . 2015;10:e0117617.
• ³³
  Ahlroos T, Tynkkynen S. Quantitative strain-specific detection of Lactobacillus rhamnosus GG in human faecal samples by real-time PCR. J Appl Microbiol . 2009;106:506-14.
• ³⁴
  Haarman M, Knol J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl Environ Microbiol . 2006;72:2359-65.
• ³⁵
  Yang YG, Song MK, Park SJ, Kim S. Direct detection of Shigella flexneri and Salmonella typhimurium in human feces by real-time PCR. J Microbiol Biotechnol. 2007;17:1616-21.
• ³⁶
  Wu ZW, Lu HF, Wu J, Zuo J, Chen P, Sheng JF, Zheng SS, Li LJ. Assessment of the fecal lactobacilli population in patients with hepatitis B virus-related decompensated cirrhosis and hepatitis B cirrhosis treated with liver transplant. Microb Ecol. 2012;63:929-37.
• ³⁷
  Kassinen A, Krogius-Kurikka L, Mäkivuokko H, Rinttilä T, Paulin L, Corander J, et al. The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects. Gastroenterology 2007;133:24-33.
• ³⁸
  Shen DH, Shi CR, Chen JJ, Yu SY, Wu Y, Yan WB. Detection of intestinal bifidobacteria and lactobacilli in patients with Hirschsprung’s disease associated enterocolitis. World J Pediatr. 2009;5:201-5.
• ³⁹
  Štšepetova J, Sepp E, Kolk H, Lõivukene K, Songisepp E, Mikelsaar M. Diversity and metabolic impact of intestinal Lactobacillus species in healthy adults and the elderly. Br J Nutr. 2011;105:1235-44.
• ⁴⁰
  Zoppi G, Cinquetti M, Luciano A, Benini A, Muner A, Minelli EB. The intestinal ecosystem in chronic functional constipation. Acta Paediatr. 1998;87:836-41.
• ⁴¹
  de Moraes JG, Motta ME, Beltrão MF, Salviano TL, da Silva GA. Fecal microbiota and diet of children with chronic constipation. Int J Pediatr. 2016;2016:6787269.

• Disclosure of funding: this study was financially supported by a grant (CMRC-9709) from Research Affairs, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Availability of data and materials; sequence data that support the findings of this study have been submitted to the GenBank database under the accession numbers MN190691 - MN190699, MN184661 - MN184668 and MN186307 - MN186311.

Publication Dates

• Publication in this collection
  06 July 2022
• Date of issue
  Apr-Jun 2022

History

• Received
  10 Dec 2021
• Accepted
  29 Mar 2022