Vancomycin and tetracycline-resistant enterococci from from raw and processed meats: phenotypic and genotypic characteristics of isolates

Enterococos resistentes à vancomicina e tetraciclina em carnes cruas e processadas: características fenotipicas e genotipicas

Abstract

The ubiquitous nature of enterococci and their ability to colonize different habitats account for their easy spread throughout the food chain. Here, we evaluated the distribution and antimicrobial susceptibility of Enterococcus isolates from meats obtained from different supermarkets. We acquired and cultured 100 products (raw chicken meat, raw pork, and boiled meats) to screen for the presence of Enterococcus spp. In total, 194 isolates were recovered from the samples, with contamination rates of 63.6% in the chicken samples, 31% in the raw pork meat, and 1.4% in the boiled meat samples. PCR amplification with specific primers was performed to screen the DNA of Enterococcus spp. (95/96), E. faecalis (66/96), E. faecium (30/96), and E. casseliflavus/E. flavescens (3/96). The antimicrobial susceptibility tests showed that all the isolates were resistant to at least one of the antibiotics. All E. faecium isolates were resistant to vancomycin, streptomycin, ciprofloxacin, norfloxacin, erythromycin, and tetracycline. The E. casseliflavus/E. flavescens isolates were resistant to gentamicin, streptomycin, ciprofloxacin, norfloxacin, erythromycin, and tetracycline. E. faecalis isolates were resistant to ciprofloxacin, tetracycline, and erythromycin (92%), norfloxacin (83%), vancomycin, and streptomycin (50%). The resistance genes tetL and vanB were detected by genotyping. The presence of these antimicrobial-resistant microorganisms in food might pose problems for public health.

Keywords:
Antimicrobials; PCR; vancomycin-resistant enterococci

Resumo

A natureza ubíqua dos enterococos e sua capacidade de colonizar diferentes habitats são responsáveis pela sua fácil disseminação pela cadeia alimentar. No presente estudo, avaliamos a distribuição e a susceptibilidade antimicrobiana de isolados de Enterococcus provenientes de produtos cárneos. Cem produtos (carne de frango cru, carne de porco crua e carne cozida) foram adquiridos e cultivados para a presença de Enterococcus spp. No total, 194 amostras foram avaliadas, com taxas de contaminação de 63,6% nas amostras de frango, 31% na carne de porco crua e 1,4% nas amostras de carne cozida. A amplificação por PCR foi realizada para confirmar a presença de Enterococcus spp. (95/96), E. faecalis (66/96), E. faecium (30/96) E. casseliflavus/E. flavescens (3/96). Resultados de susceptibilidade mostraram que 100% dos isolados foram resistentes a pelo menos um antibiótico, sendo 100% de E. faecium resistentes a vancomicina, estreptomicina, ciprofloxacina, norfloxacina, eritromicina e tetraciclina. E. casseliflavus / E. flavescens resistentes a gentamicina, estreptomicina, ciprofloxacina, norfloxacina, eritromicina e tetraciclina. E. faecalis foram resistentes a ciprofloxacina, tetraciclina e eritromicina (92%), norfloxacina (83%), vancomicina e estreptomicina (50%). Na genotipagem, foram detectados os genes tetL e vanB. A presença desses microrganismos resistentes aos antimicrobianos nos alimentos pode causar problemas para a saúde pública.

Palavras-chaves:
Antibióticos; enterococci vancomicina-resistante; PCR

Introduction

Enterococci are intestinal commensal bacteria of humans and animals and cause diseases in immunocompromised patients that are admitted in intensive care units for long periods or have severe underlying sicknesses⁽¹⁾; they can survive in a variety of environments, such as soil, water, plants, and food^(2;3). Enterococci are frequent contaminants of poultry meat and are also well-known agents in the food chain⁽⁴⁾. Although the significance of antimicrobial-resistant enterococci in food has not been well elucidated, bacteria that present with resistance-related characteristics in the environment may be considered genetic reservoirs of these genes⁽⁵⁾.

Enterococci have strikingly high levels of resistance to medically important antibiotic classes, particularly to those approved by the FDA for use in animal production, including macrolides, chloramphenicol, aminoglycosides, and vancomycin^(6;7). Vancomycin is an important agent for the treatment of serious infections caused by enterococcal species; however, the therapeutic efficacy of this antibiotic has been limited by the emergence of vancomycin-resistant enterococci (VRE)⁽⁸⁾. The most important vancomycin resistance gene is vanA. Several other species of enterococci, including E. durans, E. hirae, E. gallinarum, E. casseliflavus, E. raffinosus, E. avium, and E. mundtii possess this gene⁽⁹⁾.

Antibiotic-resistant enterococci, isolated from animals and foods, have been described in Europe and the USA^(10;11). In Brazil, these bacteria have been reported in the southern states^(12;13). Previously, researchers⁽¹⁴⁾ have reported the presence of antimicrobial-resistant Enterococcus species in soft cheese from the southern part of Brazil, although the data on the occurrence of resistance and resistance genes in enterococci from the Paraná state are sparse. Nevertheless, the presence of enterococci in food is a matter of debate, as some Enterococcus species are involved in clinical infections, such as endocarditis, bacteremia, urinary tract infections, and neonatal sepsis⁽³⁾. Although strains of VRE isolated from animals have been studied extensively, little is known regarding the combined resistance in these microorganisms.

Thus, our present study on Enterococcus spp., associated with raw and boiled meats, is expected to provide insight into the biodiversity of the species and the potential resistance of these bacteria, which are of utmost importance to ensure food safety and public health.

Materials and methods

In total, 100 food samples from different supermarkets were obtained: 66 raw chicken meat samples, 14 raw pork meat samples, 10 samples of processed pork-based products (chopped pork, ham, frankfurter, baloney, and cooked and uncooked sausages), and 10 chicken meat-based products (sausage, spread, breaded chicken, and baloney). Briefly, the samples (25 g) were aseptically collected, placed in 225 ml of brain heart infusion broth (BHI), homogenized, and incubated for 24 h at 37°C. After pre-incubation, 0.1 mL of the primary enrichment was streaked on kanamycin esculin azide agar (KEA) and incubated for 24 h at 37°C. Typical colonies, suggestive of Enterococcus, were randomly selected from each of the primary isolation cultures on the KEA plates and were submitted to microscopic examination, Gram staining, a catalase test, and growth in BHI broth containing 6.5% NaCl at 10°C and 45°C⁽¹⁵⁾.

Genomic DNA was extracted using the boiling method⁽¹⁴⁾. The identification of enterococci and the detection of resistance genes were confirmed by the polymerase chain reaction (PCR) using specific, targeted primers, which have been previously reported⁽¹⁶⁾ (Table 1). All reactions in the thermocycler (Bio-Rad Thermal Cycles T100TM) were carried out with a final volume of 20 µL and consisted of 2 µL of total DNA (20 ng mL^-1), 11.5 µL ultrapure water, 2 µL Taq buffer (10X), 1 µL MgCl₂ (2.5 mM), 1.4 µL dNTPs (0.17 mM), 1µL of each the forward and reverse primer (20 ρmol) (Table 1), and 0.1 µL Taq DNA polymerase (1 U) (Invitrogen). The cycle program used consisted of 5 min of denaturation at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 56°C for annealing, and 30 s at 72°C, and a final extension for 5 min at 72°C, followed by a cool down to 4°C until further analysis. The amplicons were separated by electrophoresis on 1% agarose gels containing ethidium bromide, and visualization by UV light was performed by a computerized photographic system (BioDoc-it System, UVP). A 100 bp DNA marker (100 bp DNA ladder, New England Biolabs/USA) was used to estimate the size of the amplified product.

Table 1
List of primers and amplification used in the present study

	Gene	Gene Primers sequence (5'- 3')	Product size (bp)	reference
Enterococcus sp.	tuf	TACTGACAAACCATTCATGATG AACTTCGTCACCAACGCGAAC	112	16
E. gallinarum	vanC-1	GGTATCAAGGAAACCTC CTTCCGCCATCATAGCT	822	16
E.casseliflavus/ E. flavencens	vanC- 2/vanC-3	CTCCTACGATTCTCTTG CGAGCAAGACCTTTAAG	439	16
E. faecalis	ddlE.faecalis	ATCAAGTACAGTTAGTCT ACGATTCAAAGCTAACTG	941	16
E. faecium	ddlE.faecium	TAGAGACATTGAATATGCC TCGAATGTGCTACAATC	550	16
Vancomycin	vanA	GTAGGCTGCGATATTCAAAGC CGATTCAATTGCGTAGTCCAA	231
	vanB	GCCGACAATCAAATCATCCTC GCCGACAATCAAATCATCCTC	330	35
Tetracycline	tet	GTMGTTGCGCGCTATATTCC GTGAAMGRWAGCCACCTAA	696	2

All the isolates were characterized by antimicrobial susceptibility testing with 12 antibiotics by use of the disc diffusion method, in accordance with the Clinical and Laboratory Standards Institute guidelines⁽¹⁷⁾. The 12 antibiotics tested included ampicillin (10 mg), ciprofloxacin (5 mg), chloramphenicol (30 mg), erythromycin (15 mg), streptomycin (300 µg), gentamicin (120 µg), norfloxacin (10 µg), penicillin (10 µg), tetracycline (30 mg), teicoplanin (30 mg), and vancomycin (30 mg). The antibiotic imipenem (100 mg) was also tested. The minimum inhibitory concentration (MIC) of vancomycin was determined by the broth microdilution technique, and the antibiotic breakpoints used were those specified by the CLSI guidelines. Staphylococcus aureus ATCC 25923 samples (American Type Culture Collection) were used for quality control for the susceptibility tests.

Results and discussion

This study provides the first description of antimicrobial-resistant enterococci isolated from raw and processed meats from the Paraná State. Enterococci constitute an interesting group of microorganisms because they are commensals of humans and animals that occur and grow in a variety of foods and have also been implicated in nosocomial infections. Among the 100 raw and processed meat samples collected from different supermarket sources in the Paraná state, 194 presumptive enterococcal isolates were found from 96 food samples, based on Gram staining, an absence of catalase activity, and growth in BHI broth with 6.5% NaCl at temperatures of 10°C and 45°C. Using PCR amplification with specific primers,Enterococcus spp. (95/96), E. faecalis (66/96), E. faecium (30/96), and E. casseliflavus/E. flavescens (3/96) were identified based on the obtained amplicon size^(14;18) (Figure 1).

Figure 1
Enterococci strain distribution in different meat products

In contrast to some reports, E. casseliflavus/E. flavescens were found in our food samples. Our results likely represent the presence of an enrichment step. The relative prevalence of Enterococcus species in food fell within the range of a previous estimate from animals and their meat, with the most frequent being E. faecalis, followed by E. faecium^(4;12;19).

Although the species E. casseliflavus/E. flavescens has not been isolated as frequently; a number of isolates were found in our study; therefore, this species is important because it has intrinsic resistance to vancomycin⁽²⁰⁾. The presence of the E. gallinarum species could not be confirmed among the analyzed food samples.

The data presented here reveal new avenues to study a possible role for the presence of Enterococcus spp. in the food chain, especially in raw and processed meat. It is, therefore, essential to investigate additional food samples to determine the potential risk to the population.

Table 2 shows the antimicrobial resistance and resistance genes present in each strain of Enterococcus spp. isolated from raw and processed meats. In comparison to other species, the prevalence of the resistance determinants was lower among the E. faecium and E. casseliflavus/flavescens isolates. All isolates that showed vancomycin resistance were subjected to a MIC determination. As a result, 100% of the isolates showed intermediate resistance to this antimicrobial (MIC ≥ 8 µg/ml). Regarding antimicrobial resistance, the study results showed that the isolates of Enterococcus spp., such as E. faecalis and E. faecium, from raw chicken meat samples, were more frequently resistant to the tested antimicrobials than the isolates from raw pork meat and processed meat products.

Table 2
Antibiotic resistance and resistance genes of enterococci isolated from different meat products

Strain	Antimicrobial	Resistance (% of strains)	Resistance genes
E. faecium	Streptomycin, Ciprofloxacin, Norfloxacin,	100	vanB
E. faecalis	Ciprofloxacin, Tetracycline and Erythromycin
		92
	Norfloxacin	83	vanB, tetL
	Vancomycin and Streptomycin	50
E. casseliflavus / E. flavescens	Gentamycin, Streptomycin, Ciprofloxacin, Norfloxacin, Erythromycin and Tetracycline	100	tetL
Enterococcu s sp.	Ciprofloxacin	100
	Norfloxacin	86
	Erythromycin and Tetracycline	93	vanB, tetL
	Streptomycin and Vancomycin	79
	Imipenem	64
	Ampicillin	50

The multidrug resistance distribution was 46%, 40%, 10%, and 3.3% for the Enterococcus spp., E. faecalis, E. faecium, and E. casseliflavus/E. flavescens isolates, respectively. All the Enterococcus isolates showed different multidrug resistance profiles, of which 35.7% of the isolates showed simultaneous resistance to the 12 antimicrobials tested. Similar to our results, these authors⁽²¹⁾ reported thatE. faecalisstrains isolated from food were more resistant to antibiotics than other species. On the other hand,⁽²²⁾it was determined thatE. faecalisand E. faeciumstrains isolated from ready-to-eat foods of animal origin showed similar antibiotic resistance patterns. Conversely, some researchers have reported that E. faecium strains were more resistant to antibiotics than other species^(23;24).

The highest rates of intermediate resistance to the antimicrobial chloramphenicol were observed for the E. casseliflavus/E. flavescens isolates (100%), followed by E. faecium (67%), E. faecalis (50%), and Enterococcus spp. (28%). Among all samples of E. faecalis, 33% showed intermediate resistance to norfloxacin, followed by 17% to ciprofloxacin and chloramphenicol. Among the Enterococcus spp. isolates, higher percentages of intermediate resistance were shown for norfloxacin and tetracycline (18%), followed by erythromycin and chloramphenicol (9%). None of the E. faecium isolates showed intermediate resistance to the antimicrobials tested.

Among the E. faecalis isolates, 17% were resistant to erythromycin and tetracycline, and 25% of the E. faecium isolates showed resistance to erythromycin. In the other Enterococcus spp. isolates, a resistance profile was not detected.

In the processed meat product samples, isolates corresponding to the E. faecium species were identified only in the chicken meat samples; these isolates presented a sensitivity profile for all the antimicrobials tested. None of the enterococci isolates from the raw pork meat or processed meat products showed a multidrug resistance profile.

The susceptibility profile that was predominant among the isolates from raw chicken meat samples was that of resistance. Similar resistance results for isolates obtained from foods were described previously⁽²⁵⁾. Reports of intermediate resistance should be considered as a warning because intermediate strains are likely to migrate to the group of resistant strains following the inappropriate use of antimicrobials⁽¹³⁾. In this study, we observed that E. faecalis is more intrinsically resistant to multiple antimicrobial agents, in particular, to several β-lactam antibiotics, and clinical doses of aminoglycosides. In Brazil, there is not much information regarding the antimicrobial resistance of enterococci from food⁽²⁶⁾.

TheEnterococcusspp. strains displayed resistance to 2-8 antibiotics. The resistance of enterococci to multiple antibiotics is not surprising. Several researchers have reported that it is common for enterococci isolated from fermented meat products to exhibit resistance to multiple antibiotics^(27;28), as also confirmed in this study ⁽²⁷⁾. It was also shown thatEnterococcusstrains isolated from fermented meat products exhibited a high rate of resistance to multiple antibiotics.

Antibiotic resistance and multidrug resistance are public health problems, as they may cause the failure of treatments for enterococcal infections. Although the causes of resistance development are contradicting, evidence based on research data suggests a potential link between antimicrobial resistance and veterinary practices, such as growth promotion, prophylaxis, and treatment^(10;29;30).

The data on multidrug resistance are extremely concerning, mainly because of the risk of acquisition of these microorganisms and their mobile genetic elements, either through the food chain, from direct contact with animals, or even from environmental contamination^(4;31), all of which further hinder the development of treatment alternatives for human infections. A resistant bacterium may infect a carcass during slaughter operations and resist the existing barriers present during food production in industries and/or during home preparation; then, it can reach the gastrointestinal tract of the consumers and modify the resistance profile of their intestinal microbiota⁽³⁰⁾.

In the present study, the genotypic basis for tetracycline and vancomycin resistance and/or sensitivity phenotype found in the food isolates of the Enterococcus strains was investigated by PCR, based on the detection of tet and van genes. The distribution of the resistance gene tetL, among the isolates from food, was found more frequently in the isolates from raw chicken meat samples. The presence of the vanB gene was evident in the isolates from raw chicken and pork meat. The vanA gene was not detected in any of the isolates studied.

The frequency with which these genes were detected in this study coincides with that in the literature^(32;33). The source of VRE is not known, although potential reservoirs of these organisms are hospitals and food.

Five isolates of Enterococcus spp. did not have the tetL, vanA, or vanB genes, and these isolates were still resistant to the tested antimicrobials, indicating that other resistance genes might be present in these isolates.

The presence of a resistance gene that did not confer resistance to these antimicrobials indicates that the gene is likely to exhibit its resistance at any time. These genes, called silent genes, can be activated by environmental factors, such as the physical conditions of the gastrointestinal tract or the synergistic effects of the bacterial microbiota⁽³⁴⁾.

Vancomycin resistance in enterococci isolated from food has a variable pattern both in Brazil and in other countries, depending on the region of their origin⁽²⁶⁾. It should be considered that the distribution of resistance genes reported in this study is based on a relatively limited set of isolates, which highlights the need for regular monitoring of diverse strains to obtain a broader view of the prevalence of these genes in food-associated enterococci.

Conclusion

Enterococci are relatively abundant and resistant to environmental adversity; hence, they have been proposed as bacterial indicators of antimicrobial resistance, as well as of hygienic quality. However, enterococci have emerged as important opportunistic pathogens with a remarkable capacity to express resistance to several groups of antimicrobial agents, thus limiting the number of therapeutic options. We used antibiotic disc diffusion tests and PCR to screen for some resistance genes from all the isolates considered in this study.

The transmission of Enterococcus spp. occurs via food, and little information is available regarding the diversity and distribution of resistance in the Enterococcus species isolated from the area north of Paraná-Brazil. This study provides the first detailed analysis of antibiotic resistance in a variety of enterococci isolated from raw and processed meats in that state. Enterococci should not only be considered potential pathogens, but also reservoirs of genes that encode antibiotic resistance, which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important to identify foods that potentially represent a risk to the population and to ensure effective treatment of human enterococcal infections.

Acknowledgements

The authors would like to thank the UTFPR, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) - Brasil and Fundação Araucária - Paraná for financial support and a post-graduate fellowship.

References

• ¹
  Foka F.E.T., Collins Njie Ateba. Detection of Virulence Genes in Multidrug Resistant Enterococci Isolated from Feedlots Dairy and Beef Cattle: Implications for Human Health and Food Safety. BioMed Research International. 2019; ID 5921840.
• ²
  Gevers D, Danielsen M, Huys G, Swings J. Molecular characterization of tet(M) genes in Lactobacillus isolates from different types of fermented dry sausage. Applied. Environmental Microbiology. 2003; 69:1270-1275.
• ³
  Donabedian SM. et al. Characterization of vancomycin-resistant Enterococcus faecium isolated from Swine in three Michigan counties. J Clin Microbiol. 2010; 48:4156-4160.
• ⁴
  Bortolaia V., Espinosa-Gongora C., Guardabassi L.. Human health risks associated with antimicrobial-resistant enterococci and Staphylococcus aureus on poultry meat. Clin Microbiol Infect. 2016; 2:130-140.
• ⁵
  Hayes JR. et al. Multiple-antibiotic resistance of Enterococcus spp. isolated from commercial poultry production environments. Appl Environ Microbiol, 2004; 70:6005-6011.
• ⁶
  Manson AL, Van Tyne D, Straub TJ, Clock S, Crupain M, Rangan U, Gilmore MS, Earl A.M. Influence of agricultural antibiotic use on chicken meat-associated enterococci and their connection to the clinic. Appl Environ Microbiol . 2019; 30: AEM.01559-19.
• ⁷
  Leavis HL, Willems RJ. Identification of high-risk enterococcal clonal complexes: global dispersion and antibiotic resistance. Curr Opin Microbiol. 2006; 9:454-460.
• ⁸
  Sahlström L. Vancomycin resistant enterococci (VRE) in Swedish sewage sludge. Acta Vet Scan. 2009; 51:01-09.
• ⁹
  Werner G. et al. Emergence and spread of vancomycin resistance among enterococci in Europe. Euro Surveill. 2008; 13:.1-11.
• ¹⁰
  Gousia P. et al. Antimicrobial resistance of major foodborne pathogens from major meat products. Foodborne Pathog Dis. 2011; 8:27-38.
• ¹¹
  Rizzotti L., Rossi F., Torriani S. Biocide and antibiotic resistance of Enterococcus faecalis andEnterococcus faecium isolated from the swine meat chain. Food Microbiol. 2016; 60:160-164.
• ¹²
  Camargo CH. et al. Prevalence and phenotypic characterization of Enterococcus spp. isolated from food in Brazil. Braz J Microbiol, 2014; 45:111-115.
• ¹³
  Campos ACFB. et al. Resistência antimicrobiana em Enterococcus faecalis e Enterococcus faecium isolados de carcaças de frango. Pesqui Vet Bras, 2013; 33: 575-580
• ¹⁴
  Furlaneto-Maia L. et al. Antimicrobial resistance in Enterococcus sp isolated from soft cheese in Southern Brazil. Adv Appl Microbiol 2014; 4:175-181.
• ¹⁵
  Teixeira LM.; FACKLAM RR. (2015) Enterococcus In PR Murray, EJ Baron, JH Jorgensen, MA Pfaller, RH Yolken (eds), Manual of Clinical Microbiology. 11 ed. Washington (DC): American Society for Microbiology, p.422-433. ISBN 978-1-55581-738-1
• ¹⁶
  Dutka-Malen S. et al. Detection of glycopeptides resistance genotypes and identification to the species level of clinically relevant Enterococci by PCR. J Clin Microbiol. 1995; 33:.24-27.
• ¹⁷
  CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 28th ed. CLSI Supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2018.
• ¹⁸
  Harwood VJ. et al. Vancomycin-Resistant Enterococcus spp. Isolated from Wastewater and Chicken Feces in the United States. Appl Environ Microbiol. 2001; 67:4930-4933.
• ¹⁹
  Pesavento G. et al. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese ready-to-eat salads, ham and raw meat. Food Microbiol. 2014; 41:1-7.
• ²⁰
  Igbinosa, E.O., Beshiru A. Antimicrobial Resistance, Virulence Determinants, and Biofilm Formation ofEnterococcus Species From Ready-to-Eat Seafood. Front Microbiol. 2019 Apr 18;10:728.
• ²¹
  Yogurtcu NN, Tuncer Y. Antibiotic susceptibility patterns of Enterococcus strains isolated from Turkish Tulum cheese. Int. J. Dairy Technol. 2013;66:236-242.
• ²²
  Chajecka-Wierzchowska W. et al. Occurrence and antibiotic resistance of enterococci in ready-to-eat food of animal origin. Afr. J. Microbiol. Res. 2012; 6:6773-6780.
• ²³
  Landeta G. et al. Technological and safety properties of lactic acid bacteria isolated from Spanish dry-cured sausages. Meat Sci. 2013; 95:272-280.
• ²⁴
  Valenzuela AS. et al. Virulence factors, antibiotic resistance and bacteriocins in enterococci from artisan food of animal origin. Food Control. 2009; 20:381-385.
• ²⁵
  Diarra MS. et al. Distribution of antimicrobial resistance and virulence genes in Enterococcus spp. and characterization of Isolates from broiler chickens. Appl Environ Microbiol . 2010; 76:8033-8043.
• ²⁶
  Cardoso, M. (2019), "Antimicrobial use, resistance and economic benefits and costs to livestock producers in Brazil", OECD Food, Agriculture and Fisheries Papers, No. 135, OECD Publishing, Paris.
• ²⁷
  Jahan M, Krause DO, Holley R A. Antimicrobial resistance of Enterococcus species from meat and fermented meat products isolated by a PCR-based rapid screening method. Int. J. Food Microbiol. 2013; 163:89-95.
• ²⁸
  Yüceer Ö, Özden Tuncer B. Determination of antibiotic resistance and biogenic amine production of lactic acid bacteria isolated from fermented Turkish sausage (sucuk) J. Food Safety. 2015;35:276-285.
• ²⁹
  Rosengren LB. et al. Associations between antimicrobial exposure and resistance in fecal Campylobacter spp. from grow-finish pigs on-farm in Alberta and Saskatchewan. J Food Prot. 2009;72:482-489.
• ³⁰
  Vignaroli C. et al. Multidrug-resistant enterococci in meat and faeces and co-transfer of resistance from an Enterococcus durans to a human Enterococcus faecium Curr Microbiol. 2011; 62:1438-1447.
• ³¹
  Aslam M. et al. Characterization of antimicrobial resistance and virulence genotypes of Enterococcus faecalis recovered from a pork processing plant. J Food Prot , 2012; 75: 1486-1491.
• ³²
  Terra M.R, Tosoni N.F, Furlaneto M.C, Furlaneto-Maia L. Assessment of vancomycin resistance transfer among enterococci of clinical importance in milk matrix, Journal of Environmental Science and Health, Part B. 2019.
• ³³
  Li S. et al. Vancomycin-resistant enterococci in a chinese hospital. Curr Microbiol , 2007; 55:125-127.
• ³⁴
  Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2013; 65:.232-260.
• ³⁵
  Furlaneto-Maia L, Rocha KR, Siqueira VLD, Furlaneto MC. Comparison between automated system and PCR-based method for identification and antimicrobial susceptibility profile of clinical Enterococcus spp. Rev. Inst. Med. Trop. Sao Paul. 2014; 56(2):1-103. Disponível em https://www.researchgate.net/profile/Marcia_Furlaneto/publication/260809626_Comparison_between_automated_system_and_PCR-based_method_for_identification_and_antimicrobial_susceptibility_profile_of_clinical_Enterococcus_spp/links/53f47e0d0cf2fceacc6e83d1/Comparison-between-automated-system-and-PCR-based-method-for-identification-and-antimicrobial-susceptibility-profile-of-clinical-Enterococcus-spp.pdf
  » https://www.researchgate.net/profile/Marcia_Furlaneto/publication/260809626_Comparison_between_automated_system_and_PCR-based_method_for_identification_and_antimicrobial_susceptibility_profile_of_clinical_Enterococcus_spp/links/53f47e0d0cf2fceacc6e83d1/Comparison-between-automated-system-and-PCR-based-method-for-identification-and-antimicrobial-susceptibility-profile-of-clinical-Enterococcus-spp.pdf

Publication Dates

• Publication in this collection
  15 June 2020
• Date of issue
  2020

History

• Received
  14 Mar 2019
• Reviewed
  30 Oct 2019
• Accepted
  22 Apr 2020