Acessibilidade / Reportar erro

The first report of the vanC1 gene in Enterococcus faecium isolated from a human clinical specimen

Abstract

The vanC1 gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC1gene. Polymerase chain reaction (PCR) assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC1and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC1 gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC1gene. However, this study is the first to report the presence of the vanC1gene in E. faecium of human origin. Additionally, our research showed the vanC1gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC1gene from different species.

Enterococcus gallinarum; Enterococcus faecium; vanC; gene


During the past two decades, glycopeptide-resistant enterococci, in particular Enterococcus faecium, have become increasingly widespread throughout the world and have been identified as multi-resistant opportunistic pathogens in hospitals and in the environment (e.g., in foods and animals) (Lebreton et al. 2011Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berqer P, Camiade S, Leclercq R, Courvalin P, Cattoir V 2011. D-Ala-d-Ser vanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother 55: 4606-4612., Nomura et al. 2012Nomura T, Tanimoto K, Shibayama K, Arakawa Y, Fujimoto S, Ike Y, Tomita H 2012. Identification of vanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan. Antimicrob Agents Chemother 56: 6389-6392.). Since the first detection of vancomycin resistance in E. faecium in 1988, nine operons that confer resistance to glycopeptides have been distinguished based on the sequence of the structure for the resistance ligase (Leclercq et al. 1988Leclercq R, Derlot E, Duval J, Courvalin P 1988. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med 319: 157-161., Uttley et al. 1988Uttley AH, Collins CH, Naidoo J, Georqe RC 1988. Vancomycin-resistant enterococci. Lancet 1: 57-58., Lebreton et al. 2011Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berqer P, Camiade S, Leclercq R, Courvalin P, Cattoir V 2011. D-Ala-d-Ser vanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother 55: 4606-4612.). These operons are classified according to the characteristics of the ligase gene, which can encode either a D-alanyl-D-lactate ligase or a D-alanyl-D-serine ligase. Genes that encode D-alanyl-D-lactate ligases include the vanA, vanB, vanD and vanM genes and those that encode D-alanyl-D-serine ligases include the vanC1, vanC2, vanC3, vanE, vanG, vanL and vanN genes (Arthur et al. 1996Arthur M, Revnolds P, Courvalin P 1996. Glycopeptide resistance in enterococci. Trends Microbiol 4: 401-407., Courvalin 2006Courvalin P 2006. Vancomycin resistance in Gram-positive cocci. Clin infect Dis 42 (Suppl. 1): S25-S34., Lebreton et al. 2011Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berqer P, Camiade S, Leclercq R, Courvalin P, Cattoir V 2011. D-Ala-d-Ser vanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother 55: 4606-4612., Nomura et al. 2012Nomura T, Tanimoto K, Shibayama K, Arakawa Y, Fujimoto S, Ike Y, Tomita H 2012. Identification of vanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan. Antimicrob Agents Chemother 56: 6389-6392.). Resistance types can be acquired except for vanC-type resistance, which is thought to be intrinsic to Enterococcus gallinarum and Enterococcus casseliflavus. The vanC1 cluster is composed of five genes: vanC1, vanXYc, vanTc, vanRc and vanSc. Three of these genes are involved in inducing resistance according to the following mechanism: vanC1 encodes a ligase that synthesises the dipeptide D-Ala-D-Ser, which is added to the UDP-MurNAc-tripeptide; vanXYc encodes a D,D-dipeptidase-carboxypeptidase that hydrolyses D-Ala-D-Ala and removes D-Ala from UDP-MurNAc-pentapeptide; vanT encodes a membrane-bound serine racemase that provides D-Ser to the synthetic pathway (Arias et al. 2000Arias CA, Courvalin P, Revnolds PE 2000. vanC cluster of vancomycin-resistant Enterococcus gallinarum BM4174. Antimicrob Agents Chemother 44: 1660-1666.). The vanC1 gene is thought to occur only in E. gallinarum and should therefore be useful for species identification (Ramotar et al. 2000Ramotar K, Woods W, Larocque L, Toye B 2000. Comparison of phenotypic methods to identify enterococci intrinsically resistant to vancomycin (vanC VRE). Diagn Microbiol Infect Dis 36: 119-124.). Furthermore, this gene is chromosomally located and has not been found in E. faecium until now. Since the vanC1 gene was first identified in vancomycin-susceptible Enterococcus faecalis strains isolated from pig manure samples in Germany, vanC1-type E. faecalis of animal origin has been reported in Spain and Brazil. This finding emphasises that the chromosomal location of a gene in intrinsically resistant strains does not necessarily prevent gene transfer to another species, which is in contrast to traditional views (Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439., de Garnica et al. 2013de Garnica ML, Valdezate S, Gonzalo C, Saez-Nieto JA 2013. Presence of the vanC1 gene in a vancomycin-resistant Enterococcus faecalis strain isolated from ewe bulk tank milk. J Med Microbiol 62: 494-495., de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). So far, there has been one report of the genetic location of the vanC1 gene isolated from cloacal swabs of broilers and this gene was detected on plasmid (de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). We also identified vanC1-type E. faecium strain isolated from a blood culture.

In this study, E. faecium TJ4031 was susceptible to both vancomycin and teicoplanin, but harboured the vanC1 resistance gene. We also presented evidence showing that the vanC1 gene cluster was incomplete; the vanC1 and vanXYc genes were not expressed. Additionally, the resistance gene in this clinical isolate was located on the chromosome.

MATERIALS AND METHODS

Strains - E. faecium TJ4031 was isolated in 2012 from a blood culture from an outpatient in our hospital. This isolate was initially identified by Gram staining and biochemical reaction as previously described (Facklam & Collins 1989Facklam RR, Collins MD 1989. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J Clin Microbiol 27: 731-734.). Furthermore, the Vitek2-Compact system (bioMérieux, France) was used and Enterococcus-specific polymerase chain reaction (PCR) was performed (Jackson et al. 2004Jackson CR, Fedorka-Cray PJ, Barrett JB 2004. Use of a genus and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol 42: 3558-3565.). This strain was also distinguished from E. gallinarum by determining the E. gallinarum sod gene using the species-specific Egaspe primer set. The primers used are listed as follows: Egaspe F, GAACCAACAGGAGCCATCA; Egaspe R, ACCAAGCCCAGCCAGAAC (Poyart et al. 2000Poyart C, Quesnes G, Trieu-Cuot P 2000. Sequencing the gene encoding manganese-dependent superoxide dismutase for rapid species identification of enterococci. J Clin Microbiol 38: 415-418.). TJ430, which was confirmed as E. gallinarum isolated from a clinical specimen and E. faecalis ATCC29212, was used as positive and negative controls, respectively, for the detection and expression analysis of the vanC1, vanXYc and vanTc genes. TJ430 was also used as control strain to analyse the location of the vanC1 gene. Salmonella H9812 was used as a marker for pulsed-field gel electrophoresis (PFGE).

Antibiotic susceptibility testing - Minimum inhibitory concentrations (MICs) were determined according to a standard agar dilution procedure, as recommended by the Clinical and Laboratory Standards Institute (CLSI 2012). E. faecalis ATCC29212 was used as a control strain.

Molecular typing and genetic techniques - TJ4031 was typed by subjecting genomic DNA to PFGE using the CHEF II Mapper system (Bio-Rad, France) (Lebreton et al. 2011Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berqer P, Camiade S, Leclercq R, Courvalin P, Cattoir V 2011. D-Ala-d-Ser vanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob Agents Chemother 55: 4606-4612.). Total DNA was digested with SmaІ and then electrophoresed (6 V/cm, 17 h, pulse times of 1-17 s at 14ºC) on an agarose gel. Total DNA from the H9812 marker was digested with XbaI. The plasmid size and content of the TJ4031 isolate were determined using the S1 nuclease method (Freitas et al. 2009aFreitas AR, Novais C, Ruiz-Garbajosa P, Coque TM, Peixe L 2009a. Clonal expansion within clonal complex 2 and spread of vancomycin-resistant plasmids among different genetic lineages of Enterococcus faecalis from Portugal. J Antimicrob Chemother 63: 1104-1111.). The location of the vanC1 gene was determined using southern hybridisation. A vanC1 probe was constructed by labelling an internal amplification product of the vanC1 gene from TJ4031 with digoxigenin according to the manufacturer’s protocol (Roche, Switzerland). The primers used to amplify the product are listed as follows: vanC1 F, 5’-ATGGCTGTATCCAAGGACTG-3’; vanC1 R, 5’-AGGCAATGGTGCTGGGAC-3’.

The E. faecium TJ4031 isolate was subjected to multilocus sequence typing (MLST) analysis (Zheng et al. 2007Zheng B, Tomita H, Xiao YH, Wang S, Li Y, Ike Y 2007. Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from mainland China. J Clin Microbiol 45: 2813-2818., Freitas et al. 2009bFreitas AR, Novais C, Ruiz-Garbajosa P, Coque TM, Peixe L 2009b. Dispersion of multidrug-resistant Enterococcus faecium isolates belonging to major clonal complexes in different Portuguese settings. Appl Environ Microbiol 75: 4904-4908.). The alleles and sequence type (ST) were determined using the MLST database (efaecium.mlst.net). The new ST identified in this study has been deposited in the database.

PCR - E. faecium isolates were species identified with PCR using Enterococcus-specific primers combined with species-specific primers for the E. gallinarum sod gene (Poyart et al. 2000Poyart C, Quesnes G, Trieu-Cuot P 2000. Sequencing the gene encoding manganese-dependent superoxide dismutase for rapid species identification of enterococci. J Clin Microbiol 38: 415-418., Jackson et al. 2004Jackson CR, Fedorka-Cray PJ, Barrett JB 2004. Use of a genus and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol 42: 3558-3565.). E. faecium TJ4031 was also evaluated to determine the presence of vanA, vanB, vanC1, vanC2/3 and vanXYc, vanTc (Patel et al. 1998Patel R, Piper KE, Rouse MS, Steckelberq JM, Uhl JR, Kohner P, Hopkins MK, Cockerill FR 3rd, Kline BC 1998. Determination of 16S rRNA sequences of enterococci and application to species identification of non-motile Enterococcus gallinarum isolates. J Clin Microbiol 36: 3399-3407., Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439.).

Sequence analysis - The band from the vanC1-positive strain was excised from the gel and then sequenced. Sequence similarity was compared using the NCBI Basic Local Alignment Search Tool database (ncbi.nlm.nih.gov).

RNA extraction and reversetranscription-PCR (RT-PCR) - Total RNA from strain TJ4031 grown in brain-heart-yeast extract broth at 37ºC to an absorbance at 600 nm of 0.8 was isolated using an RNeasy Mini Kit (Qiagen, Germany). Transcripts were obtained using a RevertAid First Strand cDNA system kit (Fermentas) according to the manufacturer’s instructions. Real-time RT-PCR was conducted in a final volume of 20 µL containing 10 µL SYBR Mix (NovoGene), 0.5 µM primers and 3 µL template cDNA. The reaction was performed using a Light Cycler 480 (Roche) under the following conditions: initial denaturation at 95ºC for 7 min and 40 cycles of denaturation at 95ºC for 10 s, annealing at 57ºC for 15 s, elongation at 72ºC for 30 s and cooling at 40ºC for 30 s. The primers used in this procedure are as follows: vanrtC1 F, ATTGGTGCTTGTGATGCG; vanrtC1 R, CGGGAGTGCCCAGTAAA; vanXYc F, GCAAAACAATGGGAACGACT; vanXYc R, ATCTCGAAAATGAGGGCAGA. Non-reverse-transcribed PCR controls were used to indicate the absence of genomic DNA contamination. ATCC29212 and TJ430 were used as negative and positive control strains, respectively.

RESULTS

Characterisation of E. faecium TJ4031 - The clinical isolate TJ4031, which was isolated from a blood culture, was identified as E. faecium using conventional tests and the Vitek2-Compact system; species identity was confirmed by PCR. E. gallinarum was excluded as a possibility by a negative result in an E. gallinarum species-specific PCR. TJ4031 was susceptible to vancomycin (MIC = 2 µg/mL) and teicoplanin (MIC = 1 µg/mL). TJ4031 was also susceptible to chloramphenicol, linezolid, ciprofloxacin, levofloxacin and fosfomycin. By comparison, this strain was resistant to penicillin, rifampicin, erythromycin and nitrofurantoin. TJ4031 was positive for the vanC1 and vanXYc genes, but negative for the vanTc gene. The vanC1 gene sequence was deposited in GenBank (accession KF849246).

Identification of gene expression by real-time RT-PCR - RT-PCR assays failed to detect the corresponding vanC1 and vanXYc gene transcripts in the vanC1 gene positive E. faecium TJ4031 strain. The positive and negative controls worked as expected.

Molecular typing - The E. faecium TJ4031 isolate was categorised as a new ST according to MLST analysis and designated as ST837 (AtpA, 52; Ddl, 5; Gdh, 1; PurK, 1; Gyd, 1; PstS, 1; Adk, 3). This new ST showed the greatest similarity to the reported MLST type ST547 (AtpA, 15; Ddl, 5; Gdh, 1; PurK, 1; Gyd, 1; PstS, 1; Adk, 3) based on the information from the database (MLST database URE) (efaecium.mlst.net/). ST837 was a single-locus variant of ST547. Neither ST547 nor ST837 belong to the well-characterised clonal complex (CC) 17, which is found in a hospital-adapted and epidemic E. faecium strain cluster.

Genetic location of vanC1 gene in E. faecium TJ4031 - Figure shows the restriction endonuclease pattern of the vanC1 genotype in the E. faecium TJ4031 strain after PFGE with SmaI was performed. The location of the vanC1 gene was determined using southern blot hybridisation with a vanC1 probe. PFGE hybridisation analysis results showed that the vanC1 probe hybridised to the chromosomal DNA band and that the size of the macrorestriction fragment was between 78.2-104.5 Kbp (Figure). However, S1-PFGE analysis results showed that a plasmid was absent in the TJ4031 isolate (data not shown). The results indicated that the vanC1 gene was located in the chromosome.


A: pulsed-field gel electrophoresis of SmaI digested genomic DNA from TJ4031 and TJ430 strains. The first lane is H9812 digested with XbaI as marker with relevant sizes indicated to the gel; B: hybridisation of southern transfer of DNA in left panel using an internal fragment of vanC1 as a probe. The result showed that the probe hybridised to the chromosome and the size was between 78.2-104.5 Kbp.

DISCUSSION

The vanC intrinsic resistance genotype is associated with several enterococcal species, including E. gallina- rum (vanC1), E. casseliflavus (vanC2) and E. flavescens (vanC3). These vanC operons are chromosome associated and testing E. faecium or other Enterococcus species for the presence of vanC1 is considered unnecessary because this gene is thought to be species-specific for E. gallinarum (Leclercq et al. 1992Leclercq R, Dutka-Malen S, Duval J, Courvalin P 1992. Vancomycin resistance gene vanC is specific to Enterococcus gallinarum. Antimicrob Agents Chemother 36: 2005-2008., Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439.). However, the vanC1 gene has also been detected in E. faecalis strains isolated from pig manure samples (Germany), sheep bulk tank milk samples (Spain) and cloacal swabs of broilers (Brazil).

In our study, expected biochemical reactions were observed in the vanC1 genotype-positive E. faecium TJ4031. E. faecium was also analysed using the Vitek2-Compact system. Moreover, the Enterococcus and E. gallinarum-specific PCR results of this study are consistent with those of other bacteriological studies (Patel et al. 1998Patel R, Piper KE, Rouse MS, Steckelberq JM, Uhl JR, Kohner P, Hopkins MK, Cockerill FR 3rd, Kline BC 1998. Determination of 16S rRNA sequences of enterococci and application to species identification of non-motile Enterococcus gallinarum isolates. J Clin Microbiol 36: 3399-3407., Arias et al. 2000Arias CA, Courvalin P, Revnolds PE 2000. vanC cluster of vancomycin-resistant Enterococcus gallinarum BM4174. Antimicrob Agents Chemother 44: 1660-1666., Zheng et al. 2007Zheng B, Tomita H, Xiao YH, Wang S, Li Y, Ike Y 2007. Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from mainland China. J Clin Microbiol 45: 2813-2818., de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). Our study failed to detect the corresponding vanC1 and vanXYc genes in a vanC1 genotype-positive strain with real-time RT-PCR assays and similar results have been previously reported (Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439., de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). This result could be attributed to a non-functional vanC1 gene cluster that has been transferred from a bacterial community to our strain or to a failed recombination event that inserted a non-functional gene and removed beneficial DNA (Lawrence et al. 2001Lawrence JG, Hendrix RW, Casjens S 2001. Where are the pseudogenes in bacterial genomes? Trends Microbiol 9: 535-540., de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). In a previous study, the vanC1 gene was found on a plasmid (de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.). However, our study showed that the vanC1 genotype of the E. faecium TJ4031 isolate contained no plasmid; this procedure was repeated in triplicate to verify our initial findings. The possible explanation is that megaplasmids, which cannot be detected with current techniques, or bacteria without plasmids may be present. Furthermore, the vanC1 gene was successfully hybridised to the chromosome band using southern blot, showing that this gene was located in this chromosome.

E. faecium TJ4031 may have acquired the vanC1 gene via a horizontal gene transfer from a natural carrier (E. gallinarum) or from a carrier of animal origin (E. faecalis) (Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439., de Garnica et al. 2013de Garnica ML, Valdezate S, Gonzalo C, Saez-Nieto JA 2013. Presence of the vanC1 gene in a vancomycin-resistant Enterococcus faecalis strain isolated from ewe bulk tank milk. J Med Microbiol 62: 494-495., de Moura et al. 2013de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis. Mem Inst Oswaldo Cruz 108: 453-456.) because strains from human-adapted CCs that cause enterococcal infection may be recovered from farm and companion animals and strains from CCs commonly found among animals have also been isolated from humans. Furthermore, other studies have revealed several cases of animal-human transmission of vancomycin-resistant enterococci, resulting in frequent infections of healthy humans that closely interact with animals (Damborg et al. 2009Damborg P, Top J, Hendrickx AP, Dawson S, Willems RJ, Guardabassi L 2009. Dogs are a reservoir of ampicillin-resistant Enterococcus faecium lineages associated with human infections. Appl Environ Microbiol 75: 2360-2365., Freitas et al. 2009bFreitas AR, Novais C, Ruiz-Garbajosa P, Coque TM, Peixe L 2009b. Dispersion of multidrug-resistant Enterococcus faecium isolates belonging to major clonal complexes in different Portuguese settings. Appl Environ Microbiol 75: 4904-4908., 2011Freitas AR, Coque TM, Novais C, Hammerum AM, Lester CH, Zervos MJ, Donabedian S, Jensen LB, Francia MV, Baquero F, Peixe L 2011. Human and swine hosts share vancomycin-resistant Enterococcus faecium CC17 and CC5 and Enterococcus faecalis CC2 clonal clusters harboring Tn1546 on indistinguishable plasmids. J Clin Microbiol 49: 925-931., Willems & van Schaik 2009Willems RJ, van Schaik W 2009. Transition of Enterococcus faecium from commensal organism to nosocomial pathogen. Future Microbiol 4: 1125-1135., Larsen et al. 2010Larsen J, Schønheyder HC, Lester CH, Olsen SS, Porsbo LJ, Garcia-Migura L, Jensen LB, Bisgaard M, Hammerum AM 2010. Porcine-origin gentamicin-resistant Enterococcus faecalis in humans, Denmark. Emerg Infect Dis 16: 682-684.).

This study was the first to identify the vanC1 gene in a vancomycin-susceptible E. faecium strain isolated from the blood culture of a patient in China. Our result is important because the vanC1 gene is often used to identify E. gallinarum; without this gene, species may be erroneously identified. This result also emphasises that the chromosomal location of a gene in an intrinsically resistant strain does not necessarily prevent transfer to other species, thereby contributing to species diversity. Furthermore, the vanC1-type vancomycin resistance gene was encoded on the chromosome. Our data indicate that vanC1-type E. faecium strains could be detected in humans. Even if the strain was phenotypically susceptible to vancomycin, the fact that E. faecium are able to naturally acquire vanC1 from the bacterial community is a cause for concern because the possibility that complete gene clusters and functional genes will be transferred and expressed cannot be ruled out. This study underlines that E. faecium are very potent resistance gene collectors and possibly donors (Schwaiger et al. 2012Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis. Microb Drug Resist 18: 434-439.). We should always monitor enterococci in not only human clinical isolates, but also in the commensals from diverse habitats.

REFERENCES

  • Arias CA, Courvalin P, Revnolds PE 2000. vanC cluster of vancomycin-resistant Enterococcus gallinarum BM4174. Antimicrob Agents Chemother 44: 1660-1666.
  • Arthur M, Revnolds P, Courvalin P 1996. Glycopeptide resistance in enterococci. Trends Microbiol 4: 401-407.
  • CLSI - Clinical and Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing, 22nd informational supplement M100-S13, CLSI, Villanova, 188 pp.
  • Courvalin P 2006. Vancomycin resistance in Gram-positive cocci. Clin infect Dis 42 (Suppl. 1): S25-S34.
  • Damborg P, Top J, Hendrickx AP, Dawson S, Willems RJ, Guardabassi L 2009. Dogs are a reservoir of ampicillin-resistant Enterococcus faecium lineages associated with human infections. Appl Environ Microbiol 75: 2360-2365.
  • de Garnica ML, Valdezate S, Gonzalo C, Saez-Nieto JA 2013. Presence of the vanC1 gene in a vancomycin-resistant Enterococcus faecalis strain isolated from ewe bulk tank milk. J Med Microbiol 62: 494-495.
  • de Moura TM, Cassenego APV, Campos FS, Ribeiro AML, Franco AC, d’Azevedo PA, Frazzon J, Frazzon APG 2013. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis Mem Inst Oswaldo Cruz 108: 453-456.
  • Facklam RR, Collins MD 1989. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J Clin Microbiol 27: 731-734.
  • Freitas AR, Coque TM, Novais C, Hammerum AM, Lester CH, Zervos MJ, Donabedian S, Jensen LB, Francia MV, Baquero F, Peixe L 2011. Human and swine hosts share vancomycin-resistant Enterococcus faecium CC17 and CC5 and Enterococcus faecalis CC2 clonal clusters harboring Tn1546 on indistinguishable plasmids. J Clin Microbiol 49: 925-931.
  • Freitas AR, Novais C, Ruiz-Garbajosa P, Coque TM, Peixe L 2009a. Clonal expansion within clonal complex 2 and spread of vancomycin-resistant plasmids among different genetic lineages of Enterococcus faecalis from Portugal. J Antimicrob Chemother 63: 1104-1111.
  • Freitas AR, Novais C, Ruiz-Garbajosa P, Coque TM, Peixe L 2009b. Dispersion of multidrug-resistant Enterococcus faecium isolates belonging to major clonal complexes in different Portuguese settings. Appl Environ Microbiol 75: 4904-4908.
  • Jackson CR, Fedorka-Cray PJ, Barrett JB 2004. Use of a genus and species-specific multiplex PCR for identification of enterococci. J Clin Microbiol 42: 3558-3565.
  • Larsen J, Schønheyder HC, Lester CH, Olsen SS, Porsbo LJ, Garcia-Migura L, Jensen LB, Bisgaard M, Hammerum AM 2010. Porcine-origin gentamicin-resistant Enterococcus faecalis in humans, Denmark. Emerg Infect Dis 16: 682-684.
  • Lawrence JG, Hendrix RW, Casjens S 2001. Where are the pseudogenes in bacterial genomes? Trends Microbiol 9: 535-540.
  • Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berqer P, Camiade S, Leclercq R, Courvalin P, Cattoir V 2011. D-Ala-d-Ser vanN-type transferable vancomycin resistance in Enterococcus faecium Antimicrob Agents Chemother 55: 4606-4612.
  • Leclercq R, Derlot E, Duval J, Courvalin P 1988. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium N Engl J Med 319: 157-161.
  • Leclercq R, Dutka-Malen S, Duval J, Courvalin P 1992. Vancomycin resistance gene vanC is specific to Enterococcus gallinarum Antimicrob Agents Chemother 36: 2005-2008.
  • Nomura T, Tanimoto K, Shibayama K, Arakawa Y, Fujimoto S, Ike Y, Tomita H 2012. Identification of vanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan. Antimicrob Agents Chemother 56: 6389-6392.
  • Patel R, Piper KE, Rouse MS, Steckelberq JM, Uhl JR, Kohner P, Hopkins MK, Cockerill FR 3rd, Kline BC 1998. Determination of 16S rRNA sequences of enterococci and application to species identification of non-motile Enterococcus gallinarum isolates. J Clin Microbiol 36: 3399-3407.
  • Poyart C, Quesnes G, Trieu-Cuot P 2000. Sequencing the gene encoding manganese-dependent superoxide dismutase for rapid species identification of enterococci. J Clin Microbiol 38: 415-418.
  • Ramotar K, Woods W, Larocque L, Toye B 2000. Comparison of phenotypic methods to identify enterococci intrinsically resistant to vancomycin (vanC VRE). Diagn Microbiol Infect Dis 36: 119-124.
  • Schwaiger K, Bauer J, Hörmansdorfer S, Mölle G, Preikschat P, Kämpf P, Bauer-Unkauf l, Bischoff M, Hölzel C 2012. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis Microb Drug Resist 18: 434-439.
  • Uttley AH, Collins CH, Naidoo J, Georqe RC 1988. Vancomycin-resistant enterococci. Lancet 1: 57-58.
  • Willems RJ, van Schaik W 2009. Transition of Enterococcus faecium from commensal organism to nosocomial pathogen. Future Microbiol 4: 1125-1135.
  • Zheng B, Tomita H, Xiao YH, Wang S, Li Y, Ike Y 2007. Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from mainland China. J Clin Microbiol 45: 2813-2818.
  • Financial support: China National Mega Project on Major Infectious Disease Prevention (2012ZX100004207-004)

Publication Dates

  • Publication in this collection
    13 Aug 2014
  • Date of issue
    Sept 2014

History

  • Received
    17 Jan 2014
  • Received
    20 June 2014
Instituto Oswaldo Cruz, Ministério da Saúde Av. Brasil, 4365 - Pavilhão Mourisco, Manguinhos, 21040-900 Rio de Janeiro RJ Brazil, Tel.: (55 21) 2562-1222, Fax: (55 21) 2562 1220 - Rio de Janeiro - RJ - Brazil
E-mail: memorias@fiocruz.br