Scielo RSS <![CDATA[Pesquisa Agropecuária Brasileira]]> http://www.scielo.br/rss.php?pid=0100-204X20000010&lang=en vol. 35 num. 10 lang. en <![CDATA[SciELO Logo]]> http://www.scielo.br/img/en/fbpelogp.gif http://www.scielo.br <![CDATA[<B>Influence of the cultivated species and of the native vegetation on leaf-cutting ant nests density in eucalyptus plantations</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000001&lng=en&nrm=iso&tlng=en Este estudo foi realizado em reflorestamentos com eucalipto da V & M Florestal Ltda., em João Pinheiro, MG. O objetivo foi verificar o efeito da espécie de eucalipto cultivada, da idade da planta, assim como da vegetação nativa que circunda os talhões, sobre a densidade de sauveiros. Os dados foram obtidos dos trabalhos de pesquisa do Sistema Monitorado de Combate a Formigas Cortadeiras da V & M Florestal (Simfor), realizados em todos os talhões reflorestados com eucalipto, de diferentes idades, entre 1991 e 1996. A densidade de sauveiros aumentou a partir do início da floresta manejada até o terceiro ano de idade e permaneceu estável a partir daí. A presença das faixas de vegetação nativa reduziu a densidade de sauveiros nos talhões de eucalipto que elas margeiam, e os fragmentos de floresta nativa apresentaram efeito contrário ao das faixas.<hr/>The effects of eucalyptus species and ages, as well as the native vegetation around the eucalyptus plantation, on leaf-cutting ant nests density was studied in a reforested area of V & M Florestal Co., in João Pinheiro, MG, Brazil. Data were obtained from the leaf-cutting ant monitoring program (Simfor) of the company, from the entire planting fields, with different ages, from 1991 to 1996. As a result, the number of leaf-cutting ant nests increased from the beginning up to three years of age of the forest, but maintained the same number afterwards. Native vegetation strips reduced the number of nests in the reforested areas, while native forest fragments showed an opposite effect. <![CDATA[<B>Synthetic sex pheromone use for field trapping of diamondback moth males</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000002&lng=en&nrm=iso&tlng=en Este trabalho teve como objetivo estudar a atração dos machos da traça-das-crucíferas (Plutella xylostella L., Lepidoptera: Yponomeutidae) por diferentes formulações do feromônio sexual sintético. Os tratamentos consistiram em: 1) formulação comercial; 2) Z11,16:Ald; 3) Z11,16:Ac; 4) mistura 7:3 de 2+3; 5) mistura 5:5 de 2+3; 6) septos de borracha com hexano (testemunha); e 7) cinco fêmeas virgens. A formulação comercial do feromônio sexual sintético propiciou maior captura de machos, não diferindo significativamente de fêmeas virgens e da mistura 5:5 utilizadas como isca. Os componentes isoladamente foram pouco atrativos aos machos. Foram testados cinco modelos de armadilhas. A armadilha Pherocon 1 CP (33,2 machos/armadilha/noite) foi a mais eficiente na captura de machos, seguida pelas armadilhas Cilíndrica Aberta, Cilíndrica Fechada, Delta e Redonda Aberta. Três alturas de instalação da armadilha foram avaliadas. Ocorreu significativamente maior captura de machos na altura do ápice das plantas (30 cm do solo). As alturas de 5 e 60 cm não diferiram entre si.<hr/>The aim of this work was to study the attractiveness of males of Plutella xylostella L. (Lepidoptera: Yponomeutidae) to different formulations of synthetic sex pheromone. The treatments were: 1) commercial formulation; 2) Z11,16:Ald; 3) Z11,16:Ac; 4) binary blends 7:3 of 2+3; 5) binary blends 5:5 of 2+3; 6) rubber septa with hexane (control); 7) five virgin females. The commercial formulation of the synthetic sex pheromone was more attractive to males, and did not differ significantly from virgin females and binary blends 5:5 treatments. The components alone were less attractive to males. Five traps were evaluated: Pherocon 1 CP (wing trap), Delta, "PVC 200", "PVC 250" and Black Round Trap, where the wing trap was more effective in capturing males than the other traps tested. The wing trap was evaluated at 5, 30 and 60 cm. More males were caught at 30 cm above the ground level, while the height of 5 and 60 cm did not differ significantly. <![CDATA[<B>Accumulation of biomass, physiological characteristics and grain yield of bean cultivars under irrigated and dry regimes</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000003&lng=en&nrm=iso&tlng=en Em experimento de campo, foram avaliados o crescimento vegetativo e o rendimento de grãos de quatro cultivares de feijoeiro (Phaseolus vulgaris L.), sob condições de irrigação ou de sequeiro, correspondendo respectivamente a lâminas totais de água de 252 e 123 mm. Foram efetuadas amostragens semanais da área foliar e da biomassa da parte aérea e seus componentes. Sob estresse hídrico, a biomassa da parte aérea, o índice de área foliar e a taxa de crescimento da cultura foram reduzidos em todas as cultivares. Não houve diferença significativa no rendimento de grãos sob sequeiro entre cultivares, mas sob deficiência hídrica o rendimento das cultivares foi reduzido, com exceção da 'NegroArgel'. O número de vagens por planta foi o componente de produção mais afetado pelo regime de irrigação. Sob estresse hídrico, verificaram-se menores reduções na biomassa de ramos ao final do ciclo de 'NegroArgel', na duração da área foliar e no rendimento de grãos, indicativos de maior tolerância à seca, enquanto na cultivar Carioca observou-se maior sensibilidade ao estresse hídrico.<hr/>In a field experiment, the vegetative growth and the grain yield of four common bean (Phaseolus vulgaris L.) cultivars were evaluated under irrigated or rainfed conditions, corresponding to total water levels of 252 and 123 mm, respectively. Leaf area and shoot biomass were weekly measured. The water stress reduced the shoot biomass, the leaf area index and the crop growth rate of all cultivars. There was no significant difference between cultivars in grain yield under rainfed; however, the water stress reduced grain yield in cultivars, except for Negro Argel. The number of pods per plant was the yield component most affected by the irrigation regimes. Under rainfed, 'Negro Argel' presented lower reductions in stem biomass at the end of growth cycle, in leaf area duration, and in grain yield, demonstrating a higher drought tolerance, whereas Carioca was the cultivar most sensitive to water stress. <![CDATA[<B>Carbon isotope discrimination and yield of upland rice as affected by drought at flowering</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000004&lng=en&nrm=iso&tlng=en Field experiments involving upland rice genotypes, sown in various dates in late season, were carried out to assess the relationship of carbon isotope discrimination with grain yield and drought resistance. In each one of the three years, one trial was kept under good water availability, while other suffered water shortage for a period of 18-23 days, encompassing panicle emergence and flowering. Drought stress reduced carbon isotope discrimination measured on soluble sugars (deltas) extracted from stem uppermost internode at the end of the imposition period, but had relatively less effect on bulk dry matter of leaves, sampled at the same period, or that of uppermost internodes and grains, sampled at harvest. The drought-induced reduction in deltas was accompanied of reduced spikelet fertility and grain yield. In the three trials subjected to drought, genotypes with the highest yield and spikelet fertility had the lowest deltas. However, this relationship was weak and it was concluded that deltas is not a sufficiently reliable indicator of rice drought resistance to be useful as a screening test in breeding programs. On the other hand, grain yield and spikelet fertility of genotypes which were the soonest to reach 50% flowering within the drought imposition period, were the least adversely affected by drought. Then, timing of drought in relation to panicle emergence and to flowering appeared to be a more important cause of yield variation among genotypes than variation in deltas.<hr/>Experimentos de campo, envolvendo genótipos de arroz de sequeiro, em várias datas de semeadura, realizadas tardiamente na estação de cultivo, foram conduzidos para investigar a relação da discriminação isotópica de carbono com a produtividade de grãos e resistência à seca. Em cada ano, um experimento foi mantido em boas condições hídricas, enquanto o outro sofreu falta de água, por período de 18-23 dias, abrangendo a emergência da panícula e florescimento. A deficiência hídrica reduziu a discriminação isotópica de carbono dos açúcares solúveis (deltas) extraídos do último entrenó do colmo, ao final do período de estresse, causando um efeito relativamente menor sobre a matéria seca das folhas amostradas na mesma ocasião, ou dos entrenós superiores e grãos amostrados na colheita. A redução de deltas induzida por deficiência hídrica foi acompanhada de redução da fertilidade das espiguetas e do rendimento dos grãos. Nos três experimentos submetidos a estresse hídrico, os genótipos de maior rendimento e fertilidade de espiguetas apresentaram os menores valores de deltas. Esta relação, no entanto, foi fraca, concluindo-se, assim, que deltas não é um indicador seguro da resistência à seca em arroz, para ser utilizado com eficiência em programas de melhoramento. Por outro lado, o rendimento de grãos e a fertilidade das espiguetas dos genótipos que apresentaram o florescimento mais precocemente no período de imposição do estresse foram menos afetados pela seca. Assim, o momento de ocorrência da seca, em relação à emergência da panícula e ao florescimento, parece ser mais decisivo na determinação do rendimento de genótipos do que o deltas. <![CDATA[<B>Irrigated rice plant growth in the main crop and the ratoon</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000005&lng=en&nrm=iso&tlng=en Com o objetivo de identificar e avaliar as características fisiológicas que se correlacionam com o rendimento de grãos da cultura principal e da soca para estabelecer critérios de seleção de genótipos de arroz irrigado por inundação com maior capacidade produtiva de grãos, foi conduzido um experimento em solo Gley Pouco Húmico. O delineamento experimental usado foi o de blocos balanceados em grupos, com quatro repetições, onde os grupos consistiram nos ciclos e, as parcelas, dos genótipos em cada ciclo. Na soca, os genótipos de ciclo médio apresentaram maiores valores de matéria seca total da parte aérea e de folha que os de ciclo curto e, na cultura principal, além desses parâmetros, foram superiores na matéria seca de raiz, densidade radicular, índice e duração de área foliar. Os valores de razão de área foliar, área foliar específica e razão de peso de folha da cultura principal foram mais elevados aos 20 dias após a emergência das plântulas e declinaram ao longo do ciclo. Foram realizadas correlações entre as variáveis estudadas e entre estas e o rendimento de grãos da cultura principal e da soca. Os índices fisiológicos da cultura principal correlacionaram-se com o rendimento de grãos, não apresentando, contudo, correlação significativa com o rendimento de grãos da soca.<hr/>A field experiment was conducted to evaluate the physiological characteristics correlated to grain yield in both main and ratoon crops with the objective to establish the criteria for genotype selection in flooding irrigated rice. The experiment was arranged in a group balanced block design with four replications where the groups represented the growth cycles and the plots corresponded to the genotypes within cycles. The intermediate cycle genotypes in the ratoon crop presented the highest values for total aerial dry weight and leaf dry weight as compared to the short cycle cultivars. In the main crop, in addition to those parameters, the same genotypes presented the highest values for root dry weight, root density, leaf area index and leaf area duration. Leaf area ratio, specific leaf area, and leaf weight ratio in the main crop showed the highest at 20 days after emergence and decreased thereafter. Correlation analysis were performed among the variables studied and among those and grain yield of the main and ratoon crops. Physiological indexes of the main crop were correlated to grain yield but these correlations were not found significant for the ratoon crop. <![CDATA[<b>Physiological and morphological responces of <i>Brachiaria</i> spp. to flooding</b>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000006&lng=en&nrm=iso&tlng=en The physiological and morphological responses of the forage grasses Brachiaria brizantha cv. Marandu, B. decumbens and B. humidicola were compared for plants grown in pots under flooding and well-drained conditions for 14 days. Flooding reduced specific leaf area and biomass allocation to roots in all species and enhanced leaf senescence in B. brizantha and B. decumbens. Relative growth rate was reduced by flooding in B. brizantha and B. decumbens, but not in B. humidicola.Leaf elongation rate was unaffected by flooding in B. decumbens and B. humidicola, but declined in B. brizantha since the first day of flooding. Net photosynthesis and leaf chlorophyll content were reduced by flooding in B. brizantha; however, no flooding effect could be detected in the other two species. For all species, there was a close relationship between net photosynthesis and stomatal conductance under flooding. These results show that the studied species have distinct degrees of tolerance to flood, B. brizantha is intolerant, B. decumbens is moderately tolerant and B. humidicola is tolerant. Because leaf elongation rate was immediately depressed by flooding only in B. brizantha, this measurement could be appropriate as an early detection mechanism for relative flood tolerance in Brachiaria spp.<hr/>As respostas morfológicas e fisiológicas de Brachiaria brizantha cv. Marandu, B. decumbens e B. humidicola foram comparadas em plantas cultivadas em vasos, sob solo alagado e bem drenado durante 14 dias. O alagamento reduziu a área foliar específica e a alocação de biomassa para as raízes em todas as três espécies e aumentou a senescência foliar em B. brizantha e B. decumbens. O alagamento reduziu a taxa de crescimento relativo em B. brizantha e B. decumbens, mas não em B. humidicola. A taxa de elongação foliar não foi afetada pelo alagamento em B. decumbens e B. humidicola, mas diminuiu em B. brizantha desde o primeiro dia de alagamento. A fotossíntese líquida e o conteúdo de clorofila foliar foram reduzidos pelo alagamento em B. brizantha; no entanto, nenhum efeito do alagamento pôde ser detectado nas outras espécies. Em todas as espécies, existiu uma estreita relação entre as taxas de fotossíntese líquida e a condutância estomatal. Esses resultados mostram que as espécies estudadas diferem quanto à tolerância ao alagamento. B. brizantha é intolerante, B. decumbens é moderadamente tolerante e B. humidicola é tolerante. Em virtude de a taxa de elongação foliar ter sido imediatamente afetada somente em B. brizantha, este parâmetro pode ser empregado como um mecanismo de detecção prematura da tolerância ao alagamento em Brachiaria spp. <![CDATA[<B>Effects of sowing dates on performance of dryland rice cultivars under sprinkler irrigation, in Selvíria, MS, Brazil</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000007&lng=en&nrm=iso&tlng=en Este trabalho teve por objetivo avaliar os efeitos da época da semeadura no comportamento de diferentes cultivares de arroz (Oryza sativa L.) de sequeiro (IAC 201, Carajás, Guarani, IAC 202, CNA 7800, CNA 7801, Caiapó, Rio Paranaíba e Araguaia) irrigados por aspersão, quanto à produção e qualidade dos grãos. As sementes foram semeadas no início da segunda quinzena dos meses de setembro, outubro, novembro, dezembro, janeiro e fevereiro. Os experimentos foram instalados no Município de Selvíria, MS, durante os anos agrícolas 1995/96 e 1996/97. O delineamento experimental utilizado foi o de blocos casualizados, com quatro repetições. O controle da irrigação foi realizado por meio de tensiômetros, e a suplementação hídrica foi realizada quando o potencial matricial atingiu -0,033 MPa, durante a fase reprodutiva e -0,058 MPa, nas demais fases. De acordo com os resultados obtidos, pode-se concluir que as cultivares CNA 7801, Carajás, IAC 201, CNA 7800 e IAC 202 apresentaram comportamento superior; a semeadura realizada em novembro propiciou produtividade mais elevada; semeaduras antecipadas (setembro-outubro) ou retardada (fevereiro) resultaram em menores índices de acamamento; as cultivares IAC 202, CNA 7800 e CNA 7801 apresentaram ausência ou baixo índice de acamamento, nas diferentes épocas de semeadura e, a semeadura retardada (fevereiro) proporcionou a obtenção de maior rendimento de inteiros.<hr/>This study was carried out to evaluate the effects of sowing periods on the performance of dryland rice (Oryza sativa L.) (IAC 201, Carajás, Guarani, IAC 202, CNA 7800, CNA 7801, Caiapó, Rio Paranaíba and Araguaia cultivars) under sprinkler irrigation. The seeds were sowed at the beginning of the second fortnight of September, October, November, December, January and February. The experiments were conducted in Selvíria, MS, Brazil, during the agricultural years of 1995/96 and 1996/97. The experimental design used in each sowing was in randomized blocks, with four replications. The irrigation control was done through tensiometer and the water supply was established when the matric potential reached -0.033 MPa, during the reproductive phase and -0.058 MPa, in the other phases. The results showed that CNA 7801, Carajás, IAC 201, CNA 7800, and IAC 202 presented better performance; November sowing reached higher productivity; earlier sowings (September-October) or delayed (February) caused smaller laying indexes; IAC 202, CNA 7800, and CNA 7801 presented absence or lower laying index, in the different sowing times and, in delayed sowing (February) larger whole grain rate was obtained. <![CDATA[<B>Grain yield and plant morphology of cowpea genotypes with different planting densities under irrigated and rainfed conditions</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000008&lng=en&nrm=iso&tlng=en Este trabalho teve como objetivo avaliar o efeito da densidade populacional na produtividade e no comportamento de alguns caracteres de morfologia de planta de três genótipos de caupi (Vigna unguiculata L. Walp) de diferentes portes, tanto em regime irrigado como de sequeiro. Foram avaliados os genótipos IT 86D-472, de porte semi-ereto, Epace 10, de porte semi-ramador, e TE 90-180-27F, de porte ramador, em cinco diferentes populações, em delineamento de blocos ao acaso, com três repetições. A análise do fatorial apresentou significância em relação a genótipos e interação não-significativa em relação aos caracteres avaliados; quanto à produção de grãos, houve ausência de significância, provocada pela constante superioridade do genótipo Epace 10 nas diferentes populações. Os genótipos apresentaram tendência não-significativa em reduzir o comprimento e o número de nós no ramo principal e maior altura da vagem em relação ao nível do solo, bem como um menor número de ramos secundários (P<0,05), quando cultivados em maiores populações, nos dois ambientes. O genótipo IT 86D-472 respondeu significativamente às diferentes populações, e as maiores produções de grãos foram obtidas com 207.328 e 203.051 plantas/ha em regimes irrigado e de sequeiro, respectivamente. Epace 10 e TE 90-180-27F não responderam significativamente às diferentes populações, tanto em regime de sequeiro como no irrigado.<hr/>The objective of this study was to evaluate the effect of planting densities on yield and on plant architecture of different genotypes of cowpea (Vigna unguiculata L. Walp.) when cultivated under irrigated and rainfed conditions. The genotypes IT 86D-472, Epace 10 and TE 90-180-27F, semi-upright, semi-spreading and spreading growth habits, respectively, were evaluated in five different populations, in a randomized block design, with three replications, at Petrolina, PE, Brazil. The analysis of variance showed significance for genotypes and no significance for genotype x plant population interaction for all characters. The lack of significance in grain production occurred because the genotype Epace 10 showed superiority in all five populations. The genotypes showed non-significant tendency to decrease the length and number of nodes in main branches, to increase the height of first pods from the soil and to decrease the number of secondary branches (P<0.05), when cultivated in higher populations in both environments. IT 86D-472 showed significance to populations and the highest grain yields were obtained with 207,328 and 203,051 plants/ha under irrigated and rainfed conditions, respectively. Epace 10 and TE 90-180-27F did not show significance when cultivated under different populations, in both environments. <![CDATA[<B>Methods of graft protection in the production of mango, avocado and macadamia nut nursery trees</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000009&lng=en&nrm=iso&tlng=en Diferentes materiais de proteção do enxerto foram avaliados na produção de mudas de mangueira (Mangifera indica L.) cv. Tommy Atkins, abacateiro (Persea americana L.) cv. Fortuna e nogueira-macadâmia (Macadamia integrifolia Maiden & Betche) cv. Kau 344. Os materiais utilizados foram: saco de polietileno, parafina, parafina + vaselina, cera de abelha, parafilme e filme de PVC. Verificou-se que o parafilme promoveu melhor resultado de pegamento do enxerto em abacateiro (80,3%) e nogueira-macadâmia (74,1%), seguido pelo filme de PVC (53,4% e 41,7%, respectivamente). Na enxertia de mangueira, o parafilme, filme de PVC e saco de polietileno não diferiram entre si estatisticamente (59,6%, 50,2% e 50,2%, respectivamente). Os porcentuais de pegamento observados nos tratamentos com parafina, parafina + vaselina e cera de abelha foram baixos, em comparação com o melhor tratamento (parafilme). Nas mudas de nogueira-macadâmia o parafilme promoveu melhor desenvolvimento das brotações, além de desprender-se naturalmente dos enxertos. Conclui-se que na enxertia de mangueira os garfos podem ser protegidos com parafilme, filme de PVC ou saco de polietileno; na enxertia de abacateiro, pode-se utilizar parafilme ou filme de PVC, e na enxertia de nogueira-macadâmia deve-se optar pelo parafilme.<hr/>Different methods of graft protection were used in the production of nursery trees of mango (Mangifera indica L.) cv. Tommy Atkins, avocado (Persea americana L.) cv. Fortuna and macadamia nut (Macadamia integrifolia Maiden & Betche) cv. Kau 344. The materials used were polyethylene bag, paraffin, paraffin + vaseline, beeswax, parafilm and PVC film. It was verified that the parafilm promoted more successful grafts in avocados (80.3%) and macadamia nut (74.1%), followed by PVC film (53.4% and 41.7%, respectively). On the grafting of mango plants the parafilm, PVC film or polyethylene bags did not promote statistic difference to each other (59.6%, 50.2% and 50.2%, respectively). The rates of successful grafts to other materials were low if compared with the best treatment (parafilm). The parafilm promoted the best growing of the sprouts in macadamia nursery trees, besides coming off naturally of the grafts. It is concluded that in the mango grafting, the graft can be protected by parafilm, PVC film or polyethylene bags; in the avocado grafting, parafilm or PVC film can be used and in the macadamia grafting the parafilm must be preferred. <![CDATA[<B>Comparisons among methods to conduct segregating bean populations</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000010&lng=en&nrm=iso&tlng=en A eficiência de cinco métodos de condução de populações segregantes foi comparada na cultura do feijoeiro. Para isso foi utilizada a população segregante do cruzamento entre as cultivares Carioca x Flor de Mayo. Foram comparados os métodos genealógico, populacional ou bulk, descendentes de uma única semente ou single seed descent (SSD), bulk dentro de F3 e bulk dentro de F2, os quais foram conduzidos conforme o preconizado em relação a cada método. Os métodos foram avaliados em dois locais: Lavras, no sul de Minas Gerais, e Patos de Minas, localizado na região do Alto São Francisco. Utilizou-se delineamento látice triplo 18 x 18. Foram avaliadas 320 famílias: 64, derivadas de cada um dos métodos, os genitores, e mais duas testemunhas. Com os dados de produtividade de grãos (g/parcela), foram obtidas estimativas de parâmetros genéticos e fenotípicos. Os principais critérios utilizados nas comparações foram o desempenho médio das famílias, o ganho esperado com diferentes intensidades de seleção, e o número de famílias em cada método com desempenho superior a um determinado padrão. Não houve diferenças marcantes entre os métodos, na obtenção de famílias superiores, ou seja: se conduzidos corretamente, todos os métodos permitem sucesso com a seleção. Contudo, considerando as estimativas dos parâmetros genéticos e fenotípicos, juntamente com a facilidade e flexibilidade de condução, os métodos do bulk e do SSD foram os mais vantajosos.<hr/>The efficiency of five methods of conduction of segregating populations was compared in common beans. For this experiment, the segregating population from cross between the cultivars Carioca and Flor de Mayo was used. The methods pedigree, bulk, single seed descent (SSD), F3 derived bulk and F2 derived bulk were conducted as established for each method. They were evaluated in two locations, Lavras, in the south of Minas Gerais, and in Patos de Minas, located in the Alto São Francisco region. Utilizing a 18 x 18 triple lattice design, 320 families were evaluated, with 64 being derived from each method, with the parents and two other checks. Estimatives were obtained from genetic and phenotypic parameters for grain yield data (g/plots). The main criteria utilized to compare the breeding methods were the average performance of the families, the expected response with different selection intensities, and the number of families in each method with superior performance to a particular standard. There were no significant differences between the methods to obtain the superior families, that is, if correctly conducted, all the methods enable similar success with the selection. Considering the estimatives of the genetic and phenotypic parameters, together with the ease and flexibility of conduction, the bulk and SSD method proved to be the most advantageous. <![CDATA[<B>Generalized method for analysis of unbalanced diallels</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000011&lng=en&nrm=iso&tlng=en Apresenta-se um procedimento generalizado de estimação das capacidades geral e específica de combinação em cruzamentos dialélicos, com número desigual de repetições para tratamentos (genitores e combinações híbridas F1), avaliados em um delineamento com restrições na casualização. Neste caso, as médias ajustadas estimadas são interdependentes e heterocedásticas, devendo-se, para estimar os parâmetros desejados, utilizar o modelo linear generalizado de GaussMarkov. O objetivo deste trabalho foi a dedução teórica do método e sua aplicação a um exemplo prático. Foram analisados os dados obtidos de um dialelo completo, sem os recíprocos, envolvendo cinco genitores: CB 511687-1, CB 733753, Diamante Negro, Rosinha G2 e Compuesto Chimaltenango 2. Os genitores CB 733753, CB 511687-1 e Diamante Negro contribuem geneticamente para a resistência, enquanto Rosinha G2 e Compuesto Chimaltenango 2 contribuem para a suscetibilidade do feijoeiro ao crestamento-bacteriano comum. Na maioria dos cruzamentos analisados constatou-se a dominância parcial da suscetibilidade do feijoeiro a Xanthomonas axonopodis pv. phaseoli.<hr/>A general procedure for estimation of general and specific combining ability in diallelic crosses with unequal number of replications for treatments (parents and F1 hybrid combinations), evaluated in a design with restricted randomization, is presented. In this case, the estimates of adjusted means are interdependent and heterocedastic, demanding the use of the GaussMarcov generalized linear model. The objective of this study was the theoretical deduction of the model and its application to a practical example. A complete diallel crossing without reciprocals was performed, including five parents: CB 511687-1, CB 733753, Diamante Negro, Rosinha G-2 and Compuesto Chimaltenango 2. The parents CB 511687-1, CB 733753 and Diamante Negro contribute genetically for resistance while Rosinha G-2 and Compuesto Chimaltenango 2 contribute for susceptibility of dry bean to common bacterial blight. Most of the crosses analyzed showed partial dominance for susceptibility of bean to Xanthomonas axonopodis pv. phaseoli. <![CDATA[<b>Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting</b>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000012&lng=en&nrm=iso&tlng=en GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.<hr/>Sondas moleculares de minissatélites CG-ricas isoladas do genoma humano têm apresentado pouca habilidade de individualização em cavalos. Neste trabalho foram isoladas novas seqüências de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genômico de cavalos Mangalarga-Marchador foi tratado com enzimas de restrição que digerem preferencialmente seqüências não-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estão localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genômica com o oligonucleotídeo (TG)n, demonstraram um perfil de hibridização semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualização obtido foi de 10-8, 10(5) vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinação do parentesco em cruzamentos e apresentaram uma seqüência-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente. <![CDATA[<B>Papaya somatic embryogenic protocol</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000013&lng=en&nrm=iso&tlng=en O presente trabalho teve por objetivo estabelecer um protocolo de embriogênese somática para o mamoeiro (Carica papaya L.) cv. Baixinho de Santa Amália, grupo Solo. Foram utilizados quatro tipos de explantes e duas condições de cultivo, sendo as fases de indução de calos, indução e maturação de embriões somáticos, alongamento e enraizamento das plântulas avaliadas em diferentes meios de cultura. A combinação explante hipocótilo com folhas cotiledonares e meio de cultura ½MS + 10 mg L-1 de 2,4-D, sob condições de escuro, foi a mais favorável para a indução de calos friáveis. Os meios de cultura HMH com 0,2 mg L-1 de ANA e 2,0 mg L-1 de cinetina e ½MS foram adequados para a indução e maturação de embriões somáticos; o meio MS com 1 mg L-1 de GA3 foi adequado para o alongamento das plântulas; e o meio MS com 1 mg L-1 IBA, para o enraizamento. A eficiência das fases de indução de calos, indução de embriões, maturação de embriões, alongamento, enraizamento e aclimatação das plântulas foi de 100%, 98%, 44%, 42%, 50% e 80%, respectivamente. O protocolo estabelecido possibilita que o processo de embriogênese somática seja realizado em um período de 230 dias, com uma eficiência final de 7%, e pode ser utilizado em trabalhos de transformação genética do mamoeiro.<hr/>The objective of this work was to establish a protocol for somatic embryogenesis of papaya (Carica papaya L.) cv. Baixinho de Santa Amália, Solo group. Four explants and two culture conditions were used. The phases of callus induction, somatic embryo induction and development, elongation and rooting were evaluated in different culture media. The combination among hypocotyl with cotyledonal leaves, ½MS medium with 10 mg L-1 2.4-D and dark conditions was the best to induce friable calli. HMH medium with 0.2 mg L-1 ANA and 2.0 mg L-1 kinetin and ½MS medium were suitable to induce and to develop somatic embryos. MS medium with 1 mg L-1 GA3 was the best to elongate the plantlets and MS medium with 1 mg L-1 IBA to root them. The efficiency of callus induction, embryo induction, embryo development, elongation, rooting and acclimatization phases were 100%, 98%, 44%, 42%, 50% and 80%, respectively. The somatic embryogenic protocol enables the process to be done in 230 days with final efficiency of 7%. This protocol can be used in papaya genetic transformation. <![CDATA[<B>Soil solarization for weed control in carrot</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000014&lng=en&nrm=iso&tlng=en Soil solarization is a technique used for weed and plant disease control in regions with high levels of solar radiation. The effect of solarization (0, 3, 6, and 9 weeks) upon weed populations, carrot (Daucus carota L. cv. Brasília) yield and nematode infestation in carrot roots was studied in São Luís (2º35' S; 44º10' W), MA, Brazil, using transparent polyethylene films (100 and 150 mm of thickness). The maximum temperature at 5 cm of depth was about 10ºC warmer in solarized soil than in control plots. In the study 20 weed types were recorded. Solarization reduced weed biomass and density in about 50% of weed species, including Cyperus spp., Chamaecrista nictans var. paraguariensis (Chod & Hassl.) Irwin & Barneby, Marsypianthes chamaedrys (Vahl) O. Kuntze, Mitracarpus sp., Mollugo verticillata L., Sebastiania corniculata M. Arg., and Spigelia anthelmia L. Approximately 40% of species in the weed flora were not affected by soil mulching. Furthermore, seed germination of Commelina benghalensis L. was increased by soil solarization. Marketable yield of carrots was greater in solarized soil than in the unsolarized one. It was concluded that solarization for nine weeks increases carrot yield and is effective for controlling more than half of the weed species recorded. Mulching was not effective for controlling root-knot nematodes in carrot.<hr/>A solarização é uma técnica usada para o controle de plantas daninhas e doenças de plantas em regiões de alta radiação solar. Estudou-se o efeito da solarização (por 0, 3, 6 e 9 semanas) sobre a população de plantas daninhas, a produção de cenoura (Daucus carota L. cv. Brasília) e a infestação das raízes por nematóides. O experimento foi realizado em São Luís, MA, utilizando filmes de plástico com espessuras de 100 e 150 mim. A temperatura máxima a 5 cm de profundidade foi cerca de 10ºC maior nas parcelas solarizadas do que nas testemunhas. Havia 20 tipos de ervas daninhas no experimento. A solarização reduziu a biomassa e densidade das plantas daninhas em 50% das espécies, incluindo Cyperus spp., Chamaecrista nictans var. paraguariensis (Chod & Hassl.) Irwin & Barneby, Marsypianthes chamaedrys (Vahl) O. Kuntze, Mitracarpus sp., Mollugo verticillata L., Sebastiania corniculata M. Arg. e Spigelia anthelmia L. No entanto, foi ineficaz para o controle de 40% das espécies vegetais presentes no campo. Além disso, a solarização estimulou a germinação das sementes de Commelina benghalensis L. O rendimento comercial da cenoura foi maior nas parcelas solarizadas do que naquelas não cobertas. Conclui-se que a solarização por nove semanas aumenta o rendimento da cenoura e foi eficiente para o controle de mais da metade das espécies de plantas daninhas no campo. Porém, a cobertura de plástico foi ineficiente para o controle de nematóides formadores de galhas na cenoura. <![CDATA[<B>Detection of arbuscular mycorrhizal fungi in roots of coffee plants and crotalaria cultivated between rows</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000015&lng=en&nrm=iso&tlng=en Avaliou-se a ocorrência de fungos micorrízicos arbusculares (FMAs) no solo rizosférico e nas raízes de cafeeiro (Coffea arabica L.) e de Crotalaria breviflora DC., cultivada na entrelinha como adubo verde. Amostras de solo rizosférico e raízes foram coletadas em julho de 1997, em parte de um experimento de longa duração conduzido no campo pelo Instituto Agronômico do Paraná, no município de Mirasselva, PR. Determinou-se a diversidade de FMAs, por meio da identificação morfológica dos esporos, a freqüência de ocorrência de populações de FMAs por meio da contagem direta de esporos no solo, e a colonização radicular. Extraiu-se DNA de raízes de cafeeiro colonizadas e não-colonizadas e de esporos de Acaulospora longula e Scutellospora gilmorei, coletados na rizosfera, realizando-se a PCR ("Polimerase chain reaction") com primers ITS ("Internal transcribed spacer") e comparando os perfis de bandas obtidos. O cultivo de crotalária na entrelinha do cafeeiro aumentou a concentração de esporos de FMAs na rizosfera do cafeeiro. A crotalária e o cafeeiro estimularam populações diferentes de FMAs. O gênero Acaulospora predominou na rizosfera do cafeeiro, e Scutellospora e Gigaspora na rizosfera da crotalária. Usando técnicas moleculares, foi possível caracterizar FMAs na rizosfera e nas raízes colonizadas do cafeeiro. O fungo micorrízico Scutellospora gilmorei, de ocorrência comum em cafeeiro e crotalária, não foi encontrado colonizando as raízes do cafeeiro. O uso de técnicas moleculares pode auxiliar no estudo da dinâmica populacional de FMAs no campo.<hr/>The sporulation and occurrence of arbuscular mycorrhizal fungi (AMF) was evaluated in the coffee trees (Coffea arabica L.) and Crotalaria breviflora DC. rhizosphere and roots. C. breviflora was intercropped for green manure of the coffee plants. Samples of rhizosphere soil and roots were collected in July of 1997 in a long-time experiment localized at the Instituto Agronômico do Paraná (IAPAR), in Mirasselva, PR, Brazil. The AMF diversity was determined through the morphologic identification of spores, the AMF occurrence frequency by the direct counting of spores in the soil, and the root colonization. To identify AMF in coffee roots, DNA from spores collected in the rhizosphere and from colonized coffee roots was extracted and used for PCR (Polimerase chain reaction) with ITS (Internal transcribed spacer) primers, comparing the obtained bands. The legume intercropping cultivation increased the spores concentration of AMF in the soil. Coffee and C. breviflora plants stimulated populations of different AMF in their rhizospheres. Scutellospora spp. and Gigaspora spp. were more abundant at the legume rhizosphere. Acaulospora spp. occurred more often in coffee plant rhizospheres. Using molecular techniques, it was possible to characterize AMF in the rhizosphere and in the colonized roots of the coffee plants. Scutellospora gilmorei, of common occurrence in coffee plants and C. breviflora, was not found colonizing the roots of coffee plants. Molecular techiniques can be of great help in the study of AM fungal dynamics in the field. <![CDATA[<b>Total microbial and phosphate-solubilizing population in soil submitted to different cultivation systems</b>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000016&lng=en&nrm=iso&tlng=en O objetivo deste trabalho foi avaliar o efeito de diferentes espécies de plantas, fontes de fósforo e calagem sobre a população microbiana total e solubilizadora de fosfato. Foram isolados fungos e bactérias capazes de solubilizar hidroxiapatita, proporcionando P solúvel. O experimento utilizado foi em blocos ao acaso com fatorial 3x3x2. E os fatores avaliados foram espécies de plantas (controle, braquiária e guandu), fertilizantes (controle, superfosfato simples e fosfato de rocha, ambos na dose de 400 kg ha-1 de P(2)0(5) ) e calagem (com e sem calcário). A população bacteriana cresceu pelo efeito da calagem, e a de fungos aumentou, independentemente da calagem, nas parcelas cultivadas com braquiária e fertilizadas com superfosfato. Foi constatado incremento de biomassa-P microbiana sobre o controle por influência da braquiária (23,9%), do superfosfato (30,9%) e da calagem (46,9%). O número de bactérias solubilizadoras foi favorecido pela calagem ou pelo plantio de guandu adubado com fosfato natural ou com braquiária sem adubação. Os fungos solubilizadores aumentaram na ausência de planta ou de adubação e na presença de guandu com fosfato natural. Finalmente, a calagem favoreceumais o crescimento dos fungos solubilizadores, em comparação com o controle, nos tratamentos fosfato natural, braquiária ou guandu.<hr/>The objective of the present study was to evaluate the effect of different plant species, phosphorus sources, and liming on the total microbial and phosphate-solubilizing population. In order to achieve that, bacteria and fungi capable of solubilizing hydroxyapatite providing available P were isolated. An experiment was carried out in a randomized factorial block design 3x3x2. The factors evaluated were plant species (control, Brachiaria ruziziensis and Cajanus cajan), fertilizers (control, simple superphosphate and rock phosphate, both at the dose of 400 kg ha-1 of P(2)0(5)) and liming (with and without lime). While the bacterial population increased due to the effect of liming, the fungal population also increased independently of liming in the soil cultivated with B. ruziziensis and fertilized with superphosphate. An increase of the microbial biomass-P compared to the control was observed under the influence of B. ruziziensis (23.9%), superphosphate (30.9%) or liming (46.9%). The number of solubilizing bacteria was favored by liming andby the planting of C. cajan fertilized with rock phosphate or with unfertilized B. ruziziensis. The solubilizing fungi increased in the absence of plants or fertilization and in the presence of C. cajan fertilized with rock phosphate. Finally, liming enhanced more the growth of solubilizing fungi than did the control in the treatments using rock phosphate, B. ruziziensis or C. cajan. <![CDATA[<B>Effect of limestone calcium and magnesium ratio on micronutrients in alfalfa</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000017&lng=en&nrm=iso&tlng=en O objetivo deste trabalho foi avaliar o efeito da relação Ca:Mg do corretivo sobre micronutrientes na alfafa, em experimento conduzido em casa de vegetação, em um Latossolo Vermelho-Escuro distrófico. O delineamento experimental utilizado foi, em todos os tratamentos, inteiramente casualizado, com quatro repetições. Foram estudadas cinco relações (1:0, 1:1, 2:1, 3:1, 4:1, na dosagem equivalente a 3.900 kg ha-1), e um tratamento com a dosagem equivalente a 7.800 kg ha-1 (relação 3:1), em seis cortes, com intervalo de 35 dias. Verificou-se que o dobro da aplicação da relação 3:1 diminui significativamente os teores de B, Fe, Mn e Zn. A aplicação só de CaCO3, como corretivo da acidez, não afeta a absorção de Cu. Os teores dos micronutrientes estudados apresentam níveis considerados adequados, sendo, estes, afetados pelas épocas de corte.<hr/>This study evaluated the effect of limestone Ca:Mg ratios on micronutrients in alfalfa. A randomized block design was used with five relations of Ca:Mg ratios (1:0, 1:1, 2:1, 3:1 and 4:1) at a recommended limestone dosage of 3,900 kg ha-1. An additional treatment was included at a ratio of 3:1 with the dosage of 7,800 kg ha-1. All treatments had four replicates in a six-cutting number, in 35 days of interval. The variables analyzed were: concentration and quantity of B, Cu, Fe, Mn, and Zn in dry matter. The decrease of the concentration of B, Fe, Mn and Zn was obtained in the treatment that used twice the recommended dosage. The antagonic effect between Ca, applied as CaCO3, and Cu was not observed in the treatments. The concentration of micronutrients varied according to the cutting times. <![CDATA[<B>Sampling size and spatial variability of chemical properties of a latosol subjected to different soil preparations</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000018&lng=en&nrm=iso&tlng=en O trabalho foi conduzido na Embrapa-Centro Nacional de Pesquisa de Arroz e Feijão, em Santo Antônio de Goiás, GO, em Latossolo Vermelho-Escuro distrófico, textura argilosa, submetido a diferentes sistemas de preparo, durante cinco anos consecutivos (19921996), e cultivado com milho no verão e feijoeiro no inverno, sob irrigação por aspersão. O objetivo foi avaliar as características químicas de um solo Latossolo Vermelho-Escuro após cinco anos de uso de três sistemas de preparo para o plantio. Os sistemas foram: com arado de aiveca, grade aradora e plantio direto. As amostras para análise química foram coletadas, em todos os três tratamentos, em uma malha quadrada de 49 pontos (7x7), a espaços de 4 m x 4 m, e nas profundidades de 0-5 cm e 5-20 cm de solo. As amostras foram analisadas para determinação do pH, Ca, Mg, P, K e cálculo da saturação por bases. Em relação a cada variável calculou-se o valor médio, mínimo, máximo e coeficiente de variação, comparando-se as médias, entre tratamentos, pelo teste t. Os valores de pH, Ca, Mg, P, K e saturação por bases do solo variaram nos diferentes tratamentos. Na profundidade de 0-5 cm, os valores de todas as variáveis foram maiores no sistema plantio direto do que no arado e na grade. Os valores de P e de K apresentaram as maiores variabilidades, e os de pH, as menores.<hr/>The study was conducted at the Embrapa-Centro Nacional de Pesquisa de Arroz e Feijão, in Santo Antônio de Goiás, GO, Brazil, on a clayey Oxisol subjected to different soil tillage systems for five consecutive years and cultivated with corn in the summer and bean in the winter under sprinkler irrigation. The objective of this study was to determine the effects of three soil tillage systems, using moldboard plough, harrow disc and no-tillage. Forty nine soil samples were collected from a 7x7 lattice sampling area spaced 4 m x 4 m at 0-5 cm and 5-20 cm soil depth. Soil samples were analyzed for pH, Ca, Mg, P, K and base saturation. Minimum, maximum and average values were calculated along with the coefficient of variation and average values were compared by the t test. Values of pH, Ca, Mg, P, K and base saturation of soil varied for different treatments. All soil chemical properties values were higher at 0-5 cm soil depth in no-tillage treatment as compared to harrow disc and moldboard plough treatments. Among the soil chemical properties evaluated, P and K concentrations showed the highest variability, whereas pH presented the lowest. <![CDATA[<B>Forms, quantity/intensity ratio and bioavailability of potassium in different Latosols (Oxisols)</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000019&lng=en&nrm=iso&tlng=en O objetivo deste trabalho foi quantificar as formas de potássio em quatro Latossolos da zona fisiográfica dos Campos das Vertentes, MG, influenciados por diferentes materiais de origem, e avaliar sua capacidade de fornecer potássio a duas espécies florestais nativas (angico-amarelo - Peltophorum dubium e cássia-verrugosa - Senna multijuga) e do milho (Zea mays). O experimento foi conduzido em casa de vegetação do Departamento de Ciência do Solo da Universidade Federal de Lavras, em delineamento inteiramente casualizado, com seis repetições. Para a determinação das formas de potássio (potássio total, não-trocável, disponível, trocável e em solução) e da relação quantidade/intensidade, utilizaram-se amostras compostas de solo das camadas superficiais (0-20 cm) e subsuperficiais (20-60 cm). Os resultados mostraram que, entre as formas de potássio avaliadas, apenas o potássio total esteve relacionado com o material de origem, sendo os maiores valores observados nos solos influenciados por rochas pelíticas. O potássio trocável e o disponível foram as formas que mais contribuíram para o potássio total. O potássio em solução apresentou concentração bastante elevada nos quatro solos. Para o angico e cássia-verrugosa, o Latossolo Vermelho-Escuro e o Latossolo Variação Una possuem teores adequados de potássio para o crescimento inicial dessas espécies, ao passo que para o milho houve resposta à aplicação desse nutriente.<hr/>The objective of this work was to quantify the potassium forms in four Latosols (Oxisols) from Campos das Vertentes, MG, Brazil, physiographical zone, influenced by different parent materials, and to evaluate their capacity to furnish potassium to two native forest species (Peltophorum dubium and Senna multijuga) and to corn (Zea mays). The experiment was conducted in greenhouse conditions at Soil Science Department of Universidade Federal de Lavras, in Lavras, MG, Brazil, in a completely randomized design, with six replications. For the characterization of potassium forms (total, non-exchangeable, available, exchangeable and in solution) and determination of the quantity/intensity ratio, soil composite samples from superficial (0-20 cm) and subsuperficial (20-60 cm) layers were utilized. The results showed that, among the evaluated K forms, only the total K was related to the parent material, being the highest values observed for the soils influenced by pellitic rocks. The exchangeable and the available K were the forms which more contributed to the total K. The in solution K presented elevated concentration in the four soils. For the Peltophorum dubium and Senna multijuga, the Dark-Red and Una Latosol revealed adequate amounts of K for the initial growth of these species, while for the corn there was response to this nutrient application. <![CDATA[<B>Effect of calcium chloride and hydrothermical treatment on enzymatic activity and phenol content of pineapple</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000020&lng=en&nrm=iso&tlng=en O abacaxi (Ananas comosus Mill.) está sujeito a danos causados pelo frio durante o armazenamento refrigerado. A aplicação, pós-colheita, de Ca pode contribuir para reduzir vários tipos de desordens fisiológicas. Neste trabalho, verificou-se a influência da aplicação, pós-colheita, de CaCl2 a 2%, associada ao tratamento hidrotérmico (38ºC e 40ºC) por 10 e 20 minutos de imersão, na composição química (fenólicos e enzimas), e na suscetibilidade ao escurecimento interno do abacaxi (Ananas comosus Mill.) cultivar Smooth Cayenne. Os frutos foram armazenados a 9ºC e umidade relativa de 90% por um período de 15 dias. As avaliações foram efetuadas sete dias após a retirada dos frutos das condições de refrigeração. O tratamento dos frutos com CaCl2 reduziu o índice de escurecimento interno, conferindo menor atividade das enzimas polifenoloxidase, peroxidase e fenilalanina amônio liase e reduzindo o teor de compostos fenólicos na polpa quando associado ao tratamento hidrotérmico, independentemente do tempo de imersão.<hr/>Pineapple (Ananas comosus Mill.) is exposed to injuries caused by low temperature during the refrigerated storage. The post-harvest application of Ca may contribute to reduce a number of physiological disorders. In this work, the influence of the postharvest application of 2% CaCl2 associated with hydrothermical treatment (38ºC and 40ºC) for 10 and 20 minutes, on the chemical composition (enzymes, phenols), and susceptibility to internal browning of pineapple `Smooth Cayenne' fruits was studied. The fruits were stored at 9ºC and 90% relative humidity for 15 days. The evaluations were performed seven days after removal of the fruits from the refrigerated conditions. The immersion of the fruits into a 2% CaCl2 solution reduced the index of internal browning and diminished the activities of the enzymes polyphenoloxidase, peroxidase and phenilalanine ammonium lyase, as well as the content of phenolic compounds when associated with the hydrothermic treatment regardless to the immersion period. <![CDATA[<B>Astringency removal of 'Giombo' persimmon fruit in different exposure periods to ethyl alcohol vapor</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000021&lng=en&nrm=iso&tlng=en O objetivo deste trabalho foi avaliar o efeito do período de exposição ao vapor de álcool etílico na remoção da adstringência de frutos de caquizeiro (Diospyros kaki L.) cultivar Giombo. Os frutos foram expostos ao vapor de álcool durante 24, 36 e 48 horas, sob temperatura de 20°C e 95% de umidade relativa. As características químicas e físicas dos frutos foram avaliadas durante dez dias, em intervalos de dois dias. As variáveis analisadas foram: teor de taninos solúveis, firmeza da polpa, perda de matéria fresca, pH, sólidos solúveis totais, acidez total titulável e teor de ácido ascórbico. De acordo com os resultados obtidos, os períodos de 24 e 36 horas demonstraram ser igualmente eficientes no processo de remoção da adstringência dos frutos; no entanto, a avaliação das demais características indicou melhor qualidade dos frutos expostos durante o período de 24 horas. Constatou-se uma diminuição linear na firmeza da polpa em função do tempo. O melhor período para consumo dos frutos situou-se entre o 4°e o 8° dia após o tratamento, considerando-se que a partir do 4° dia a concentração de taninos solúveis ficou abaixo de 0,1%, imperceptível ao paladar, e a firmeza da polpa dos frutos se manteve aceitável durante o período de oito dias posteriores ao tratamento.<hr/>The purpose of this research was to study the effect of exposure period to ethyl alcohol vapor on astringency removal of persimmon fruits (Diospyros kaki L.) cv. Giombo. Fruits were exposed to alcohol vapor for 24, 36 and 48 hours at 20°C and 95% RH. Chemical and physical characteristics of fruits were measured for ten days, at two day intervals. Soluble tannin content, flesh firmness, water loss, pH, soluble solids, titratable acidity and ascorbic acid content were measured. This research showed that 24 and 36 hours were equally efficient in the astringency removal of fruits, although the analysis of other quality indices showed that fruits exposed for 24 hours exhibited better quality. The flesh firmness underwent a linear decrease in terms of time. The best period for consumption of the fruits was placed between the 4th and 8th day after the treatment. Fruits became edible at the 4th day after the treatment, when the content of soluble tannins was under 0.1%, imperceptible to taste, and the flesh firmness was kept for 8 days after the treatment. <![CDATA[<B>Production and quality of pearl millet sowed in two times and fertilized with nitrogen</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000022&lng=en&nrm=iso&tlng=en O trabalho foi conduzido na FCAV-UNESP, câmpus de Jaboticabal, com o objetivo de avaliar as características fisiológicas de crescimento, produção de matéria seca (MS) e teores de proteína bruta (PB), fibra em detergente ácido (FDA) e digestibilidade in vitro da matéria seca (DIVMS) de dois genótipos de milheto (Pennisetum americanum) cultivar Comum e CMS 02/EMBRAPA, semeados em duas épocas (23/11/94 e 10/3/95) e submetidos a quatro doses de N (0; 75; 150 e 225 kg ha-1). O delineamento experimental adotado foi o de blocos ao acaso, com parcelas subdivididas, e três repetições. Na primeira época de semeadura, a cv. Comum apresentou produção de MS total significativamente superior (6.995 kg ha-1) à do genótipo CMS 02 (6.177 kg ha-1), e a aplicação de 150 kg ha-1 foi a dose mais adequada nesse período. Na segunda época de semeadura, a produção de MS total dos genótipos foi, em média, de 2.799 kg ha-1, e a adubação nitrogenada não revelou efeito significativo. Plantas da primeira época de semeadura apresentaram, nos dois primeiros cortes, alta produção de folhas, cujos teores de PB foram superiores a 20%, e os valores de DIVMS em torno de 70%.<hr/>This work was carried out at FCAV-UNESP, Jaboticabal, SP, Brazil, to evaluate growth physiological characteristics, dry matter production, contents of crude protein and acid detergent fiber and the IVDMD of two genotypes of Pennisetum americanum (cv. Comum and CMS 02/EMBRAPA). Genotypes were sown in November/94 and March/95 and submitted to four nitrogen levels (0; 75; 150 and 225 kg ha-1) as ammonium nitrate. A split plot design, with three replications was used. In the first sowing time, the cv. Comum presented higher (P<0.05) total dry-matter production (6,995 kg ha-1) than the genotype CMS 02 (6,177 kg ha-1). The application of 150 kg ha-1 was considered adequate during this period. In the second sowing time, the average total DM productions of the genotypes (2,799 kg ha-1) were similar and the nitrogen fertilization did not show any significative effect. In the first two cuts of the first sowing time the plants presented a high production of leaves with contents of crude protein higher than 20% and values of IVDMD around 70%. <![CDATA[<b>Alternative management for weaned nelore calves in the Pantanal's native pastures</b>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000023&lng=en&nrm=iso&tlng=en Entre março de 1992 e janeiro de 1993 realizou-se este estudo com o objetivo de avaliar o efeito integrado da veda do pasto nativo com o controle estratégico de nematóides gastrintestinais no desempenho corporal de bezerros Nelore pós-desmame no Pantanal da Nhecolândia, MS, Brasil. Dois lotes de animais recém-desmamados aos nove meses foram colocados em invernadas contíguas de pastagens nativas com as mesmas características fisionômicas, que foram vedadas por três meses e meio; a invernada do lote controle foi previamente pastejada por vacas com bezerro ao pé para contaminação. O lote tratado permaneceu com níveis muito baixos de ovos por grama de fezes durante todo o período experimental, e no lote controle foram diminuindo no decorrer do ensaio, terminando semelhantes. No desenvolvimento corporal, observou-se menor perda de peso do lote tratado durante a estação seca e ganho de peso compensatório do lote controle na estação chuvosa subseqüente. Os pesos médios dos dois lotes no final do experimento foram semelhantes.<hr/>The aim of this study was to investigate the integrated effects of native pastures sealing with strategic control of gastrointestinal nematodes on body development of weaned Nellore calves, studied between March 1992 and January 1993 in the Pantanal region, Brazil. Two homogeneous groups of weanling calves were put on contiguous paddocks of native pastures with the same physiognomic characteristics and sealed for three and a half months. The paddock where the non-treated group was put, was previously used by cows that were rearing a calf for contamination of the pasture. The treated group remained with low levels of eggs per gram of feces (EGF) during the whole experimental period. In the non-treated group, the EGF diminished during the assay, ending with similar levels of the treated group. On body development, it was observed a lower body weight loss of the treated group during the dry season and a compensatory weight gain of the nontreated group on the subsequent rainy season. The mean body weight of the two groups was similar at the end of the trial. <![CDATA[<B>Evaluation of nutrients in a calcareous vertisol</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000024&lng=en&nrm=iso&tlng=en Neste experimento estudou-se a disponibilidade de nutrientes em um Vertissolo calcário. Utilizou-se a técnica de diagnóstico por subtração, e o arroz como planta-teste. O delineamento experimental foi o inteiramente ao acaso, com nove tratamentos (completo, -P, -S, -B, -Cu, -Fe, -Mn, -Zn e a testemunha sem adubação), com três repetições. A produção de matéria seca de plantas de arroz mostrou, em seqüência crescente, que os tratamentos que mais limitaram o crescimento foram: completo, -Cu, -Fe, -B, -Mn, -S, testemunha, -P e -Zn. O teor e a produção de matéria seca do arroz mostraram efeito de inibição entre Fe e Mn e entre P e Zn.<hr/>The capacity of calcareous Vertisol to supply nutrients for the growth of rice plants was studied. The method of subtraction diagnostic was adopted in this study. A completely randomized experimental design with nine treatments (complete, control, minus P, minus S, minus B, minus Cu, minus Fe, minus Mn and minus Zn) and three replicates were used. The amount of the dry matter of the rice was ranked in the following decreasing order of treatments: complete, minus Cu, minus Fe, minus B, minus Mn, minus S, control, minus P and minus Zn. The minus P and minus Zn treatments reduced the rice production. The analysis of the nutrients, together with the weight of the dry matter of rice, showed that there was a strong interaction between Fe and Mn and between P and Zn. <![CDATA[<B>Potassium use efficiency of upland rice genotypes</B>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000025&lng=en&nrm=iso&tlng=en O emprego de cultivares eficientes na utilização de nutrientes é uma estratégia importante para reduzir o custo da produção agrícola pela redução do uso de fertilizantes. Foi conduzido um experimento em casa de vegetação na Embrapa-Centro Nacional de Pesquisa de Arroz e Feijão, Fazenda Capivara, Santo Antônio de Goiás. O objetivo foi estudar a resposta de 15 genótipos de arroz (Oryza sativa L.), em terras altas, ao tratamento sem K (nível baixo de K), e 200 mg kg-1 de K (nível alto) no solo. Os genótipos de arroz mostraram diferenças significativas na produção de grãos e no uso de K. Com base na produção de grãos no baixo nível de K e na eficiência agronômica de K, os genótipos foram classificados como eficientes e não-eficientes. Rio Paranaíba, L141 e Guarani foram classificados como eficientes e responsivos. O segundo grupo, mais importante, é de genótipos eficientes e não-responsivos. Três genótipos - CNA6187, CNA7911 e CNA7680 -foram classificados neste grupo.<hr/>Use of nutrient efficient cultivar in crop production is an important strategy in reducing cost of crop production. A greenhouse experiment was conducted at the Embrapa-Centro Nacional de Pesquisa de Arroz e Feijão, Experimental Station of Capivara, Santo Antonio de Goiás, Brazil, to study the efficiency of 15 genotypes of upland rice (Oryza sativa L.) at low (without K application) and high (application of 200 mg kg-1 of K) levels of K applied in the soil. Genotypes differed significantly in relation to grain yield and K use efficiency. Based on grain yield at low K level and agronomic efficiency of K use, genotypes were classified as efficient and unefficient. Genotypes Rio Paranaíba, L141 and Guarani were classified as efficient and responsives. Second most important group of the genotypes was efficient and non-responsive. Genotypes CNA6187, CNA7911 and CNA7680 fall in this category.