Effects of atorvastatin in suppressing pulmonary vascular remodeling in rats with chronic obstructive pulmonary disease

He, YongHong; Wang, SongPing; Li, Yuying; Deng, Jun; Huang, Lan

doi:10.1016/j.clinsp.2023.100252

Acessibilidade / Reportar erro

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original articles • Clinics 78 • 2023 • https://doi.org/10.1016/j.clinsp.2023.100252 copy

Effects of atorvastatin in suppressing pulmonary vascular remodeling in rats with chronic obstructive pulmonary disease

Authorship SCIMAGO INSTITUTIONS RANKINGS

Highlights

HMG-CoA reductase inhibitor statins can inhibit vascular remodeling.
The regulation of HDAC2/NF-κB signaling pathway can improve pulmonary vascular remodeling.
Atorvastatin can be used in the early intervention of pulmonary vascular remodeling.

Abstract

Objective

To investigate the effects of atorvastatin calcium on pulmonary vascular remodeling, the authors explored the regulatory mechanism of Histone Deacetylation Enzyme-2 (HDAC2) in rats with Chronic Obstructive Pulmonary Disease (COPD), and provided a new direction for drug treatment in the progression of vascular remodeling.

Methods

Eighteen female SD rats were randomly divided into control (Group S1), COPD (Group S2), and atorvastatin calcium + COPD (Group S3) groups. A COPD rat model was established by passive smoking and intratracheal injection of Lipopolysaccharide (LPS). Haematoxylin and eosin staining and Victoria Blue + Van Gibson staining were used to observe pathological changes in the lung tissue. The pulmonary vascular inflammation score was calculated, and the degree of pulmonary vascular remodeling was evaluated. The ratio of Muscular Arteries in lung tissue (MA%), the ratio of the vessel Wall Area to the vessel total area (WA%), and the ratio of the vessel Wall Thickness to the vascular outer diameter (WT%) were measured using imaging software. The expression of HDAC2 was measured using western blotting, ELISA (Enzyme-Linked Immunosorbent Assay), and qPCR (Real-time PCR).

Results

Compared with the control group, the degree of pulmonary vascular inflammation and pulmonary vascular remodeling increased in rats with COPD. The WT%, WA%, and lung inflammation scores increased significantly; the expression of HDAC2 and HDAC2mRNA in the serum and lung tissue decreased, and the level of Vascular Endothelial Growth Factor (VEGF) in the lung tissues increased (p< 0.05). Compared with the COPD group, the lung tissues from rats in the atorvastatin group had fewer inflammatory cells, and the vascular pathological changes were significantly relieved. The WT%, WA%, and lung inflammation scores decreased significantly; the expression of HDAC2 and HDAC2mRNA in the serum and lung tissues increased, and the level of VEGF in the lung tissues decreased (p< 0.05).

Conclusion

The present study revealed that atorvastatin calcium could regulate the contents and expression of HDAC2 in serum and lung tissues and inhibit the production of VEGF, thereby regulating pulmonary vascular remodeling in a rat model with COPD.

Keywords
Atorvastatin calcium; HDAC2; COPD rats; Pulmonary vascular remodeling

Gene	Primer sequence (5′→3′)	Value
HDAC2	Forward: ACCTAACTGTCAAAGGTCACGCT	152 bp
HDAC2	Reverse: ACCTAACTGTCAAAGGTCACGCT	152 bp
GAPDH	Forward: GCCAAGGTCATCCATGACAAC	152 bp
GAPDH	Reverse: GTGGATGCAGGGATGATGTTC	152 bp

Group	n	Inflammation score	WA%	WT%	MA%
Control (S1)	6	0.54±0.07	27.25±1.02	16.27±0.44	35.63±1.26
COPD (S2)	6	2.63±0.45*	40.70±1.14^a a p< 0.05; compared with COPD group.	18.37±0.38^a a p< 0.05; compared with COPD group.	59.26±1.49^a a p< 0.05; compared with COPD group.
Atorvastatin(S3)	6	1.96±0.36^a a p< 0.05; compared with COPD group. ,^b b p< 0.05.	30.41±0.87^a a p< 0.05; compared with COPD group. ,^b b p< 0.05.	17.22±0.20^a a p< 0.05; compared with COPD group. ,^b b p< 0.05.	48.54±1.52^a a p< 0.05; compared with COPD group. ,^b b p< 0.05.
F		30.09	284.98	50.95	418.33
P		0.001	<0.001	<0.001	<0.001

			Lung tissue
Group	n	HDAC2 in serum (μg/L)	HDAC2 protein	HDAC2 mRNA	VEGF protein	VEGF mRNA
Control (S1)	6	13.794±1.549	0.356±0.056	1.273±0.177	0.121±0.003	1.21±0.107
COPD (S2)	6	2.921±1.288^a a Compared with the control group, p< 0.05.	0.102±0.016^a a Compared with the control group, p< 0.05.	0.292±0.022^a a Compared with the control group, p< 0.05.	0.269±0.011^a a Compared with the control group, p< 0.05.	4.03±0.442^a a Compared with the control group, p< 0.05.
Atorvastatin (S3)	6	12.135±1.622^a a Compared with the control group, p< 0.05. ,^b b Compared with the COPD group, p< 0.05.	0.313±0.028^a a Compared with the control group, p< 0.05. ,^b b Compared with the COPD group, p< 0.05.	0.883±0.079^a a Compared with the control group, p< 0.05. ,^b b Compared with the COPD group, p< 0.05.	0.139±0.005^a a Compared with the control group, p< 0.05. ,^b b Compared with the COPD group, p< 0.05.	1.43±0.13^a a Compared with the control group, p< 0.05. ,^b b Compared with the COPD group, p< 0.05.
F		184.472^* ⁎ p< 0.01.	77.384^* ⁎ p< 0.01.	114.502^* ⁎ p< 0.01.	690.386^* ⁎ p< 0.01.	102.86^* ⁎ p< 0.01.

Faculdade de Medicina / USP Rua Dr Ovídio Pires de Campos, 225 - 6 and., 05403-010 São Paulo SP - Brazil, Tel.: (55 11) 2661-6235 - São Paulo - SP - Brazil
E-mail: clinics@hc.fm.usp.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] * Corresponding author. E-mail addresses:he1007175340@126.com (Y. He) wsp1007175340@126.com, lzhlyyhy@126.com (S. Wang) lzhlyyhy@126.com (Y. Li).