Determinants of virulence in <i>Enterococcus</i> endogenous to artisanal cheese

Porto, Bruna Castro; Fujimoto, Graciela; Borges, Maria de Fatima; Bruno, Laura Maria; Carvalho, Juliane Döering Gasparin

doi:10.5935/1806-6690.20160008

Acessibilidade / Reportar erro

Brasil

Revista Ciência Agronômica

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Engenharia de Alimentos • Rev. Ciênc. Agron. 47 (1) • Jan-Mar 2016 • https://doi.org/10.5935/1806-6690.20160008 copy

Determinants of virulence in Enterococcus endogenous to artisanal cheese

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

The presence of Enterococcus spp. in food poses a danger to public health due to its frequent association with various clinical infections. Pathogenicity in Enterococcus is multifactorial and complex, and stems from a sequence of virulence factors. The aim of this study was to evaluate the presence of phenotypic and genotypic determinants of virulence in Enterococcus spp. isolated from curd cheese. A total of 53 strains of Enterococcus spp. were analysed as to their susceptibility to antimicrobial agents, production of hemolysins, DNAse, thermonuclease, and gelatinase, and the profile of virulence-encoding genes. It was found that 75.5% of the strains were resistant to at least one of the nine antibiotics tested, 26.42% were resistant to two, and 3.77% to three antibiotics. The presence of vancomycin-resistance phenotypes was seen in 11.33% of the strains. Haemolytic activity was observed in 100% of strains and DNAse production in only 3.8%. There was no production of thermonuclease or gelatinase. Strains resistant to vancomycin and teicoplanin were identified as E. faecium and Enterococcus spp. The profile of the genetic determinants of virulence was highly variable, and 90% of the strains harboured at least one of the nine genes being studied. The efaA gene showed the highest prevalence (70%), followed by the ace gene (50%), the esp gene and gelE gene (40%).

Key words:
Dairy products; Lactic acid bacteria; Pathogenicity; Susceptibility to antibiotics

Gene	Marcador	Primers	Sequencia (5’ - 3’)	Tamanho produto (pb)	Temp. de anelamento (°C)	Referencia
ddlE.faecalis	E. faecalis	Fk1	ATCAAGTAC AGTTAGTCTT	941	54	Dutka-Malen, Evers e Courvalin (1995)DUTKA-MALEN, S; EVERS, S; COURVALIN, P. Detection of glycopeptide resistance genotypes and identifications the species level of clinically relevant enterococci by PCR. Journal of Clinical Microbiology, v. 33, n. 1, p. 24-27, 1995.
ddlE.faecalis	E. faecalis	Fk2	ACGATTCAAAGCTAACTG	941	54
ddlE.faecium	E. faecium	Fae1	GCAAGG CTTCTTAGAGA	550	54	Dutka-Malen; Evers; Courvalin (1995)DUTKA-MALEN, S; EVERS, S; COURVALIN, P. Detection of glycopeptide resistance genotypes and identifications the species level of clinically relevant enterococci by PCR. Journal of Clinical Microbiology, v. 33, n. 1, p. 24-27, 1995.
ddlE.faecium	E. faecium	Fae2	CATCGTGTA AGCTAACTTC	550	54
Ace	Adesinas de colageno	ACE1	AAAGTAGAATTA GATCCACAC	320	50	*Mannu et al. (2003)*MANNU, L. et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcusfaecium strains of dairy, animal and clinical origin. International Journal of Food Microbiology, v. 88, n. 2-3, p. 291-304, 2003.
Ace	Adesinas de colageno	ACE2	TCTATCACATT CGGTT GCG	320	50
As	Substancias de agregajao	AS1	CCAGTAATCAGTCCAGAAACAACC	406	58	*Mannu et al. (2003)*MANNU, L. et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcusfaecium strains of dairy, animal and clinical origin. International Journal of Food Microbiology, v. 88, n. 2-3, p. 291-304, 2003.
As	Substancias de agregajao	AS2	TAGCTTTTTTCATTCTTGTGTTTGTT	406	58
cylM	Citolisinas	TE13	CTGATGGAAAGAAGATAGTAT	742	56	Eaton e Gasson (2001)EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001.
cylM	Citolisinas	TE14	TGAGTTGGTCTGATTACATTT	742	56
cylB	Citolisinas	TE15	ATTCCTACCTATGTTCTGTTA	843	54	Eaton e Gasson (2001)EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001.
cylB	Citolisinas	TE16	AATAAACTCTTCTTTTCCAAC	843	54
cylA	Citolisinas	TE17	T GGAT GATAGT GATAGGAAGT	517	56	Eaton e Gasson (2001)EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001.
cylA	Citolisinas	TE18	TCTACAGTAAATCTTTCGTCA	517	56
efaA	Adesinas de parede celular	efaA1	CGTGAGAAAGAAAT GGAGGA	499	60	*Mannu et al. (2003)*MANNU, L. et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcusfaecium strains of dairy, animal and clinical origin. International Journal of Food Microbiology, v. 88, n. 2-3, p. 291-304, 2003.
efaA	Adesinas de parede celular	efaA2	CTACTAACACGTCACGAATG	499	60
Esp	Proteinas de superficie	TE34	TTGCTAATGCTAGTCCACGACC	933	65	Eaton e Gasson (2001)EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001.
Esp	Proteinas de superficie	TE36	GCGTCAACACTTGCATTGCCGAA	933	65
gelE	Gelatinase	TE9	ACCCCGTATCATTGGTTT	419	54	Eaton e Gasson (2001)EATON, T. J.; GASSON, M. J. Molecular screening of Enterococcus virulence determinants and potential genetic exchange between food and medical isolates. Applied and Environmental Microbiology, v. 67, n. 4, p. 1628-1635, 2001.
gelE	Gelatinase	TE10	ACGCATTGCTTTTCCATC	419	54
vanA	Resistencia a vancomicina	VA1	CCCCTTTAACGCTAATACGATCAA	1030	52	*Mannu et al. (2003)*MANNU, L. et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcusfaecium strains of dairy, animal and clinical origin. International Journal of Food Microbiology, v. 88, n. 2-3, p. 291-304, 2003.
vanA	Resistencia a vancomicina	VA2	CATGAATAGAATAAAAGTTGCAAT	1030	52

Antibiótico	Concentração (μg mL^-1)	Grau de sensibilidade^* * O grau de sensibilidade das cepas foi determinado com base nas Normas de Desempenho para Testes de Sensibilidade Antimicrobiana: 15° Suplemento Informativo, Normas Interpretativas do Teste de CIM (μg/mL-1) para Enterococcus spp. (CLSI, 2005)
Antibiótico	Concentração (μg mL^-1)	Sensível (%)	Intermediária (%)	Resistente (%)
Ampicilina	10	100,0	0,0	0,0
Cloranfenicol	30	86,79	13,21	0,0
Eritromicina	15	11,32	28,30	60,38
Estreptomicina	300	100,0	0,0	0,0
Gentamicina	120	100,0	0,0	0,0
Norfloxacina	10	35,85	47,17	16,98
Teicoplanina	30	86,79	3,77	9,44
Tetraciclina	30	92,46	0,0	7,54
Vancomicina	30	84,90	3,77	11,33

Antibióticos	Código das cepas	N° de cepas resistentes
Eritromicina	1; 3; 4; 5; 7; 8; 9; 11; 13; 15; 16; 17; 21; 22; 23; 24; 25; 27; 28; 29; 30; 32; 33; 34; 35;	32
Eritromicina	36; 37; 38; 47; 50; 51 e 52	32
Norfloxacina	1; 7; 11; 13; 14; 19; 21; 28 e 50	9
Teicoplanina	39; 41; 44; 45 e 46	5
Tetraciclina	7; 11; 16 e 17	4
Vancomicina	10; 39; 41; 44; 45 e 46	6

Tipos de hemólise	Frequência (%)
Tipos de hemólise	Sangue de carneiro	Sangue de cavalo
α - hemólise	24,53 (13/53)	5,66 (3/53)
β - hemólise	16,98 (9/53)	18,87 (10/53)
γ - hemólise	58,49 (31/53)	75,47 (40/53)

Genes de virulência	Marcador de virulência	----E. faecium----			----------------Enterococcus spp.--------------							Cepas
Genes de virulência	Marcador de virulência	162	190	191	157	160	161	189	194	195	196	(%)
ace	Adesinas de colágeno	+	-	-	-	-	-	+	+	+	+	50
as	Substâncias de agregação	-	-	-	-	-	-	-	-	-	-	0
cylA	Citolisinas	-	-	-	-	-	-	-	-	-	-	0
cylB	Citolisinas	-	-	-	-	-	-	-	-	-	-	0
cylM	Citolisinas	-	-	-	-	-	-	-	-	-	-	0
efaA	Adesinas de parede celular	+	+	-	-	-	+	+	+	+	+	70
esp	Proteínas de superfície	-	-	-	-	-	+	+	+	+	-	40
gelE	Gelatinase	-	-	+	+	-	+	+	-	-	-	40
vanA	Resistência à vancomicina	-	-	-	-	-	-	-	-	-	-	0
N ° de fatores de virulência		2	1	1	1	0	3	4	3	3	2	-

Universidade Federal do Ceará Av. Mister Hull, 2977 - Bloco 487, Campus do Pici, 60356-000 - Fortaleza - CE - Brasil, Tel.: (55 85) 3366-9702 / 3366-9732, Fax: (55 85) 3366-9417 - Fortaleza - CE - Brazil
E-mail: ccarev@ufc.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] * Autor para correspondência