Scielo RSS <![CDATA[Summa Phytopathologica]]> http://www.scielo.br/rss.php?pid=0100-540520170002&lang=en vol. 43 num. 2 lang. en <![CDATA[SciELO Logo]]> http://www.scielo.br/img/en/fbpelogp.gif http://www.scielo.br <![CDATA[Symbiotic and endophytic fungi as biocontrols against cocoa (<em>Theobroma cacao</em> L.) phytopathogens]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200087&lng=en&nrm=iso&tlng=en ABSTRACT Cocoa (Theobroma cacao L.) is a tropical tree, seriously affected by fungal diseases. To control several pathogens, biological methods are prescribed since they are friendly to the environment and easy to use. The main objective of this study was to assess the biocontrol effect of two native strains, Trichoderma viride and Botryosphaeria quercum, on phytopathogens such as Phytophthora palmivora and Moniliophtora roreri, causal agents of black pod and frosty pod rot diseases, respectively. In addition, biocontrolers were faced on potential mycotoxigenic fungi such as Aspergills flavus and Fusarium solani, which are very common on cocoa. The Bio-Control Index (BCI) was calculated to determine the in vitro biocontrol effect against the four phytopathogens. Results indicated that the best biocontrol agent of phytopathogens was B. quercum, showing BCI of 82.3%, 80.7%, 63.3% and 59.7% for each tested phytopathogen, respectively. Competition for substrate was the dominant biocontrol strategy. As to the origin of strains, those coming from the Department Norte de Santander and Santander showed the highest average inhibition percentage. This study provides an initial screening to the endophytic and antagonistic potential of fungi, specifically those capable of colonizing cocoa pods and soils. Thus, these strains can be used as an efficient biological control alternative against several known phytopathogens of cocoa in the field.<hr/>RESUMO Cacau (Theobroma cacao L.) é uma árvore tropical, bastante atacada por doenças fúngicas. Para o controle de doenças, métodos biológicos são prescritos uma vez que são amigáveis ao meio ambiente e fácil de usar. O principal objetivo do estudo foi avaliar o efeito de biocontrole das estirpes nativas, Trichoderma viride e Botryosphaeria quercum, em fitopatgenos: tais como Phytophthora palmivora e Moniliophtora roreri, agentes causais de doenças podridão parda e monilíase, respectivamente. Além disso, os agentes de biocontroles foram avaliados no controle de fungos micotoxigênico: como Aspergills flavus e Fusarium solani, que são muito comuns em cacau. O Índice de Bio-Controle (BCI) foi calculada para determinar o efeito in vitro de biocontrole contra quatro fitopatógenos. Os resultados indicaram que o melhor agente de controle biológico de fitopatogenos era B. quercum, que mostra 82,3% de BCI e 80,7%, 63,3% e 59,7% para cada um dos fitopatógenos testados, respectivamente. A competição por substrato foi a estratégia utilizada no controle biológico. As estirpes, provenientes do Departamento de Santander e Santander Norte apresentaram a maior inibição percentual média. Este estudo é um inicial para sobre o potencial endófito e antagonística de fungos, capazes de colonizar as especificamente bagas de cacau e solo. Assim, estas estirpes podem ser indicadas uma alternativa eficiente contra fitopatógenos de cacau importantes. <![CDATA[Relationship between <em>Rps 1k</em> gene and resistance to <em>Pythium ultimum and P. irregulare</em> in soybean]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200094&lng=en&nrm=iso&tlng=en RESUMEN En el cultivo de soja Pythium spp. produce la pudrición de semillas y raíces, y “damping off”. El objetivo del presente trabajo fue verificar la relación entre el gen Rps 1k de resistencia a Phytophthora sojae y P. ultimum y P. irregulare. Cuatro genotipos de soja, dos con el gen Rps 1k (SE+1y SE+2) y dos sin el gen (SE-1 y SE-2) se sembraron en suelo inoculado y sin inocular. Los genotipos SE-1 y SE-2 no difirieron entre sí, ya sea que estuviesen inoculados o no, ni tampoco difirieron del SE+2. En cambio, los genotipos con el gen Rps1k difirieron entre sí, tanto los que estuvieron inoculados como los no inoculados. SE+2 presentó un 95% de emergencia mientras que SE+1 presentó un 78.35% de emergencia pero en ambos casos la emergencia disminuyó cuando se inoculó, con 63.35% y 34.15% respectivamente. Bajo las condiciones del presente ensayo las variedades utilizadas conteniendo el gen Rps 1k a Ph. sojae no presentaron mayor número de plántulas emergidas frente a las cepas probadas de P. ultimum ni de P. irregulare.<hr/>ABSTRACT In soybean Pythium spp. produces seed and root rot and “damping off”. The aim of this study was to verify the relationship between resistant gene Rps 1k to Phytophthora sojae with Pythium ultimum and P. irregulare. Four genotypes of soybean were sown on inoculated soil, two of them with gene Rps 1k and the other two without it. Genotypes without the gene did not differ among themselves, no matter whether they were inoculated or not. On the other hand, Rps1k genotypes differed from each other, whether or not they were inoculated. SE+2 presented 95% of emergence whereas SE+1 presented 78.35% of emergence, but in both cases the emergence decreased when genotypes were inoculated with 63.35% and 34.15% respectively. Under the assayed conditions the gene Rps1k resistant to Ph. sojae did not show a greater number of emerged seedlings against the tested strains of P. ultimum or P. irregulare.<hr/>RESUMO Em soja Pythium spp. causa apodrecimento de sementes, da raiz e “tombamento”. O objetivo deste estudo foi verificar a relação do gene de resistência Rps 1k de Phytophthora sojae com Pythium ultimum e P. irregulare. Quatro genótipos de soja foram semeados em solo inoculado ou não com Pythium spp, dois deles com o gene Rps 1k (SE+1 e SE+2) e os outros dois sem ele (SE-1 e SE-2). Os genótipos SE-1 e SE-2 não diferiram entre si, não importa se eles foram inoculados ou não, nem eram diferentes de SE + 2. Por outro lado, genótipos com Rps 1k diferiam uns dos outros, sendo inoculados ou não. SE + 2 apresenta uma emergência de 95% enquanto que a SE + 1 tinha 78.35% de emergência, mas em ambos os casos a emergência diminuiu quando foram inoculados, com 63.35% e 34.15% respectivamente. Nas condições analisadas o gene Rps 1k de resistência a Ph. sojae não mostrou aumento do número de plântulas emergidas testados contra as espécies de P. ultimum ou P. irregulare. <![CDATA[Reaction of passion fruit cultivars in areas with fusariosis]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200098&lng=en&nrm=iso&tlng=en RESUMO O objetivo deste trabalho foi avaliar a sobrevivência de oito cultivares de P. edulis Sims. e a reação do maracujazeiro amarelo enxertado sobre Passiflora foetida L. em área com histórico de fusariose (Fusarium oxysporum f. sp. passiflorae) na região de Mossoró/RN. Foram conduzidos dois ensaios, onde foram plantadas oito cultivares de maracujazeiro (FB 200, FB 300, BRS Gigante Amarelo, BRS Sol do Cerrado, BRS Rubi do Cerrado, IAC 273, IAC 275 e IAC 277) e uma cultivar comercial ‘redondo amarelo’ da Topssed® enxertada sobre P. foetida, em área naturalmente infestada com F. oxysporum f. sp. passiflorae. O delineamento experimental adotado foi em blocos ao acaso, com quatro repetições e três plantas por parcela. No ensaio I foi avaliado a sobrevivência das cultivares e no ensaio II, avaliou-se a incidência da fusariose e a classe de reação, identificando os tratamentos como resistentes, moderadamente susceptíveis e susceptíveis. Todas as cultivares (ensaio I) apresentaram baixos índices de sobrevivência aos 180 dias após o plantio. As cultivares não enxertadas (ensaio II) foram classificadas como susceptíveis, com incidência de fusariose variando de 22,22 a 91,67%. Não houve registro de incidência de fusariose no maracujazeiro enxertado sobre P. foetida (ensaio II) durante o período de avaliação, mostrando-se como um porta-enxerto promissor para solos infestados com Fusarium oxysporum.<hr/>ABSTRACT The aim of this study was to evaluate the survival of eight cultivars of P. edulis Sims. and the reaction of yellow passion fruit grafted on Passiflora foetida L. in an area with history of fusariosis (Fusarium oxysporum f. sp. passiflorae) in the region of Mossoró/RN. Two assays were conducted, in which eight passion fruit cultivars (FB 200, FB 300, BRS Gigante Amarelo, BRS Sol do Cerrado, BRS Rubi do Cerrado, IAC 273, IAC 275 and IAC 277) were planted and a commercial cultivar ‘yellow round’ by Topssed® was grafted on P. foetida in an area naturally infested with F. oxysporum f. sp. passiflorae. Experimental design was in randomized blocks with four replicates and three plants per plot. In Assay I the survival of cultivars was evaluated and in Assay II the incidence of fusariosis and the reaction class were evaluated, identifying treatments as resistant, moderately susceptible and susceptible. All cultivars (Assay I) showed low survival rates at 180 days after planting. Non-grafted cultivars (Assay II) were classified as susceptible, and fusariosis incidence ranged from 22.22 to 91.67%. There was no record of fusariosis incidence in passion fruit grafted on P. foetida (Assay II) during the evaluation period, which showed to be a promising rootstock for soils infested with Fusarium oxysporum. <![CDATA[Selection of <em>Eucalyptus</em> genotypes resistant to rust .<em>Puccinia psidii</em>. using monocyclic parameters]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200103&lng=en&nrm=iso&tlng=en RESUMO A variabilidade genética dentro do gênero Eucalyptus para resistência à doenças e a fatores abióticos estão presentes, particularmente, com a ferrugem do eucalipto (Puccinia psidii WINTER), cuja primeira medida de controle é evitar o plantio comercial de materiais suscetíveis. A busca de caracteres quantitativos da resistência pode levar a genótipos superiores com resistência mais durável. Por isso, este estudo objetivou identificar parâmetros monocíclicos de avaliação da ferrugem em eucalipto, mais proximamente relacionados à resistência genética e estabelecer um ranking com os genótipos de maior resistência à ferrugem para compor um programa de melhoramento genético, além de relacionar a resposta do hospedeiro às vias metabólicas de defesa. Para tanto, foi realizado um estudo comparativo entre a avaliação da ferrugem no campo, com auxilio de escala qualitativa de severidade da doença com parâmetros monocíclicos quantitativos da doença em ambiente controlado. O predomínio de indivíduos suscetíveis indicou possíveis distorções de segregação nos cruzamentos, corroborando com hipóteses de estudos anteriores. Os resultados demonstraram, que o gene de resistência presente nesta população é dependente da ação de outros genes indiretamente relacionados à resistência e que participam das vias metabólicas de defesa das plantas.<hr/>ABSTRACT Genetic variability within the genus Eucalyptus for resistance to diseases and abiotic factors is present, especially for eucalyptus rust (Puccinia psidii WINTER), the first control measure of which is to prevent commercial planting of susceptible plants. Search for quantitative resistance traits can lead to superior genotypes with durable resistance. This study aimed to identify monocyclic parameters for evaluating rust in eucalyptus, most closely related to genetic resistance, and to establish a ranking of genotypes with greater resistance to rust in order to prepare a breeding program, besides relating the host response to the plant defense pathways. Therefore, a comparative study was conducted between assessment of rust in the field, based on a qualitative disease severity scale, and quantitative monocyclic parameters of the disease in a controlled environment. Prevalence of susceptible individuals indicated possible segregation distortions, corroborating hypotheses of previous studies. Results showed that the resistance gene present in this population is dependent on the action of other genes that are indirectly related to resistance and that participate in the metabolic defense pathways of Eucalyptus. <![CDATA[Early leaf removal as a strategy to control <em>Botrytis cinerea</em> rot in Cabernet Sauvignon grapevine at high altitude regions]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200111&lng=en&nrm=iso&tlng=en RESUMO Botrytis cinerea é um dos mais importantes patógenos da videira nas regiões de altitude em Santa Catarina. O presente trabalho objetivou avaliar a influência de diferentes épocas de desfolha no progresso da podridão de B. cinerea na videira Cabernet Os ensaios foram conduzidos nas safras 2014/2015 e 2015/2016, em um vinhedo comercial, situado a 1230m (a.n.m.), no munícipio de São Joaquim, SC (28º 17’ 39” S e 49º 55’ 56” W). Foi utilizado a variedade Cabernet Sauvignon, enxertada sobre o porta-enxerto Paulsen 1103, conduzida em espaldeira, com espaçamento de 3,0m x 1,5m e cobertura anti-granizo. Os tratamentos consistiram na realização da desfolha nos estádios fenológicos: plena florada, grão chumbinho, grão ervilha, virada de cor, 15 dias após a virada de cor e plantas não submetidas ao manejo da desfolha. A doença foi quantificada quinzenalmente nos cachos, no início dos primeiros sintomas até a colheita. As curvas de progresso da doença foram elaboradas e comparadas de acordo com: início do aparecimento dos sintomas, tempo para atingir a máxima incidência e severidade da doença, incidência e severidade máxima da doença, área abaixo da curva de progresso da incidência e severidade da doença. Os resultados desse estudo evidenciam que desfolhas precoces devem ser recomendadas, como estratégia de manejo de controle de B. cinerea da videira Cabernet Sauvignon cultivada em regiões de elevada altitude de Santa Catarina.<hr/>ABSTRACT Botrytis cinerea is one of the most important pathogens in the highlands of Santa Catarina State. This study aimed to evaluate the influence of different times of leaf removal on the progress of B. cinerea rot in Cabernet Sauvignon grapevine. Assays were conducted in the 2014/2015 and 2015/2016 growing seasons in a commercial vineyard located at 1230m (a.s.l.) in São Joaquim Municipality, Santa Catarina State (28º 17’ 39” S and 49º 55’ 56” W). The variety Cabernet Sauvignon was grafted on Paulsen 1103 rootstock, conducted in vertical shooting positioning, 3.0m x 1.5m spacing, and covered with hail protection net. Treatments consisted in leaf removal at the phenological stages: full bloom, buckshot berries, pea-sized berries, veraison, 15 days after veraison and plants not subjected to leaf removal. The disease was biweekly measured in bunches from the first symptoms to harvest. Disease progress curves were elaborated and compared according to: beginning of symptoms, time to maximum disease incidence and severity, maximum disease incidence and severity, and area under the disease incidence and severity progress curve. Results evidenced that early leaf removal should be recommended as management strategy to control B. cinerea in Cabernet Sauvignon grapevine grown in the highlands of Santa Catarina. <![CDATA[Morphogenetic characterization and resistance reaction of mandarin orange genotypes to <em>Alternaria alternata</em> f. sp. <em>citri</em>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200118&lng=en&nrm=iso&tlng=en RESUMO Este trabalho teve como objetivo a caracterização morfogenética de dez isolados de Alternaria alternata f. sp. citri coletados no estado da Paraíba e avaliar a reação de cinco genótipos de tangerineira inoculados com A. alternata f. sp. citri. O experimento foi realizado na Universidade Federal da Paraíba. Dez isolados de A. alternata foram avaliados quanto à produção de conídios, índice de velocidade de crescimento micelial e crescimento micelial final. As inoculações de A. alternata foram em folhas destacadas e em mudas de tangerineiras de cinco genótipos, Tangelo Robinson’, Tangerina ‘Clementina’, Tangerina ‘Nova’, Tangerina ‘Lee’ e Tangerina ‘Swatow’ e em frutos de tangerineira cv. “Dancy”. Na inoculação das mudas foi utilizado o isolado 7, de Lagoa seca-PB que apresentou as melhores características morfológicas. As avaliações foram realizadas 48h após a inoculação do patógeno, utilizando uma escala de notas. Os isolados 2 e 7 apresentaram maior velocidade de crescimento micelial e os isolados 6 e 7 causaram maior severidade da doença em frutos de cv. ‘Dancy’. Sete grupos divergentes de A. alternaria f. sp. citri foram obtidos pelo marcador ISSR. Os genótipos ‘Tangelo Robinson’, Tangerina ‘Swatow’ e Tangerina ‘Nova’ apresentaram maior resistência a Mancha Marrom de Alternaria nas condições desse trabalho.<hr/>ABSTRACT This study aimed to obtain morphogenetic characterization of ten isolates of Alternaria alternata f. sp. citri collected in the state of Paraíba and to evaluate the reaction of five mandarin orange genotypes inoculated with A. alternata f. sp. citri. The experiment was carried out at Federal University of Paraíba. Ten isolates of A. alternata were evaluated for conidial production, mycelial growth rate and final mycelial growth. A. alternata inoculations were done in detached leaves and seedlings of five mandarin orange genotypes, ‘Tangelo Robinson’, ‘Clementina’ Tangerine, ‘Nova’ Tangerine, ‘Lee’ Tangerine and ‘Swatow’ Tangerine, as well as in fruits of tangerine tree cv. ‘Dancy’. In the inoculation of seedlings, isolate 7 was used, which was from Lagoa Seca-PB and presented the best morphological characteristics. Evaluations were performed at 48h after the pathogen inoculation and used a scale of grades. Isolates 2 and 7 presented higher mycelial growth rate and isolates 6 and 7 caused greater disease severity in fruits of cv. ‘Dancy’. Seven divergent groups of A. alternaria f. sp. citri were obtained by the ISSR marker. Genotypes ‘Tangelo Robinson’, ‘Swatow’ Tangerine and ‘Nova’ Tangerine presented greater resistance to Alternaria brown spot under the conditions of the present study. <![CDATA[Incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo – Brasil]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200124&lng=en&nrm=iso&tlng=en RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.<hr/>ABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil. <![CDATA[Temperatures and leaf wetness duration on orange rust development in sugarcane ( <em>Puccinia kuehnii</em>)]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200132&lng=en&nrm=iso&tlng=en RESUMO Devido à escassez de estudos epidemiológicos da ferrugem alaranjada da cana-de-açúcar no Brasil e a importância dessa cultura no agronegócio brasileiro, objetivou-se neste trabalho determinar a influência da temperatura e do período de molhamento foliar na epidemiologia dessa doença. Foram utilizadas plantas da cultivar SP89-1115 com vinte dias de idade inoculadas com o fungo Puccinia kuehnii na concentração de 2 x104 de uredósporos/mL. O delineamento experimental utilizado foi inteiramente casualizado (DIC) em esquema fatorial 5x7 sendo cinco temperaturas (17,5 ; 20,0 ; 22,5 ; 25,0 e 27,5°C) e sete períodos de molhamento foliar (0 ; 4; 8; 12; 16; 20 e 24 horas), com três repetições. As melhores temperaturas para o desenvolvimento da ferrugem alaranjada foram 20,0; 22,5 e 25,0°C sendo esta última a melhor. Nas temperaturas de 22,5 e 25,0°C com 20 horas de molhamento foliar foram observadas que as pústulas apresentaram-se em maior número decrescendo com 24 horas de molhamento. Não foi observado sintomas da doença nos períodos de molhamentos foliares de 0, 4 e 8 horas em todas as temperaturas testadas. Também não ocorreu a doença na temperatura de 27,5°C em todas as combinações dos períodos de molhamentos foliares testados. Estudos de epidemiologia dessa doença são importantes para traçar estratégias de controle e futuramente desenvolver um sistema de previsão para a ferrugem alaranjada da cana-de-açúcar.<hr/>ABSTRACT Considering the lack of epidemiological studies on orange rust of sugarcane in Brazil and the importance of this crop in the Brazilian agribusiness, the aims of this study were to determine the influence of temperature and leaf wetness duration on the epidemiology of this disease. Twenty-day-old plants of the cultivar SP 89-1115 were inoculated with the fungus Puccinia kuehnii at a concentration of 2 x 104 urediniospores.mL. Experimental design was completely randomized (DIC), in 5x7 factorial arrangement, representing five temperatures (17.5, 20.0, 22.5, 25.0 and 27.5°C) and seven leaf wetness periods (0, 4, 8, 12, 16, 20 and 24 hours), including three replicates. Ideal temperatures for orange rust development were 20.0, 22.5 and 25.0°C, of which the latter was the best. At temperatures of 22.5 and 25.0°C, pustules increased in number with 20 hours leaf wetness but decreased with 24 hours wetness. No disease symptoms were observed at 0, 4 and 8 hours leaf wetness for all tested temperatures. Similarly, the disease did not occur at a temperature of 27.5°C for all tested combinations of leaf wetness duration. Epidemiological studies of this disease are important to devise control strategies and eventually develop a forecasting system for orange rust of sugarcane. <![CDATA[Chemical control of smut and seed honeydew in cultivars of <em>Brachiaria brizantha</em>]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200136&lng=en&nrm=iso&tlng=en RESUMO O Brasil é o maior produtor, consumidor e exportador mundial de sementes de espécies forrageiras tropicais. Contudo, a produção tem sido ameaçada pela presença de fungos e fitonematoides, os quais podem reduzir a produtividade e/ou a qualidade das sementes produzidas, além de constituírem barreiras sanitárias para vários países importadores dessas sementes. Em Brachiaria spp., as principais doenças são a mela-das-sementes e o carvão, causadas, respectivamente, pelos fungos Claviceps maximensis e Ustilago operta. Apesar da grande demanda pelo setor produtivo, poucos são os estudos relacionados a estratégias de controle das doenças. Assim, realizou-se este trabalho objetivando-se avaliar a eficiência de fungicidas no controle das referidas doenças. Implantaram-se quatro experimentos, sendo dois na Embrapa Gado de Corte, em Campo Grande-MS, e dois em Paraíso das Águas-MS. Foram utilizadas as cultivares BRS Piatã e Xaraés, ambas pertencentes à Brachiaria brizantha. Foram avaliados os efeitos de vários fungicidas (g ia/ha), os quais foram aplicados em três épocas para Campo Grande: plantas com 10% de antese, 20 e 40 dias após a primeira aplicação. Em Paraíso das Águas, os fungicidas foram aplicados uma única vez, nas plantas com 10% de antese. Na cultivar BRS Piatã, para Campo Grande, os melhores resultados obtidos para o controle da mela-das-sementes foram com os tratamentos T7 (trifloxistrobina + ciproconazole (150,0 + 64,0)) e T11 (primeira aplicação: piraclostrobina (97,5) + epoxiconazole (60,0), segunda aplicação: tebuconazole (120,0), terceira aplicação: piraclostrobina (97,5) + epoxiconazole (60,0)). Na cultivar Xaraés, a doença foi menos expressiva nos tratamentos T4 (piraclostrobina (175,0)), T6 (azoxistrobina + ciproconazole (80,0 + 32,0)), T9 (primeira aplicação: piraclostrobina (175,0); segunda e terceira aplicações: piraclostrobina + epoxiconazole (99,75 + 37,5)) e T11 (primeira aplicação: piraclostrobina (97,5) + epoxiconazole (60,0), segunda aplicação: tebuconazole (120,0), terceira aplicação: piraclostrobina + epoxiconazole (97,5 + 60,0)). Não houve ocorrência de carvão para ambas as cultivares em Campo Grande. Para BRS Piatã, no experimento de Paraíso das Águas-MS, apesar da intensidade de mela-das-sementes e de carvão não terem sido expressivas, no tratamento T4 (piraclostrobina (175,0) a produtividade de sementes puras foi 69,6% maior que a testemunha, produzindo 456,78 kg/ha, demonstrando alta relação benefício/custo com o referido tratamento. Tal resultado em T4 pode ter sido expressão de efeitos fisiológicos proporcionados pela piraclostrobina. A aplicação de fungicidas na parte aérea das plantas de BRS Xaraés de Brachiaria brizantha em Campo Grande, onde houve alta incidência dos fungos Alternaria spp., Bipolaris spp., Curvularia spp., Fusarium spp. e Phoma spp. nas sementes, revelou o efeito benéfico do tratamento, sobretudo do T7 (trifloxistrobina + ciproconazole (150,0 + 64,0)), o qual reduziu significativamente a ocorrência de Bipolaris spp., Fusarium spp. e Phoma spp. Em Paraíso das Águas, onde a incidência dos referidos patógenos foi menor, os resultados não foram conclusivos.<hr/>ABSTRACT Brazil is the world’s largest producer, consumer and exporter of seeds of tropical forage species. However, production has been threatened by the presence of fungi and phytonematodes, which may reduce the productivity and / or the quality of produced seeds, besides constituting sanitary barriers for several countries that import these seeds. Considering Brachiaria spp., the main diseases are honeydew and smut in the seeds, caused by the fungi Claviceps maximensis and Ustilago operta, respectively. Despite the great demand by the productive sector, there are few studies related to control strategies for these diseases. Thus, this study was carried out with the aim of evaluating fungicide efficiency in the control of these diseases. Four experiments were implemented, two of them in Embrapa Gado de Corte, in Campo Grande-MS, and two in Paraíso das Águas-MS. The cultivars BRS Piatã and Xaraés, both belonging to Brachiaria brizantha, were used. The effects of several fungicides (g ai / ha) were evaluated; they were applied in three periods for Campo Grande: plants with 10% anthesis, 20 and 40 days after the first application. In Paraíso das Águas, fungicides were applied only once, in plants with 10% anthesis. For the cultivar BRS Piatã, in Campo Grande, the best results for honeydew control were obtained with treatments T7 (trifloxystrobin + cyproconazole (150.0 + 64.0)) and T11 (first application: pyraclostrobin (97.5) + epoxiconazole (60.0), second application: tebuconazole (120.0), third application: pyraclostrobin (97.5) + epoxiconazole (60.0)). For the cultivar BRS Xaraés, the disease was less expressive with treatments T4 (pyraclostrobin (175.0)), T6 (azoxystrobin + cyproconazole (80.0 + 32.0)), T9 (first application: pyraclostrobin (175.0), second and third application: pyraclostrobin + epoxiconazole (99.75 + 37.5)) and T11 (first application: pyraclostrobin (97.5) + epoxiconazole (60.0), second application: tebuconazole (120.0), third application: pyraclostrobin + epoxiconazole (97.5 + 60.0)). There was no occurrence of smut for both cultivars in Campo Grande. For BRS Piatã, in the experiment at Paraíso das Águas-MS, although the intensity of honeydew and smut was not significant, with treatment T4 (pyraclostrobin (175.0)), the yield of pure seeds was 69.6% higher than that of control, producing 456.78 kg/ha, which demonstrates a high benefit/cost ratio using this treatment. This result with T4 may have been the expression of physiological effects caused by pyraclostrobin. Fungicide application on the aerial part of Brachiaria brizantha plants cv BRS Xaraés in Campo Grande, where there was high incidence of the fungi Alternaria spp., Bipolaris spp., Curvularia spp., Fusarium spp. and Phoma spp. in the seeds, showed the beneficial effect of the treatment, especially T7 (trifloxystrobin + cyproconazole (150.0 + 64.0)), which significantly reduced the occurrence of Bipolaris spp., Fusarium spp. and Phoma spp. In Paraíso das Águas, where the incidence of these pathogens was lower, results were not conclusive. <![CDATA[Impact of white mold control by fluazinam on soybean yield in the south of Paraná: Meta-analysis]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200145&lng=en&nrm=iso&tlng=en RESUMO O controle químico de Sclerotinia sclerotiorum pode prevenir infecção, e reduzir a incidência e severidade da doença. Analisar resultados de ensaios individuais nem sempre fornecem conclusões confiáveis. Com isso, técnicas estatísticas como a metanálise, pouco utilizada na fitopatologia, podem ser úteis. Basicamente a técnica sumariza quantitativamente resultados de diversos estudos os ponderando de acordo com sua variabilidade. Assim, foram analisados trabalhos publicados e relatórios técnicos fornecidos por entidades de pesquisa, contendo o tratamento químico com o ingrediente ativo fluazinam usado no controle de S. sclerotiorum e seu efeito na produtividade da soja. Foram analisados 18 experimentos, totalizando 50 entradas de dados. A variável utilizada para o modelo de efeitos aleatórios foi obtida pela diferença entre o tratamento com o fungicida e a testemunha (sem aplicação). A estimativa metanalítica indicou acréscimo de 413,9 kg.ha-1 com amplitude de 344,6 a 483,1 kg.ha-1. A probabilidade de haver qualquer acréscimo de produtividade foi de 89,1%, sendo que para 120, 300, 600, 900 e 1.200 Kg.ha-1 as chances foram 82,8; 69,6; 41,7; 17,6 e 4,9%, respectivamente. Considerando-se R$50,00 o preço da saca 60 kg e R$ 170,00.ha-1 o custo do fungicida, estimou-se em 77,1% a probabilidade de retorno econômico. Concluiu-se que a aplicação de fluazinam contribuiu para o aumento de produtividade de soja atacada por S.scleotiorum.<hr/>ABSTRACT Chemical control of Sclerotinia sclerotiorum can prevent infection and reduce the disease incidence and severity. Assessment of individual assay results may not provide reliable conclusions. Statistical techniques like meta-analysis, rarely adopted in phytopathology, may be useful. Basically, the technique quantitatively summarizes the results of several studies, weighting them according to their variability. Thus, published studies and technical reports provided by research entities were analyzed; they contained chemical treatment with the active ingredient fluazinam used in S. sclerotiorum control and its effect on soybean yield. Eighteen experiments were analyzed, totaling 50 data entries. The variable used for the random effects model was obtained based on the difference between the fungicide treatment and the control (without application). Meta-analytic estimate indicated an increase of 413.9 kg.ha-1 and range from 344.6 to 483.1 kg.ha-1. Probability of any increase in yield was 89.1%, and for 120, 300, 600, 900 and 1,200 Kg.ha-1 chances were 82.8, 69.6, 41.7, 17.6 and 4.9%, respectively. Considering R$ 50.00 is the cost of a 60kg bag and R$ 170.00.ha-1 is the fungicide cost, the probability of financial return was estimated at 77.1%. Fluazinam application contributed to increase the yield of soybean attacked by S. sclerotiorum. <![CDATA[Temporal progress of rust in different genotypes of peach]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200151&lng=en&nrm=iso&tlng=en RESUMO A ferrugem do pessegueiro causada por Tranzschelia discolor é uma das doenças que comprometem a área foliar da cultura durante todo o período vegetativo, causando prejuízos à produção e a qualidade dos frutos. Considerando que o progresso temporal desta doença é pouco conhecido, esse trabalho teve como objetivo avaliar o progresso da doença ao longo do ciclo produtivo entre diferentes genótipos. O experimento foi realizado em pomar de pessegueiro do Instituto Federal Catarinense (IFC) Campus Rio do Sul. Foram avaliados os genótipos Granada, Dourado 1, Dourado 2, Douradão, Ouro, Chimarrita, Flordaprince, Premier, Aurora e Della Nona. Selecionaram-se quatro plantas de cada genótipo e avaliou-se a severidade da doença semanalmente, após o inicio da brotação, em 16 folhas de cada planta com auxilio de uma escala diagramática. A curva de progresso da doença para cada um dos genótipos foi ajustada a um modelo logístico, já que a severidade observada correspondeu ao modelo e foi confirmada pela coerência entre os pontos estimados e pelo resíduo. Foi verificado que o genótipo Dourado1 apresentou a maior taxa da doença (0,645), enquanto Aurora, a menor (0,330). Verificou-se que o genótipo Douradão apresentou o pico máximo da doença com 2,4% de severidade e que Chimarita e Dourado 1 tiveram o menor acúmulo da doença com 0,5%. Os genótipos apresentaram diferentes comportamentos de progresso da ferrugem do pessegueiro.<hr/>ABSTRACT Peach rust caused by Tranzschelia discolor is one of the diseases that affect the crop leaf area throughout the growing season, causing damage to production and fruit quality. Considering that the temporal progress of this disease is little known, this study aimed to evaluate the disease progress throughout the productive cycle among different genotypes. The experiment was carried out in a peach orchard at “Instituto Federal Catarinense-IFC”/Rio do Sul Campus. Evaluated genotypes were Granada, Dourado 1, Dourado 2, Douradão, Ouro, Chimarrita, Flordaprince, Premier, Aurora and Della Nona. Four plants from each genotype were selected and the disease severity was weekly evaluated, using a diagrammatic scale, after the start of sprouting in sixteen leaves from each plant. The disease progress curve for each genotype was adjusted to a logistic model, since the observed severity corresponded to the model and was confirmed by the consistency between the estimated points and by the residue. Dourado 1 genotype showed the highest disease rate (0.645) while Aurora showed the lowest rate (0.330). Douradão genotype showed the highest disease peak with 2.4% severity, and Chimarita and Dourado 1 had the lowest disease accumulation, 0.5%. Genotypes showed different peach rust progress behavior. <![CDATA[Evaluating the efficiency of extracts from plants native to caatinga on dry rot (<em>Lasiodiplodia theobromae</em>) control in bunches of grape cv. Itália]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200155&lng=en&nrm=iso&tlng=en RESUMO Com a realização deste trabalho objetivou-se verificar o controle de L. theobromae através da utilização de extratos vegetais. Inicialmente, foi avaliada a inibição do crescimento micelial de L. theobromae em placas de Petri contendo o meio BDA suplementado com os extratos de Boldo Baiano, Jurema Preta, Pata de Vaca e Pau-ferro, nas concentrações 10, 20 e 30%, para todos os extratos. Posteriormente, foram realizados dois experimentos in vivo com o objetivo de avaliar o efeito direto e protetor dos extratos vegetais testados in vitro sobre a intensidade da podridão seca em cachos da videira cv. Itália, utilizando-se a concentração de 30%, sendo a água destilada esterilizada (ADE) utilizada como testemunha. Os resultados mostraram que extratos de Pau-ferro, Pata de vaca, Jurema preta e Boldo baiano com concentrações de 30% inibiram o crescimento micelial em 85,6; 83,3; 85,6 e 88,9%, respectivamente, contudo, os extratos testados não foram eficientes para inibir a incidência e a severidade da doença.<hr/>ABSTRACT This study aimed to verify L. theobromae control by using plant extracts. Initially, L. theobromae mycelial growth inhibition was evaluated on Petri dishes containing PDA medium supplemented with extracts of “boldo baiano”, “jurema preta”, “pata-de-vaca” and “pau-ferro” at the concentrations of 10, 20 and 30% for all extracts. Afterwards, two in vivo experiments were carried out to evaluate the direct and protective effect of the plant extracts tested in vitro on dry rot intensity in bunches of grape cv. Itália, using the concentration of 30%, while sterile distilled water (ADE) was adopted as control. Results showed that extracts of “pau-ferro”, “pata-de-vaca”, “jurema preta” and “boldo baiano” at concentrations of 30% inhibited mycelial growth by 85.6, 83.3, 85.6 and 88.9%, respectively; however, the tested extracts were not efficient in inhibiting the disease incidence and severity. <![CDATA[Extracts of Brazilian peppertree, angico, amburana and “quebra-faca” on <em>Lasiodiplodia theobromae</em> control in bunches of grape cv. Itália]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200158&lng=en&nrm=iso&tlng=en RESUMO O objetivo deste estudo foi avaliar o efeito dos extratos vegetais sobre L. theobromae pela utilização de produtos como método alternativo. Foi analisado o crescimento micelial de L. theobromae em placas de Petri contendo o meio BDA suplementado com os extratos de Aroeira, Angico, Umburana e Quebra-faca nas concentrações de 10, 20 e 30%. Para avaliação do efeito direto dos extratos sobre o desenvolvimento de L. theobromae, cachos da cv Itália foram inoculados com o patógeno e, após 4 h, pulverizados com os diferentes extratos: Angico e Umburana (30%) e Quebra-faca (10%). Água destilada esterilizada (ADE) foi utilizada como testemunha. Posteriormente, para avaliar o potencial dos extratos como indutores de resistência, cachos da cv Itália foram submetidas aos mesmos tratamentos e, inoculados após 4 horas com L. theobromae. Os resultados mostraram que os extratos de Angico e Umburana nas concentrações de 30%, inibiram o crescimento micelial in vitro em 61,66 e 60% respectivamente, contudo os extratos testados não foram eficientes em inibir a incidência e a severidade da doença.<hr/>ABSTRACT The aim of this study was to evaluate the effect of plant extracts on L. theobromae by using products as an alternative method. Mycelial growth of L. theobromae was analyzed on Petri dishes containing PDA medium supplemented with extracts of Brazilian peppertree, angico, amburana and “quebra-faca” at the concentrations of 10, 20 and 30%. To evaluate the direct effect of extracts on the development of L. theobromae, bunches of grape cv Itália were inoculated with the pathogen and, after 4 h, sprayed with the different extracts: angico and amburana (30%) and “quebra-faca” (10%). Sterile distilled water (ADE) was used as control. Subsequently, to evaluate the potential of extracts as resistance inducers, bunches of grape cv Itália were subjected to the same treatments and inoculated, after 4 hours, with L. theobromae. Results showed that extracts of angico and amburana at the concentration of 30% inhibited in vitro mycelial growth by 61.66 and 60%, respectively; however, the tested extracts were not efficient in inhibiting the disease incidence and severity. <![CDATA[Sobrevivência e viabilidade de escleródios de <em>Sclerotium cepivorum</em> no solo]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200161&lng=en&nrm=iso&tlng=en RESUMO Em experimento de campo quantificou-se a sobrevivência e a viabilidade de escleródios de Sclerotium cepivorum no solo. Cem escleródios multiplicados em meio de cultura BDA foram colocados em saquinhos feito de tecido. Em armação de madeira contendo solo, colocaram-se 12 repetições respectivamente na superfície e enterrados a 10 centímetros. Mensalmente os saquinhos foram retirados de cada posição, lavados em água corrente e submetidos à compressão com agulha histológica para constatar-se os mesmos mantinham-se intactos. Os escleródios intactos foram submetidos à assepsia com álcool 70% durante um minuto, hipoclorito de sódio 1,25% por três minutos e em água estéril para lavagem, em seguida depositado em placas contendo meio BDA e acondicionado em câmara de crescimento a 20ºC sem luz. Durante os dias de incubação realizava-se a contagem dos escleródios germinados, até o sétimo dia. Os escleródios coletados na superfície perderam sua viabilidade após três meses e os enterrados permaneceram viáveis até sétimo mês. Os escleródios de S. cepivorum na superfície tendem a perderem sua viabilidade num período de tempo menor que os enterrados<hr/>ABSTRACT In a field experiment, the survival and viability of sclerotia from Sclerotium cepivorum in the soil was quantified. One hundred sclerotia were multiplied on PDA culture medium and stored in fabric bags. In a wooden frame containing soil, 12 replicates were placed respectively on the surface and buried at 10 cm depth. Every month, bags were removed from each position, washed in water and subject to compression with a histological needle to verify whether they were intact. Intact sclerotia were sterilized with 70% ethanol for one minute, 1.25% sodium hypochlorite for three minutes and sterile water for washing; then, they were deposited on plates containing PDA culture medium and placed in a growth chamber at 20° C without light. During incubation, germinated sclerotia were counted until the seventh day. Sclerotia collected from the surface lost their viability after three months, while buried ones remained viable until the seventh month. S. cepivorum sclerotia on the soil surface tend to lose their viability in a shorter period than buried sclerotia. <![CDATA[Influência da temperatura e do fotoperíodo na germinação <em>in vitro</em> de escleródios de <em>Sclerotium cepivorum</em>, agente causal da podridão branca do alho e da cebola]]> http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-54052017000200164&lng=en&nrm=iso&tlng=en RESUMO Em experimento de campo quantificou-se a sobrevivência e a viabilidade de escleródios de Sclerotium cepivorum no solo. Cem escleródios multiplicados em meio de cultura BDA foram colocados em saquinhos feito de tecido. Em armação de madeira contendo solo, colocaram-se 12 repetições respectivamente na superfície e enterrados a 10 centímetros. Mensalmente os saquinhos foram retirados de cada posição, lavados em água corrente e submetidos à compressão com agulha histológica para constatar-se os mesmos mantinham-se intactos. Os escleródios intactos foram submetidos à assepsia com álcool 70% durante um minuto, hipoclorito de sódio 1,25% por três minutos e em água estéril para lavagem, em seguida depositado em placas contendo meio BDA e acondicionado em câmara de crescimento a 20ºC sem luz. Durante os dias de incubação realizava-se a contagem dos escleródios germinados, até o sétimo dia. Os escleródios coletados na superfície perderam sua viabilidade após três meses e os enterrados permaneceram viáveis até sétimo mês. Os escleródios de S. cepivorum na superfície tendem a perderem sua viabilidade num período de tempo menor que os enterrados<hr/>ABSTRACT In a field experiment, the survival and viability of sclerotia from Sclerotium cepivorum in the soil was quantified. One hundred sclerotia were multiplied on PDA culture medium and stored in fabric bags. In a wooden frame containing soil, 12 replicates were placed respectively on the surface and buried at 10 cm depth. Every month, bags were removed from each position, washed in water and subject to compression with a histological needle to verify whether they were intact. Intact sclerotia were sterilized with 70% ethanol for one minute, 1.25% sodium hypochlorite for three minutes and sterile water for washing; then, they were deposited on plates containing PDA culture medium and placed in a growth chamber at 20° C without light. During incubation, germinated sclerotia were counted until the seventh day. Sclerotia collected from the surface lost their viability after three months, while buried ones remained viable until the seventh month. S. cepivorum sclerotia on the soil surface tend to lose their viability in a shorter period than buried sclerotia.