The existence of only one haplotype of   <i>Leishmania major</i> in the main and potential reservoir hosts of zoonotic cutaneous leishmaniasis using different molecular markers in a focal area in Iran

Najafzadeh, Narmin; Sedaghat, Mohammad Mehdi; Sultan, Syed Shuja; Spotin, Adel; Zamani, Alireza; Taslimian, Roozbeh; Yaghoubinezhad, Amir; Parvizi, Parviz

doi:10.1590/0037-8682-0164-2014

Acessibilidade / Reportar erro

Brasil

Revista da Sociedade Brasileira de Medicina Tropical

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Major Articles • Rev. Soc. Bras. Med. Trop. 47 (5) • Oct 2014 • https://doi.org/10.1590/0037-8682-0164-2014 copy

The existence of only one haplotype of Leishmania major in the main and potential reservoir hosts of zoonotic cutaneous leishmaniasis using different molecular markers in a focal area in Iran

Authorship SCIMAGO INSTITUTIONS RANKINGS

Introduction

Leishmania major is the causative agent of zoonotic cutaneous leishmaniasis (ZCL), and great gerbils are the main reservoir hosts in Iran. Abarkouh in central Iran is an emerging focal point for which the reservoir hosts of ZCL are unclear. This research project was designed to detect any Leishmania parasites in different wild rodent species.

Methods

All rodents captured in 2011 and 2012 from Abarkouh district were identified based on morphological characteristics and by amplification of the rodent cytochrome b (Cyt b) gene. To detect Leishmania infection in rodents, deoxyribonucleic acid (DNA) of each ear was extracted. Internal transcribed spacer-ribosomal deoxyribonucleic acid (ITS-rDNA), microsatellites, kinetoplast deoxyribonucleic acid (kDNA) and cytochrome b genes of Leishmania parasites were amplified by polymerase chain reaction (PCR). Restriction fragment length polymorphism (RFLP) and sequencing were employed to confirm the Leishmania identification.

Results

Of 68 captured rodents in the region, 55 Rhombomys opimus were identified and nine Leishmaniainfections (9/55) were found. In addition, eight Meriones libycus and two Tatera indicawere sampled, and one of each was confirmed to be infected. Two Meriones persicus and one Mus musculuswere sampled with no infection.

Conclusions

The results showed that all 11 unambiguously positive Leishmania infections were Leishmania major. Only one haplotype of L. major(GenBank access No. EF413075) was found and at least three rodents R. opimus, M. libycus and T. indica—appear to be the main and potential reservoir hosts in this ZCL focus. The reservoir hosts are variable and versatile in small ZCL focal locations.

Leishmania parasite; Zoonotic cutaneous leishmaniasis; Rodents; Haplotype; Iran

Genes	Primer name	Primer sequence	Fragment size (bp)		Annealing temperature & cycle number
ITS-rDNA	ITS1F (F)	5′ GCAGCTGGATCATTTTCC 3′	462		58°C, 37
ITS-rDNA	ITS2R4 (R)	5′ ATATGCA GAA GAGAGG AGG C 3′	462		58°C, 37
Microsatellite DNA	ITSmF1 (F)	5′ GTGTGGAAGCCAAGAGGAGG 3′	160		58°C, 37
Microsatellite DNA	ITSmR2 (R)	5′ GCAAGCACCAGAGAGGAGT 3′	160		58°C, 37
kDNA	LINR4 (F)	5′ GGGGTTGGTGTAAAATAGGG 3′		Semi-nested PCR	1^st step: 52°C, 17
	LIN 17 (first-step R)	5′ TTTGAACGGGATTTCTG 3′	650		1^st step: 52°C, 17
	LIN19 (second-step R)	5′ CAGAACGCCCCTACCCG 3′			2^nd step: 58°C, 33
LeishmaniaCytochrome b	LCBF1 (F)	5′ GGTGTAGGTTTTAGTTTAGG 3′	880		50°C, 39
LeishmaniaCytochrome b	LCBR2 (R)	5′ CTACAATAAACAAATCATAATATACAATT 3′	880		50°C, 39
Rodent Cytochrome b^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification.	UNFOR403 (F)	5′ TGAGGACAAATATCATTCTGAGG 3′	624		58°C, 35
	UNREV1025 (R)	5′ GGTTGTCCTCCTCCAATTCATGTTA 3′	624		58°C, 35

Villages							Conventional methods		Molecular methods				Total
Species	Frequency of captured rodents	Harooni	Abarghasr	Khoram abad	Gonbad	Chahgir	Microscopic Observation of Leishmaniaparasites	BALB/C Injection	Leishmania major (+ve) by ITS-rDNA PCR	Leishmania major (+ve) by microsatellite PCR	Leishmania major (+ve) by kDNA PCR	Leishmania major (+ve) by Leishmania Cyt b PCR	Total
Rhombomys opimus	81%	0/10	0/10	1/4	8/26	0/6	1/55	1/55	2^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. /55	8(3^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. )/55	2(1^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. )/55	3^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. /55	9^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. / 55 (13.04%)
Meriones libycus	12%	0	0	0/1	0/3	1/4	1/8	1/8	1/8	1^ The positive microscopic and BALB/C injected samples also tested positive in molecular tests (ITS-rDNA, microsatellite and kDNA gene amplification). /8	1^ The positive microscopic and BALB/C injected samples also tested positive in molecular tests (ITS-rDNA, microsatellite and kDNA gene amplification). /8	1^ The positive microscopic and BALB/C injected samples also tested positive in molecular tests (ITS-rDNA, microsatellite and kDNA gene amplification). /8	1/8 (12.5%)
Mus musculus	1%	0	0	0	0	0/1	0/1	0/1	0/1	0/1	0/1	0/1	0/1 (0%)
Meriones persicus	3%	0	0	0	0/1	0/1	0/2	0/2	0/2	0/2	0/2	0/2	0/2 (0%)
Tatera indica	3%	0	0	0	0	1/2	0/2	0/2	0/2	1/2	1^* * Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification. /2	0/2	1/2 (50%)
Total	100%	0/10 (0%)	0/10 (0%)	1/5 (20%)	8/30 (27%)	2/14 (14%)	2/68 (2.94%)	2/68 (2.94%)	3/68 (4.4%)	10 /68 (14%)	3/68 (4.4%)	4/68 (5.8%)	11 /68 (16%)

Sociedade Brasileira de Medicina Tropical - SBMT Caixa Postal 118, 38001-970 Uberaba MG Brazil, Tel.: +55 34 3318-5255 / +55 34 3318-5636/ +55 34 3318-5287, http://rsbmt.org.br/ - Uberaba - MG - Brazil
E-mail: rsbmt@uftm.edu.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Address to: Dr. Parviz Parvizi. Molecular Systematic Laboratory/Parasitology Department/Pasteur Institute of Iran. 69 Pasteur Ave, Tehran, Iran. Phone/Fax:98 21 6649-6414. e-mail:parp@pasteur.ac.ir