Role of aminoglycoside-modifying enzymes and 16S rRNA methylase (ArmA) in resistance of <i>Acinetobacter baumannii</i> clinical isolates against aminoglycosides

Jouybari, Maryam Asadi; Ahanjan, Mohammad; Mirzaei, Bahman; Goli, Hamid Reza

doi:10.1590/0037-8682-0599-2020

Acessibilidade / Reportar erro

Brasil

Revista da Sociedade Brasileira de Medicina Tropical

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Major Article • Rev. Soc. Bras. Med. Trop. 54 • 2021 • https://doi.org/10.1590/0037-8682-0599-2020 copy

Role of aminoglycoside-modifying enzymes and 16S rRNA methylase (ArmA) in resistance of Acinetobacter baumannii clinical isolates against aminoglycosides

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

INTRODUCTION:

This study aimed to determine the role of genes encoding aminoglycoside-modifying enzymes (AMEs) and 16S rRNA methylase (ArmA) in Acinetobacter baumannii clinical isolates.

METHODS:

We collected 100 clinical isolates of A. baumannii and identified and confirmed them using microbiological tests and assessment of the OXA-51 gene. Antibiotic susceptibility testing was carried out using disk agar diffusion and micro-broth dilution methods. The presence of AME genes and ArmA was detected by PCR and multiplex PCR.

RESULTS:

The most and least effective antibiotics in this study were netilmicin and ciprofloxacin with 68% and 100% resistance rates, respectively. According to the minimum inhibitory concentration test, 94% of the isolates were resistant to gentamicin, tobramycin, and streptomycin, while the highest susceptibility (20%) was observed against netilmicin. The proportion of strains harboring the aminoglycoside resistance genes was as follows: APH(3′)-VIa (aphA6) (77%), ANT(2”)-Ia (aadB) (73%), ANT(3”)-Ia (aadA1) (33%), AAC(6′)-Ib (aacA4) (33%), ArmA (22%), and AAC(3)-IIa (aacC2) (19%). Among the 22 gene profiles detected in this study, the most prevalent profiles included APH(3′)-VIa + ANT(2”)-Ia (39 isolates, 100% of which were kanamycin-resistant), and AAC(3)-IIa + AAC(6′)-Ib + ANT(3”)-Ia + APH(3′)-VIa + ANT(2”)-Ia (14 isolates, all of which were resistant to gentamicin, kanamycin, and streptomycin).

CONCLUSIONS:

High minimum inhibitory concentration of aminoglycosides in isolates with the simultaneous presence of AME- and ArmA-encoding genes indicated the importance of these genes in resistance to aminoglycosides. However, control of their spread could be effective in the treatment of infections caused by A. baumannii.

Keywords:
Acinetobacter baumannii; Aminoglycoside-modifying enzymes; ArmA; Aminoglycoside resistance

Target genes	Primer sequences (5´-3´)	Amplicon size (bp)	94 °C	94 °C	Annealing Temperature and time	72 °C	72 °C	Reference
OXA-51	TAATGCTTTGATCGGCCTTG	353	2 min	25 sec	51 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
	TGGATTGCACTTCATCTTGG
**APH(3′)-VIa**	CGGAAACAGCGTTTTAGA	717	2 min	25 sec	49 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
*(aphA6)*	TTCCTTTTGTCAGGTC
**AAC(3)-IIa**	ATGCATACGCGGAAGGC	822	2 min	25 sec	54 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
*(aacC2)*	TGCTGGCACGATCGGAG
AAC(6′)-Ib	TATGAGTGGCTAAATCGAT	395	2 min	25 sec	54 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
*(aacA4)*	CCCGCTTTCTCGTAGCA
ANT(2")-Ia	ATCTGCCGCTCTGGAT	405	2 min	25 sec	49 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
*(aadB)*	CGAGCCTGTAGGACT
ANT(3")-Ia	ATGAGGGAAGCGGTGATCG	792	2 min	25 sec	62 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
*(aadA1)*	TTATTTGCCGACTACCTTGGT
ArmA	ATTCTGCCTATCCTAATTGG	315	2 min	25 sec	49 °C for 30 sec	30 sec	5 min	⁵5. Sheikhalizadeh V, Hasani A, Ahangarzadeh Rezaee M, Rahmati-Yamchi M, Hasani A, Ghotaslou R, et al. Comprehensive study to investigate the role of various aminoglycoside resistance mechanisms in clinical isolates of Acinetobacter baumannii. J Infect Chemother. 2017;23(2):74-9.
	ACCTATACTTTATCGTCGTC

Antibiotics	No. (%) of resistant, intermediate resistant or susceptible isolates in terms of
	Susceptibility	Total	Hospital wards					Sample types
		(n=100)	Burn	ICU	Surgery	Pediatric	P-value	Wound	Urine	Blood	P-value
			(n=34)	(n=29)	(n=21)	s (n=16)		(n=73)	(n=15)	(n=12)
PIP	R	86	28 (82.3)	28 (96.5)	19 (90.4)	11 (68.7)	0.412	62 (84.9)	14 (93.3)	10 (83.3)	0.917
	I	10	5 (14.7)	1 (3.4)	2 (9.5)	2 (12.5)		8 (10.9)	1 (6.6)	1 (8.3)
	S	4	1 (2.9)	0	0	3 (18.7)		3 (4.1)	0	1 (8.3)
PIP-TAZ	R	78	26 (76.4)	24 (82.7)	16 (76.1)	12 (75)	0.104	54 (73.9)	14 (93.3)	10 (83.3)	0.372
	I	10	4 (11.7)	2 (6.8)	3 (14.2)	1 (6.2)		8 (10.9)	0	2 (16.6)
	S	12	4 (11.7)	3 (10.3)	2 (9.5)	3 (18.7)		11 (15)	1 (6.6)	0
CAZ	R	76	25 (73.5)	22 (75.8)	18 (85.7)	11 (68.7)	0.743	52 (71.2)	15 (100)	9 (75)	0.559
	I	0	0	0	0	0		0	0	0
	S	24	9 (26.4)	1 (3.4)	3 (14.2)	5 (31.2)		21 (28.7)	0	3 (25)
CTX	R	93	32 (94.1)	28 (96.5)	19 (90.4)	14 (87.5)	0.762	67 (91.7)	15 (100)	11 (91.6)	0.618
	I	0	2 (5.8)	1 (3.4)	2 (9.5)	2 (12.5)		6 (8.2)	0	1 (8.3)
	S	7	0	0	0	0		0	0	0
CEF	R	92	32 (94.1)	28 (96.5)	18 (85.7)	14 (87.5)	0.448	67 (91.7)	14 (93.3)	11 (91.6)	0.728
	I	4	1 (2.9)	1 (3.4)	2 (9.5)	0		2 (2.7)	1 (6.6)	1 (8.3)
	S	4	1 (2.9)	0	1 (4.7)	2 (12.5)		4 (5.4)	0	0
IMI	R	75	27 (79.4)	25 (86.2)	17 (80.9)	10 (62.5)	0.617	55 (75.3)	12 (80)	8 (66.6)	0.873
	I	11	4 (11.7)	2 (6.8)	2 (9.5)	3 (18.7)		9 (12.3)	1 (6.6)	1 (8.3)
	S	14	7 (20.5)	2 (6.8)	2 (9.5)	3 (18.7)		9 (12.3)	2 (13.3)	3 (25)
MER	R	97	33 (97)	28 (96.5)	20 (95.2)	16 (100)	0.964	70 (95.8)	15 (100)	12 100)	0.667
	I	0	0	0	0	0		0	0	0
	S	3	1 (2.9)	1 (3.4)	1 (4.7)	0		3 (4.1)	0	0
DOR	R	96	32 (94.1)	28 (96.5)	20 (95.2)	16 (100)	0.797	69 (94.5)	15 (100)	12 (100)	0.913
	I	2	1 (2.9)	1 (3.4)	0	0		2 (2.7)	0	0
	S	2	1 (2.9)	0	1 (5)	0		2 (2.7)	0	0
CIP	R	100	34 (100)	29 (100)	21 (100)	16 (100)	0.100	73 (100)	15 (100)	12 (100)	0.100
	I	0	0	0	0	0		0	0	0
	S	0	0	0	0	0		0	0	0
LEV	R	93	31 (91.1)	27 (93.1)	20 (95.2)	15 (93.7)	0.725	67 (91.7)	14 (93.3)	12 (100)	0.842
	I	3	2 (5.8)	0	0	1 (6.2)		3 (4.1)	0	0
	S	4	1 (2.9)	2 (6.8)	1 (4.7)	0		3 (4.1)	1 (6.6)	0
SXT	R	92	31 (91.1)	27 (93.1)	18 (85.7)	16 (100)	0.935	68 (93.1)	12 (80)	12 (100)	0.216
	I	3	1 (2.9)	1 (3.4)	1 (4.7)	0		1 (1.3)	2 (13.3)	0
	S	5	2 (5.8)	1 (3.4)	2 (9.5)	0		4 (5.4)	1 (6.6)	0

Antibiotics	MIC ranges	No. of the isolates with
	(µg/mL)	Susceptibility	**APH(3′)-VIa**	ANT(2")-Ia	ANT(3")-Ia	AAC(6′)-Ib	**AAC(3)-IIa**	armA	Total
		pattern	*(aphA6)*	*(aadB)*	*(aadA1)*	*(aacA4)*	*(aacC2)*	(n=22)
			(n=77)	(n=73)	(n=33)	(n=33)	(n=19)
Gentamicin	≤4	S	-	-	-	-	-	-	6
	8	I	5	3	1	1	-	1	-
	16-32	R	-	-	-		-	-	94
	64-128	R	5	-	-	-	-	-
	≥256	R	67	70	32	32	19	21
	MIC₅₀		512	256	512	512	256	1024	256
	MIC₉₀		1024	256	1024	256	256	1024	512
Tobramycin	≤4	S	3	3	-	-	-	1	4
	8	I	1	-	-	-	-	2	2
	16-32	R	2	-	1	-	-	-	94
	64-128	R	-	2	1	4	2	3
	≥256	R	71	68	31	29	17	16
	MIC₅₀		256	512	512	256	512	512	512
	MIC₉₀		1024	1024	1024	512	1024	512	1024
Amikacin	≤16	S	13	10	6	6	2	3	16
	32	I	7	10	6	6	5	1	10
	64	R	-	1	-	-	-	-	74
	128	R	-	4	-	-	-	-
	≥256	R	57	48	21	21	12	18
	MIC₅₀		256	1024	512	512	512	256	512
	MIC₉₀		512	512	512	1024	512	256	1024
Netilmicin	≤8	S	8	8	3	-	1	2	20
	16	I	6	-	-	4	-	6	12
	32	R	8	10	4	6	4	2	68
	64-128	R	5	7	1	3	2	4
	≥256	R	50	48	25	20	12	8
	MIC₅₀		256	128	64	256	256	128	128
	MIC₉₀		256	128	64	512	512	128	256
Kanamycin	≤16	S	4	2	-	-	-	-	4
	32	I	2	2	-	-	-	-	2
	64	R	-	3	-	1	-	-	94
	128	R	3	2	2	-	2	1
	≥256	R	68	64	31	32	17	21
	MIC₅₀		64	32	128	64	256	128	128
	MIC₉₀		64	256	256	64	256	256	256
Streptomycin	≤4	S	1	-	1	1	-	-	6
	8	S	1	1	-	1	-	-
	16	S	-	-	-	-		-
	32	I	-	-	-	-	-	-	-
	64-128	R	3	3	-	3	2	-	94
	≥256	R	72	69	32	28	17	18
	MIC₅₀		256	128	256	256	256	512	256
	MIC₉₀		256	128	512	1024	128	512	512
Spectinomycin	≤4	S	1	1	-	-	-	3	12
	8	S	7	5	2	2	-	-
	16	S		-		-	-	-
	32	I	8	3	-	1	-	5	10
	64-128	R	2	1	-	2	2	1	78
	≥256	R	59	63	31	28	17	13
	MIC₅₀		256	256	512	64	64	256	256
	MIC₉₀		256	512	256	128	128	256	512

Antibiotics	Susceptibility Pattern	No. (%) of the isolates contained
		APH(3′)-VIa (aphA6)	P-value	ANT(2")-Ia (aadB)	P-value	ANT(3")-Ia (aadA1)	P-value	AAC(6′)-Ib (aacA4)	P-value	AAC(3)-IIa (aacC2)	P-value	armA	P-value
		(n=77)		(n=73)		(n=33)		(n=33)		(n=19)		(n=22)
Gentamicin	Non-susceptible	77 (100)	0.012	73 (100)	0.023	33 (100)	0.033	33 (100)	0.033	19 (100)	0.007	22 (100)	0.021
	Susceptible	0		0		0		0		0		0
Tobramycin	Non-susceptible	74 (96.1)	0.019	70 (95.8)	0.029	33 (100)	0.003	33 (100)	0.003	19 (100)	0.007	21 (95.4)	0.024
	Susceptible	3 (3.8)		3 (4.1)		0		0		0		1 (4.5)
Amikacin	Non-susceptible	64 (83.1)	0.036	63 (86.3)	0.037	27 (81.8)	0.038	27 (81.8)	0.038	17 (89.4)	0.024	19 (86.3)	0.033
	Susceptible	13 (16.8)		10 (13.6)		6 (18.1)		6 (18.1)		2 (10.5)		3 (13.6)
Netilmicin	Non-susceptible	63 (81.8)	0.042	65 (89.04)	0.039	30 (90.9)	0.014	29 (87.8)	0.032	18 (94.7)	0.018	14 (63.6)	0.072
	Susceptible	15 (19.4)		8 (10.9)		3 (9.09)		4 (12.1)		1 (5.2)		8 (36.3)
Kanamycin	Non-susceptible	73 (94.8)	0.029	71 (97.2)	0.023	33 (100)	0.003	33 (100)	0.003	19 (100)	0.007	22 (100)	0.021
	Susceptible	4 (5.1)		2 (2.7)		0		0		0		0
Streptomycin	Non-susceptible	75 (97.4)	0.015	72 (98.6)	0.019	32 (96.9)	0.019	31 (93.9)	0.021	19 (100)	0.007	18 (81.8)	0.044
	Susceptible	2 (2.5)		1 (1.3)		1 (3.03)		2 (6.06)		0		4 (18.1)
Spectinomycin	Non-susceptible	69 (89.6(	0.028	67 (91.7)	0.037	31 (93.9)	0.021	31 (93.9)	0.021	19 (100)	0.007	19 (86.3)	0.033
	Susceptible	8 (10.3)		6 (8.2)		2 (6.06)		2 (6.06)		0		3 (13.6)

Gene profile (No.)	Gentamicin		Tobramycin		Amikacin		Netilmicin		Kanamycin		Streptomycin		Spectinomycin
	NS	S	NS	S	NS	S	NS	S	NS	S	NS	S	NS	S
	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)	(%)
ArmA (9)	9 (100)	-	9 (100)	-	7 (77.7)	2 (22.2)	3 (33.3)	6 (66.6)	9 (100)	-	7 (77.7)	2 (22.2)	9 (100)	-
aphA6 (2)	2 (100)	-	2 (100)	-	-	2 (100)	-	2 (100)	1 (50)	1 (50)	2 (100)	-	-	2 (100)
aadB (4)	4 (100)	-	3 (75)	1 (25)	3 (75)	1 (25)	2 (50)	2 (50)	3 (75)	1 (25)	4 (100)	-	3 (75)	1 (25)
ArmA + aphA6 (3)	3 (100)	-	3 (100)	-	2 (66.6)	1 (33.3)	2 (66.6)	1 (33.3)	3 (100)	-	3 (100)	-	2 (66.6)	1 (33.3)
aacA4 + aadA1 (2)	2 (100)	-	2 (100)	-	2 (100)	-	1 (50)	1 (50)	2 (100)	-	2 (100)	-	2 (100)	-
aadA1 + armA (2)	2 (100)	-	2 (100)	-	1 (50)	1 (50)	2 (100)	-	2 (100)	-	1 (50)	1 (50)	2 (100)	-
aadA1 + aphA6 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aadB + aadA1 (2)	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-
aphA6 + aadB (39)	38 (97.4)	1 (2.56)	38 (97.4)	1 (2.56)	34 (87.1)	5 (12.8)	37 (94.8)	2 (5.1)	39 (100)	-	33 (84.6)	6 (15.3)	32 (82)	7 (17.9)
aacA4 + aphA6 (3)	3 (100)	-	3 (100)	-	3 (100)	-	3 (100)	-	3 (100)	-	3 (100)	-	3 (100)	-
aadB + aadA1 +aphA6 (2)	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-
aacA4 + aadB +aadA1 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aacA4 + aadB + aphA6 (1)	1 (100)	-	1 (100)	-	1 (100)	-	-	1 (100)	1 (100)	-	-	1 (100)	1 (100)	-
aadB + armA + aphA6 (3)	3 (100)	-	3 (100)	-	2 (66.6)	1 (33.3)	2 (66.6)	1 (33.3)	3 (100)	-	3 (100)	-	2 (66.6)	1 (33.3)
aacA4 + aacC2 + aphA6 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aacA4 + armA+ aphA6 (2)	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-
aacC2 + aacA4 + aadA1 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aacA4 + aadA1 + aphA6 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aacC2 + aacA4+ aadB + aphA6 (1)	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-	1 (100)	-
aacA4 + aadB +aadA1 + aphA6 (4)	4 (100)	-	4 (100)	-	4 (100)	-	4 (100)	-	4 (100)	-	4 (100)	-	4 (100)	-
aacC2 + aacA4 + aadA1 + aphA6 + aadB (14)	14 (100)	-	13 (92.8)	1 (7.1)	12 (85.7)	2 (14.2)	12 (85.7)	2 (14.2)	14 (100)	-	14 (100)	-	13 (92.8)	1 (7.1)
aacC2 + aacA4 + aadA1 + aadB + armA + aphA6 (2)	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-	2 (100)	-

Sociedade Brasileira de Medicina Tropical - SBMT Caixa Postal 118, 38001-970 Uberaba MG Brazil, Tel.: +55 34 3318-5255 / +55 34 3318-5636/ +55 34 3318-5287, http://rsbmt.org.br/ - Uberaba - MG - Brazil
E-mail: rsbmt@uftm.edu.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Corresponding Author: Dr. Hamid Reza Goli. e-mail:goli59@gmail.com