First report of Diaporthe phaseolorum var. caulivora infecting soybean plants in Brazil

Primeiro relato de Diaporthe phaseolorum var. caulivora infectando plantas de soja no Brasil

SHORT COMMUNICATION COMUNICAÇÃO

First report of Diaporthe phaseolorum var. caulivora infecting soybean plants in Brazil

Primeiro relato de Diaporthe phaseolorum var. caulivora infectando plantas de soja no Brasil

Leila M. Costamilan^I; José T. Yorinori^II; Álvaro M.R. Almeida^III; Claudine D.S. Seixas^III; Eliseu Binneck^III; Marcelo R. Araújo^III; Jairo A. Carbonari^IV

^IEmbrapa Trigo, 99001-970, Passo Fundo, RS, Brazil

^IITropical Melhoramento e Genética Ltda, Cambé, PR, Brazil

^IIIEmbrapa Soja, 86001-970, Londrina, PR, Brazil

^IVMinistério da Agricultura, Pecuária e Abastecimento, 90010-420, Porto Alegre, RS, Brazil

ABSTRACT

In March 2006, diseased soybean plants (Glycine max) were found in the municipalities of Passo Fundo and Coxilha, state of Rio Grande do Sul, Brazil, showing withered, brown leaves and light to reddish-brown discoloration and necrosis (canker) of the lower half of the stem. Cultural characteristics in potato dextrose agar showed identical patterns to those described for Diaporthe phaseolorum varcaulivora (Dpc). The rDNA-ITS sequence data from the Brazilian strain CH 40/06 (GenBank accession number EU622854) were compared to homologous sequences from the NCBI GenBank database, and a high similarity with Dpc strains was verified. A phylogenetic reconstruction was performed to compare EU622854 with other related sequences and grouped with Dpc. This group was highly supported by the bootstrap test (99%). Morphology of the Brazilian specimen was also similar to that described in the literature for Dpc, but the ascospores were slightly narrower than the American original material of Dpc. In field surveys performed in the 2006/07 crop season, Dpc was also found in five additional municipalities in RS.

Keywords: stem canker, Phomopsis phaseoli f.sp. caulivora, Glycine max.

RESUMO

Em março de 2006, plantas de soja (Glycine max) doentes foram encontradas em Passo Fundo e em Coxilha, Rio Grande do Sul, Brasil. O quadro sintomatológico caracterizava-se por plantas com folhas secas e de coloração marrom; necrose (cancro) na metade inferior da haste, de coloração marrom-clara a marrom-avermelhada, envolvendo a mesma, seguindo-se murcha e morte da planta. Características culturais em batata dextrose ágar mostraram padrões idênticos àqueles publicados para Diaporthe phaseolorum varcaulivora (Dpc). Os dados de seqüenciamento de DNA do isolado brasileiro CH 40/06 (número de acesso GenBank EU622854) foram comparados às seqüências homólogas de NCBI GenBank, e alta similaridade foi verificada com outros isolados de Dpc. Árvore filogenética foi elaborada a fim de comparar EU622854 com outras seqüências de Dpc, cujo agrupamento foi altamente confirmado pelo teste bootstrap (99%). Características morfológicas foram similares às descritas para Dpc na literatura, embora os ascosporos do espécime brasileiro fossem mais estreitos que o original americanoNa safra 2006/07, Dpc foi também encontrado em outros cinco municípios do RS.

Palavras-chave: cancro da haste, Phomopsis phaseoli f.sp. caulivora, Glycine max.

Soybean (Glycine max) is affected worldwide by the Diaporthe/Phomopsis complex, which is composed of three varieties of Diaporthe phaseolorum, anamorph Phomopsis phaseoli: D. phaseolorum varmeridionalis F.A. Fernández, and D. phaseolorum varcaulivora Athow and Caldwell, both causal agents of soybean stem canker, and D. phaseolorum varsojae (Lehman) Wehm, causal agent of pod and stem blight; and by Phomopsis longicolla Hobbs (teleomorph unknown), primary agent of seed decay (Pioli et al., 2003).

Soybean stem canker, caused by D. phaseolorum varmeridionalis (Dpm) was found for the first time in Brazil in 1989 and, in the next crop season, it was observed in almost all the Brazilian soybean-producing areas, leading to yield losses approaching 100% in some fields (Yorinori et al., 1989; Yorinori, 1996). The use of resistant soybean cultivars, released seven to eight years after the first detection of the disease, led to an effective control of this disease in Brazil. Nowadays, every soybean cultivar has to be tested for resistance to soybean canker caused by Dpm in order to be registered and released for cultivation by the Serviço Nacional de Proteção de Cultivares (National Service to Protect Cultivars), a government agency within the Brazilian Ministry for Agriculture, Livestock and Food Supply - MAPA.

In 1999, Diaporthe phaseolorum varcaulivora (Dpc) was found for the first time in South America occurring in the main soybean-producing region of Argentina (Pioli et al., 2001). More recently (March 2006) diseased soybean plants with symptoms of stem canker were found in Passo Fundo and Coxilha municipalities, state of Rio Grande do Sul (RS), Brazil, in cultivars previously known as resistant to Dpm canker. The symptoms were withered brown leaves associated with light to reddish-brown discoloration and necrosis (canker) of the lower half of the stem, especially around the nodes (Figures 1-3).

Portions of the discolored cortical stem tissue were plated in potato dextrose agar (PDA) amended with streptomicine sulphate, and a Phomopsis-like white-grey to brownish colony developed. A strain isolated from cultivar BRS 154 from Passo Fundo RS was deposited in the Coleção Micológica de Referência (Mycological Reference Collection) at the University of Brasília, accession number UB 20868 (CH 40/06 Embrapa Soy culture collection), and chosen for further molecular, pathogenic and morphological studies.

For DNA extraction, a pellet containing mycelium obtained by single-ascospore culturing in PDA was crushed on liquid nitrogen and treated with CTAB extraction buffer (50mM Tris-HCl, pH 8.0, 100 mM NaCl, 10 mM EDTA, 2% hexadecyltrimethyl-ammonium bromide-CTAB), followed by phenol/chloroform purification, precipitated with ethanol and stored at -80ºC (Almeida et al., 2003). DNA concentration was determined through spectrophotometer analysis and the DNA sample was stored at -20ºC. The nuclear rDNA region, including internal transcribed spacer 1 (ITS-1), 5.8S rRNA gene, and internal transcribed spacer 2 (ITS-2), was amplified with the primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990) in an Eppendorf Mastercycler gradient thermocycler. Amplification reactions were performed in 50 µL-volumes containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl₂, 200 µM each deoxynucleoside triphosphate, 0.5 µM each primer (ITS5 and ITS4), 10 ng of genomic DNA and 2.5 U Taq DNA polymerase. Temperature and time parameters for PCR amplification were 94ºC for 3 min for the first cycle and 1 min for the remaining cycles, 55ºC for 1 min, and 72ºC for 2 min for 35 cycles, followed by a final extension at 72ºC for 7 min. Amplified products were analyzed by electrophoresis in 1.3% agarose gel and visualized after staining with ethidium bromideIt was observed that the band patterns were identical to those produced by Dpc isolates.

The band produced by CH 40/06 was excised from the gel and the amplicon was purified using the PureLink^TM Quick Gel Extraction Kit (Invitrogen^®). Sequencing was performed by the chain-termination method using the ABI Big Dye Terminator Cycle sequencing kit v2.0 (Applied Biosystems^®) on an ABI PRISM model 3100 DNA sequencer. The DNA sequence data of ITS-1, 5.8S ribosomal RNA gene, and ITS-2, from the strain CH 40/06 were deposited in GenBank (accession number EU622854). The sequence EU622854 was compared to homologous sequences from the NCBI GenBank database using BLAST (Altschul et al., 1997), and a high similarity (99-100%) was verified with Dpc strains.

A phylogram was constructed in order to compare the ITS sequences of CH 40/06 strain with other homologous sequences from NCBI GenBank database (Fig. 4). A multiple sequence alignment was performed using Clustal W (Thompson et al., 1994) and a neighbor-joining phylogenetic tree was constructed from Kimura 2-parameter pairwise distances using MEGA 4 (Tamura et al., 2007). The consistency of phylogenetic resolution was supported by a bootstrap analysis using 1,000 replicates. Indels and gaps were treated as missing data.

Biometric characteristics were measured for the strain CH 40/06, cultivated in PDA medium at 25ºC, in the dark. The colony growth was fast (90 mm diameter in five days), and semi-immersed black stromata (1.0-3.0 mm diameter) developed around 20 days later. Black, globose perithecia arranged in caespitose groups were formed after 40 days in stromata and were 210-320 x 290-410 µm at the base. Perithecial beaks were 280-320 µm long, 80-110 µm wide at the base and 50-60 µm wide at the apice (Fig. 5). The eight-spored asci (5-6 x 32-40 µm) were elongated clavate with thin, evanescent walls. Ascospores (2-2.5 x 8-10 µm) were hyaline, ellipsoidal, two-celled, biguttulate at each cell (Fig. 6). The morphology of the Brazilian strain was equivalent to that reported by Athow & Caldwell (1954) for Dpc, with a slight difference in ascospore width, which is narrower in the Brazilian material. This difference was also reported by Pioli et al.(2001) for the Argentinian strain of Dpc (ascospores: 2.5-2.7 x 7.7-8.9 µm).

In Petri dishes, strain CH 40/06 was paired on PDA with a strain for Dpm, CH8 (GenBank accession number FJ357154), which has been used since 1989 by Embrapa Soy as the reference strain for testing soybean genotypes for resistance to stem canker. After five days, barrage reactions were evident as black lines along the zone of mycelial contact between expanding colonies (vegetative incompatibility reaction, according to Smit et al., 1997), but not between the two CH 40/06 colonies (Fig. 7).

Pathogenicity tests were performed in greenhouse conditions (temperatures around 25ºC) using the toothpick method described by Yorinori (1996), in soybean plants at V1 growth stage (completely unrolled leaf at the unifoliolate node, according to Fehr et al., 1971), with isolates CH8 and CH 40/06 and the soybean cultivars BR 23 (susceptible to Dpm) and BRS 154 (original source of the CH 40/06). Fifteen days later, it was observed that CH 40/06 did not cause disease symptoms in cvBR 23, but it caused internal stem discoloration without leading to plant death of cv. BRS 154. Plant death was observed when BR 23 was inoculated with Dpm, but no symptoms resulted from inoculation of BRS 154, leading to the conclusion that CH 40/06 was different from Dpm. Dpc was reisolated on PDA from BRS 154 stem portions.

In this study, the combination of molecular tests and cultural aspects showed that isolate CH 40/06 clearly belongs to Dpc. According to Pioli et al.(2002), clustered perithecia, smaller asci and ascospores, and the development of fluffy mycelia with age are the main morphological characteristics that distinguish Dpc from Dpm. Nevertheless, molecular techniques allow for a more precise identification. Since the 1990's, molecular techniques have been used as a tool for identification and characterization of D. phaseolorum strains, additionally to morphologic characteristics and pathogenicity and vegetative compatibility tests (Fernández & Hanlin, 1996; Zhang et al., 1997; 1998; Pioli et al., 2001; 2002; 2003; Vechiato et al., 2003).

Some of the previous works on D. phaseolorum (Fernández & Hanlin, 1996; Pioli et al., 2001; 2003), have recorded asci and ascospore dimensions that were somewhat different from those given in Athow and Caldwell (1954)The same was observed for the Brazilian isolate (CH 40/06), which otherwise had the combination of characteristics typical for Dpc. The biometric differences between ascospores of the Brazilian Dpc strain and the original Dpc, described by Athow and Caldwell in 1954, were also observed by Pioli et al.(2003) on Argentinian records of Dpc. It also suggests that the probable origin of the Brazilian isolate is soybean seed material brought from Argentina.

Field surveys, performed by officials of the Department of Agriculture - MAPA in Rio Grande do Sul during the 2006/2007 crop season, yielded soybean plants bearing stem cankers. The fungus involved in the disease was isolated and identified by the phylogenetics described herein. The results evidenced that Dpc was present in five additional municipalities of Rio Grande do Sul: Marau, Pontão, Quatro Irmãos, Lagoa Vermelha, and Ibirubá.

ACKNOWLEDGEMENTS

The authors thank Robert W. Barreto and José Luiz Bezerra for their comments and suggestions.

Received 5 May 2008

Accepted 30 October 2008

Author for correspondence: Leila M. Costamilan, e-mail: [e-mail]

TPP 7106

Associate Editor: Robert W. Barreto

• Almeida AMR, Abdelnoor RV, Arias CAA, Carvalho VP, Jacoud Filho DS, Marin SRR, Benato L, Pinto MC, Carvalho CGP (2003) Genotypic diversity among Brazilian isolates of Macrophomina phaseolina revealed by RAPD. Fitopatologia Brasileira 28:279-285.
• Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25:3389-3402.
• Athow AL, Caldwell RM (1954) A comparative study of Diaporthe stem canker and pod and stem blight of soybeans. Phytopathology 44:319-325.
• Fehr WR, Caviness CE, Burmood DT, Pennington JS (1971) Stage of development descriptions for soybens, Glycine max (L) Merrill. Crop Science. 11:929-931.
• Fernández FA, Hanlin RT (1996) Morphological and RAPD analysis of Diaporthe phaseolorum from soybean. Mycologia 88:425-440.
• Pioli RN, Morandi EN, Bisaro V (2001) First report of soybean stem canker caused by Diaporthe phaseolorum var. caulivora in Argentina. Plant Disease 85:95.
• Pioli RN, Morandi EN, Luque A, Gosparini CO (2002) Recent outbreak of soybean stem canker caused by Diaporthe phaseolorum var. caulivora in the main soybean producing region of Argentina. Plant Disease 86:1403.
• Pioli RN, Morandi EN, Martínez MC, Lucca F, Tozzini A, Bisaro V, Hopp HE (2003) Morphologic, molecular, and pathogenic characterization of Diaporthe phaseolorum variability in the core soybean-producing area of Argentina. Phytopathology 93:136-146.
• Smit WA, Wingfield BD, Wingfield MJ (1997) Vegetative incompatibility in Diaporthe ambigua Plant Pathology 46:366-372.
• Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599.
• Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680.
• Vechiato MH, Maringoni AC, Martins EMF, Kohara EY (2003) Caracterização de isolados de Diaporthe spp. e Diaporthe phaseolorum var. meridionalis Arquivos do Instituto Biológico 70:159-167.
• White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR Protocols: a guide to methods and applications. New York. Academic Press. pp. 315-322.
• Yorinori JT (1996) Cancro da haste da soja: epidemiologia e controle. Londrina PR. Embrapa Soja. Circular Técnica no. 14.
• Yorinori JT, Almeida AMR, Homechin M, Miranda LC, Kiihl RAS, Pola JN (1989) Epifitia do cancro da haste da soja nos municípios de Castro, Palmeira, Ponta Grossa e Tibagi no Paraná e Rondonópolis, no Mato Grosso, na safra de 1988/89. Resumos, 5. Seminário Nacional de Pesquisa de Soja, Campo Grande MS. Londrina PR. Embrapa Soja. pp. 22-23.
• Zhang AW, Hartman GL, Riccioni L, Chen WD, Ma RZ, Pedersen WL (1997) Using PCR to distinguish Diaporthe phaseolorum and Phomopsis longicolla from other soybean fungal pathogens and to detect them in soybean tissues. Plant Disease 81:1143-1149.
• Zhang AW, Riccioni L, Pedersen WL, Kollipara KP, Hartman GL (1998) Molecular identification and phylogenetic grouping of Diaporthe phaseolorum and Phomopsis longicolla isolates from soybean. Phytopathology 88:1306-1314.

Publication Dates

• Publication in this collection
  09 Jan 2009
• Date of issue
  Oct 2008

History

• Accepted
  30 Oct 2008
• Received
  05 May 2008