Colletotrichum spp. and other fungi associated with anthracnose on Coffea arabica L. in Mérida State, Venezuela

Colletotrichum spp., y otros hongos asociados con la antracnosis en Coffea arabica L. en el estado Mérida, Venezuela

Colletotrichum spp. e outros fungos associados à antracnose em Coffea arabica L. no estado de Mérida, Venezuela

ABSTRACT

In tropical and subtropical regions worldwide, diseases can be major limiting factors to coffee (Coffea arabica) production, a highly valued crop internationally. Our aim was to identify Colletotrichum spp. and other fungal species associated with Coffee Berry Disease (CBD) and anthracnose on coffee twigs, which can greatly inhibit crop production. Concatenated phylogenetic analyses of ApMat and GS loci were used to identify two Colletotrichum species. Colletotrichum siamense was isolated from symptomatic mature and green berries that were both infested and uninfected with Coffee Berry Borer (CBB) and from twigs displaying anthracnose symptoms. Colletrotrichum alienum was isolated from twigs showing anthracnose symptoms. Along with these two Colletotrichum species, association of Fusarium incarnatum (= Fusarium semitectum) and Fusarium solani was found. Identification of Fusarium species was obtained through combined datasets of partial TEF1 and RPB2. Fusarium isolates came from ripe coffee fruits displaying symptoms of CBD, infested or not with CBB, and coffee twigs. In addition, concatenation of four gene regions (ITS, TEF1, CAL, TUB2) allowed the identification of another fungus, together with isolates from coffee twigs with anthracnose, Diaporthe pseudomangiferae. This is the first report of Colletotrichum siamense and Colletotrichum alienum, along with the fungi Fusarium solani and Diaporthe pseudomangiferae, associated with berry diseases on Coffea arabica in the state of Mérida, Venezuela.

Keywords
Coffee Berry Disease; Diaporthe pseudomangiferae ; Fusarium incarnatum ; Fusarium solani

RESUMEN

En las regiones tropicales y subtropicales de todo el mundo, las enfermedades pueden ser factores limitantes importantes para la producción de café (Coffea arabica), un cultivo muy valorado a nivel internacional. Nuestro objetivo era identificar Colletotrichum spp., y otras especies de hongos asociadas con la enfermedad de las Bayas o Cerezas del café (CBD) y de la antracnosis en las ramitas de café, que pueden inhibir en gran medida la producción de cultivos. Se utilizaron análisis filogenéticos, concatenando los locus ApMat y GS para identificar dos especies de Colletotrichum. Se aisló Colletotrichum siamense desde bayas verdes y maduras sintomáticas que estaban infestadas y no por Broca del fruto del cafeto (CBB) y desde ramitas que presentaban síntomas de antracnosis. Colletrotrichum alienum se aisló de ramitas que mostraban síntomas de antracnosis. Junto con estas dos especies de Colletotrichum, se encontraron asociados Fusarium incarnatum (= Fusarium semitectum) y Fusarium solani. La identificación de la especie Fusarium se realizaron utilizando conjuntos de datos combinados del parcial TEF1 y RPB2. Los aislamientos de Fusarium provinieron de frutos de café maduros que mostraban síntomas de CBD, infestados o no con CBB y ramitas de café. Asimismo, mediante la concatenación de cuatro regiones genéticas (ITS, TEF1, CAL, TUB2) se identificó otro hongo junto con aislamientos de ramitas de café con antracnosis, Diaporthe pseudomangiferae. Este es el primer reporte de Colletotrichum siamense y Colletotrichum alienum, junto con los hongos Fusarium solani y Diaporthe pseudomangiferae, asociados con enfermedades de las bayas en Coffea arabica en el estado de Mérida, Venezuela.

Palabras Claves
Enfermedad de las Bayas o Cerezas del Café; Diaporthe pseudomangiferae ; Fusarium incarnatum ; Fusarium solani

RESUMO

Nas regiões tropicais e subtropicais do mundo todo, as enfermidades podem ser fatores limitantes importantes para a produção do café (Coffea arabica), que possui grande valor no mercado internacional. O objetivo do presente trabalho foi identificar as espécies de Colletotrichum spp. e de outros fungos associados a queda dos dos frutos do café (QFC) e a antracnose dos ramos que podem reduzir a produtividade. Foram utilizados análises filogenéticas, de locos ApMat e GS. Foi identificado Colletotrichum siamense nos frutos verdes e maduros sintomáticos infestados ou não pela broca do café (BFC) como também nos ramos com sintomas de antracnose onde se isolou Colletotrichum alienum. Associados a outras espécies de Colletotrichum, foi isolado do fungo Fusarium incarnatum (= Fusarium semitectum e Fusarium solani), identificados com a combinação TEF e RPB2. Mediante a amplificação de regiões genéticas (ITS, TEF1, CAL, TUB2), foi possível identificar outro fungo nos ramos com antracnose: Diaporthe pseudomangiferae. Este é o primeiro relato da ocorrência de Colletotrichum siamense e Colletotrichum alienum, junto com os fungos Fusarium solani e Diaporthe pseudomangiferae, associados com os frutos de Coffea arabica no estado de Mérida, Venezuela.

Palavras Chaves
Quadra dos frutos de café; Diaporthe pseudomangiferae ; Fusarium incarnatum ; Fusarium solani

Coffea arabica L. is considered one of the most important crops worldwide, contributing significantly to the economy of different countries. The largest global producers of green Coffea arabica include Brazil, Colombia, Ethiopia and Honduras; meanwhile, in Venezuela, Coffea arabica production has faced a steady decline since 2007 (¹⁸). Biotic agents, particularly fungal agents, are known as major limiting factors to coffee production. Increased fungal pressure can greatly impact food security in certain countries, especially those where coffee is a major income source for small-scale growers concerning purchase of food and supplies for grain cultivation (¹).

Pathogens of the genus Colletotrichum are responsible for anthracnose diseases on several economically important crops, and Colletotrichum gloeosporioides Penz. is the predominant pathogen in tropical and subtropical regions (⁵, ⁸, ³⁵, ⁴², ⁵³). Colletotrichum species have been reported on coffee as endophytes, epiphytes or pathogens (⁴²) capable of causing leaf necrosis, coffee berry diseases and dieback (³⁵).

Colletotrichum kahawae subsp. kahawae has been reported in multiple African countries, including Kenya, Angola, Cameroon and Malawi (⁵⁴), causing Coffee Berry Disease (CBD), damaging green berries and inducing premature fruit drop and/or fruit mummification (³⁷). This disease reduces yields by as much as 70-80% (¹⁴).

Even though C. kahawae is most virulent, sixteen Colletotrichum species have been identified on Coffea arabica, and six of them are presently reported in Vietnam and Mexico (⁵, ³⁵). There are reports of Colletotrichum asianum Prihastuti, L. Cai & K.D. Hyde, C. fructicola Prihastuti, L. Cai & K.D. Hyde, C. siamense Prihastuti, L. Cai & K.D. Hyde, and C. cordylinicola Phoulivong, L. Cai & K.D. Hyde causing diseases on green and red berries in Laos and Thailand (⁴¹, ⁴²); Colletotrichum acutatum Simmonds also causes minor disease on ripening berries (³¹). In Mexico, at least six Colletotrichum species were identified causing anthracnose on fruits and leaves of C. arabica, including C. gloeosporioides, C. siamense, C. gigasporum E.F. Rakotoniriana & F. Munauton, C. theobromicola Delacr., C. karstii Y.L. Yang, Zuo Y. Liu, K.D. Hyde & L. Cai and one Colletotricum sp. (⁵). In Costa Rica, Colletotrichum costaricense Damm, P.F. Cannon & Crous was isolated as pathogenic/endophytic on berries of C. arabica (⁶, ¹⁹). In Brazil, Colletotrichum boninense Moriwaki, Toy, Sato & Tsukib., and C. gloeosporioides have been reported on C. arabica and Coffea canephora L. trees, producing dieback and necrosis on leaves and berries (⁹). Furthermore, Colletotrichum coffeanum Noak & Pflanzenk. and C. gloeosporioides have also been reported as endophytic on healthy leaves of C. arabica in Brazil (³⁶). In Colombia, Colletotrichum gigasporum was reported as an endophytic fungus on C. arabica (⁴³).

For Venezuelan coffee production, there is little information about the involved diseases. In 1984 and 1985, C. arabica fields were surveyed in Lara and Portuguesa States, Venezuela, to determine the causal agent of leaf and branch anthracnose, fruit diseases and tree dieback. Colletotrichum gloeosporioides was identified, at altitudes between 700 and 1300 m, as the causal agent of anthracnose (²⁹, ³⁰). Colletotrichum capsici (Syd.) E. J. Butler & Bisby and a species similar to C. gossypii Southworth were reported as the causal agents of basal rot on coffee plants in Trujillo State (⁵¹). The aim of the present study was to characterize Colletotrichum species and fungal species associated with anthracnose and CBD in Venezuela using both morphological and genetic species identifications.

Figure 1
Coffee plant with anthracnose symptom. (A) Dead coffee plant due to anthracnose; (B) Berries with anthracnose symptoms or coffee berry disease (CBD); (C, D) CBD on ripe berries; (E) CBD on unripe or green berries; (F) Coffee berry borer (CBB); (G, H) Black acervuli on coffee twig with anthracnose.

MATERIALS AND METHODS

Isolation of fungal species from infected coffee berries and twigs

Samples were collected in two parishes from Antonio Pinto Salina Municipality (8°24′33.12″ N, 71°39′5.4″ W), Mesa de Las Palmas parish and Agropecuaria Las Canales farm, Santa Cruz de Mora parish, both belonging to Mérida State, Venezuela. Fungi were isolated from green and mature fruits symptomatic of CBD, infested or not with CBB, and from twigs with anthracnose (Figure 1). Samples were transferred to the Phytopathology Laboratory of the School of Forestry Engineering, University of Los Andes (ULA), Mérida State, Venezuela. Fungi were isolated from anthracnose lesions on infected berries and twigs by excising 5×5mm margins of infected tissue. The tissues were then dipped in 1% sodium hypochlorite for 1 minute, immersed in 70% ethanol for 1 minute, rinsed three times with sterile water and finally dried in sterile tissue paper. Samples were placed on water-agar and incubated at room temperature, 25-28°C. The growing edges of any fungal hyphae, developing from the tissues, were then transferred aseptically to potato dextrose agar (PDA; 20 g potato dextrose agar in 1L distilled water; Difco Laboratories, Detroit, MI). Fungi were identified following sporulation. Single spore subcultures were obtained according to the procedure described by Choi et al. (⁴). After overnight room temperature incubation, single germinated spores were picked up with a sterile needle, transferred to PDA and incubated at 25°C for 7 days or until mycelia were observed growing from the samples. Fungal mycelium was sub-cultured onto PDA and hyphal tipping methods were performed to obtain pure cultures.

Morphological analyses

Mycelial plugs (5-mm diameter) were taken from the periphery of actively growing cultures and transferred to 9-cm Petri dishes containing PDA and malt extract agar (MEA, Difco Laboratories, Detroit, MI, USA). Following incubation at room temperature (25°C) for 7 days, colony characteristics and pigment production were noted; colony diameters were measured after 7-to-10-day growth. Colony coloration was rated according to Rayner (⁴⁵). Cultures were examined periodically for ascoma development. Conidia produced on PDA and MEA were mounted in lactophenol to obtain dimensions and perform morphological analyses. If a fungus was not sporulating on PDA and MEA, morphological characteristics were described from synthetic nutrient-poor agar (SNA). Hyphal appressoria were observed on colonies grown on PDA. At least 50 measurements per structure were taken at x1000 magnification under a compound light microscope (Nikon Eclipse Ci).

DNA extraction, amplification and sequencing

DNA was extracted from 7-day-old axenic cultures, grown on half-strength potato dextrose agar medium (1/2 PDA: 10 g potato dextrose agar in 1L distilled water; Difco Laboratories, Detroit, MI) added of 0.1 g streptomycin sulphate (Sigma-Aldrich, USA). Cultures were grown on sterile MF-Millipore membrane filters (Millipore Sigma, Burlington, MA) and incubated at 25°C. DNA was extracted, using the ZR Fungal/Bacterial DNA MiniPrep (Zymo Research, Irvine, CA), following the manufacturer’s protocol. Polymerase chain reactions (PCR) were performed with a reaction mixture that consisted of 30 ng fungal genomic DNA, 2.5 μl of 10x Standard Tag Reaction Buffer (New England BioLabs (NEB), Ipswich, MA), 0.5 μl of 10 mM dNTP (Roche Applied Science, Penzberg, Germany), 1 μl of each of 10 μM primer, 0.125 μl Taq DNA polymerase (NEB), and sterile deionized water for a total volume of 25 μl. For certain fungal genera, 1.5 μl MgCl₂ had to be included in the PCR reaction mixture for amplification (Roche Diagnostics, Mannheim, Germany). PCR products were cleaned with ExoSAP-IT PCR Product Cleanup (Thermo Fisher Scientific, Grand Island, NY) and sequenced at Eurofins Scientific (www.eurofinsus.com).

Several genes were amplified and sequenced for phylogenetic species recognition considering the isolates within each genus, including 5.8S rDNA and two flanking internal transcribed spacers (ITS), partial sequence of the translation elongation factor 1-α (TEF1), glutamine synthetase (GS), Apn2-Mat1-2 intergenic spacer and partial mating type (Mat1-2) gene (ApMat), calmodulin (CAL), β-tubulin (TUB2), and RNA polymerase II second largest subunit (RPB2). Primer pairs were used for the following genera: Colletotrichum sp.: GS: GSLF2 (TACACGAGSAAAAGG ATACGC) and GSLR1 (AGRCGCACATTGTCAGTATCG) (²⁵); ApMAT: AMF1 (TCATTCTACGTATGTGCCCG) and AMR1 (CCAGAAATACACCGAACTTGC) (⁵⁰); Fusarium sp.: TEF1: EF1 (ATGGGTAAGGA(A/G)GACAAGAC) and EF2 (GGA(G/A)GTA CCAGT(G/C)ATCATGTT) (³⁸); RPB2: fRPB2-5f2 (GGGGWGAYCAGAAGAAGGC) and fRPB2-7cr (CCCATRGCTTGYTTRCCCAT) (²⁷); Diaporthe sp.: ITS: ITS1F (CTTGGTCATTTAGAGGAAGTAA) (¹¹) and ITS4 (TCCTCCGCTTATTGATATGC) (⁵⁵); TEF1: EF1-728F (CATCGAGAAGTTCGAGAAGG) and EF1-986R (TACTTGAAGGAACCCTTACC) (²); CAL: CAL-228F (GAGTTCAAGGAGGCCTTCTCCC) and CAL-737R (CATCTTTCTGGCCATCATGG) (²); TUB2: Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC) (¹²), respectively.

PCR thermal cycle programs were performed as described by each previous author. The optimum annealing temperatures were: ApMat, GS, ITS, TEF1 (EF1-728F+ EF1-986R): 55°C; TUB2: 55 or 60°C; TEF1 (EF1+EF2) and CAL: 61°C; RPB2: 62°C. Some isolates required a change in the annealing temperatures due to either excessive or no bands amplified at the original annealing temperature.

Phylogenetic analyses

Phylogenetic analyses compared the sequenced isolates from the current study with holotypes and ex-types of closely related taxa. Preliminary sequence alignments for each locus and genus were completed using either ClustalX v. 2.1 (²²) or BioEdit version 7.2.5 (¹⁵). Sequence data for closely related species considering genus were obtained from GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Manual adjustments and concatenation of loci were conducted using MAFFT for final alignments (²⁰, ²¹) within Geneious Pro v. 9.0.5.

Maximum likelihood (ML) and Bayesian inference (BI) algorithms were used to reconstruct phylogenies for alignments using PhyML and MrBayes v. 3.2.1 (⁴⁶) in Geneious v6.1.3 (Biomatters Inc.). A best-fit substitution model for each dataset was selected using the Bayesian Information Criterion (BIC) implemented in DT ModSel (³³). Models HKY+G, SYM+I+G and TrN+I+G were chosen for the combined loci for Colletotrichum, Fusarium and Diaporthe, respectively. For ML analyses within PhyML, phylogenies were run with 1000 bootstraps. Bayesian Markov Chain Monte Carlo analyses were carried out using MrBayes (¹⁷). Six chains were run for 2000000 generations and trees were sampled every 100 generations. The first 25000 trees were discarded as burn-in, the remaining trees were used to estimate posterior probabilities (PP) for the majority rule consensus tree. Phylogenies were estimated for each locus separately and multiple loci together for each genus.

Phylogenies for multiple loci datasets were estimated using Bayesian analyses, implemented in Bayesian Evolutionary Analysis Sampling Trees (BEAST v1.7.5) (⁷). BEAST does not use concatenation, but rather co-estimates the individual gene trees embedded inside the summary species tree. Bayesian Evolutionary Analysis Utility (BEAUti), version 1.7.5, was used to create XML-formatted input files for BEAST v1.7.5. In BEAST, a Markov Chain Monte Carlo algorithm was used to sample the posterior distribution of trees by conducting five independent runs of 100 million generations each using a constant size tree prior, strict molecular clock, and uniform priors. Trees were sampled every 1000 generations and the first 20% were discarded as burn-in. Post burn-in trees were combined with the program Log Combiner (BEAST v1.7.5), and chains were assumed to converge when the average standard deviation of split frequencies was < 0.01. The maximum clade credibility tree with posterior probability of each node was computed with the program Tree Annotator (BEAST v 1.7.5). Log files and tree files were visualized in Tracer v1.5 (http://tree.bio.ed.ac.uk/software/tracer/) and FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/), respectively.

Results and Discussion

Isolates were divided into five groups according to mycelium growth, color on culture media, and conidial shape and size after 8 days. Two groups of Colletotrichum and Fusarium and one Diaporthe were separated.

Colletotrichum Corda

Sixteen isolates of Colletotrichum spp. (CSM 143-1, CSM 143-2, CSM 144, CSM 148, CSM 149, CSM 150, CSM 151, CSM 152, CSM 153, CSM 154, CSM 155, CSM 158, CSM 159, CSM 163, CSM 166, CSM 167) presented colonies white to pale brown, reverse pale yellow, aerial mycelium greyish white, dense, cottony; conidia one-celled, smooth-walled, guttulate, hyaline, fusiform with obtuse to slightly rounded ends, sometimes oblong, 8-18.5 x 4-8.5 μm (mean = 12.7 x 5.5 μm, n = 50). Other five isolates (CSM 145, CSM 146, CSM 147, CSM 156, CSM 157) had colonies cottony, grey aerial mycelium and orange conidial ooze, reverse dark grey to pale orange in center; conidia were one-celled, cylindric with broadly rounded ends, 13-21 x 3-6 μm (mean = 15.5 x 5.0 μm, n = 50) (⁵⁴) (Table 1).

Table 1
GenBank and culture collection accession numbers of Colletotrichum spp. included in the current study.

Species	Accession number	Host	Locality	Collector	GenBank accession number
					GS	ApMat
Colletotrichum aenigma	ICMP 18608	Persea americana	Israel	S. Freeman	JX010078	KM360143
C. aeschynomenes	ICMP 17673	Aeschynomene virginica	USA	D. TeBeest	JX010081	KM360145
C. alatae	CBS 304.67	Dioscorea alata	India	K.L. Kothari/J. Abramham	JX010065	KC888932
C. alienum	ICMP 12071	Malus domestica	New Zealand	P.R. Johnston	JX010101	KM360144
C. alienum	LF322	Camellia sinensis	China	F. Liu	KJ954982	KJ954545
C. alienum	CSM 145	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584613	MG584592
C. alienum	CSM 146	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584612	MG584591
C. alienum	CSM 147	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584611	MG584590
C. alienum	CSM 156	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584610	MG584589
C. alienum	CSM 157	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584609	MG584588
C. aotearoa	ICMP 18537	Coprosma sp.	New Zealand	B. Weir	JX010113	KC888930
C. asianum	CBS 130418	Coffea Arabica (berry)	Thailand	H. Prihastuti	JX010096	FR718814
C. aeschynomenes	ICMP 17673	Aeschynomene virginica	USA	D. TeBeest	JX010081	KM360145
C. camelliae	LC1364	Camellia sinensis	China	P. Tan	KJ954932	KJ954497
C. clidemiae	ICMP 18658	Clidemia hirta	USA	S.A Ferreira/K. Pitz	JX010129	KC888929
C. cordylinicola	ICMP 18579	Cordyline fruticosa	Thailand	S. Phoulivong	JX010122	JQ899274
C. fructicola	CBS 130416	Coffea Arabica (berry)	Thailand	H. Prihastuti	JX010095	JQ807838
C. gloeosporioides	CBS 112999	Citrus sinensis	Italy	G. Goidánich	JX010085	JQ807843
C. henanense	LF238	Camellia sinensis	China	M. Zhang/R. Zang	KJ954960	KJ954524
C. horii	ICMP 10492	Diospyros kaki	Japan	N. Nishihara	JX010137	JQ807840
C. jiangxiense	LF687	Camellia sinensis	China	Y. Zhang	KJ955051	KJ954607
C. jiangxiense	LF684	Camellia sinensis	China	Y. Zhang	KJ955048	KJ954604
C. kahawae	ICMP 17816	Coffea arabica	Kenya	D.M. Masaba	JX010130	JQ894579
Colletotrichum musae	CBS 116870	Musa sp.	USA	M. Arzanlou	JX010103	KC888926
C. nupharicola	CBS 470.96	Nuphar lutea subsp. polysepala	USA	D.A. Johnson	JX010088	JX145319
C. psidii	CBS 145.29	Psidium sp.	Italy	M. Curzi	JX010133	KC888931
C. queenslandicum	ICMP 1778	Carica papaya	Australia	J.H. Simmonds	JX010104	KC888928
C. salsolae	ICMP 19051	Salsola tragus	Hungary	D. Berner	JX010093	KC888925
C. siamense	LF139	Camellia sp.	China	F. Liu	KJ954938	KJ954503
C. siamense	LF177	Camellia oleifera	China	F. Liu	KJ954943	KJ954508
C. siamense	CBS130417,ICMP 18578	Coffea arabica	Thailand	H. Prihastuti	JX010094	JQ899289
C. siamense (syn. C. hymenocallidis)	CBS125378,ICMP 18642	Hymenocallis americana	China	Y. L. Yang	JX010100	JQ899283
C. siamense	CSM 143-1	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584608	MG584587
C. siamense	CSM 143-2	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584607	MG584586
C. siamense	CSM 144	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584606	MG584585
C. siamense	CSM 148	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584605	MG584584
C. siamense	CSM 149	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584604	MG584583
C. siamense	CSM 150	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584603	MG584582
C. siamense	CSM 151	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584602	MG584581
C. siamense	CSM 152	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584601	MG584580
C. siamense	CSM 153	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584600	MG584579
C. siamense	CSM 154	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584599	MG584578
C. siamense	CSM 155	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584598	MG584577
C. siamense	CSM 158	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584597	MG584576
C. siamense	CSM 159	Coffea arabica-twigs	Venezuela	S. R. Mohali	MG584596	MG584575
C. siamense	CSM 163	Coffea arabica-ripe fruit	Venezuela	S. R. Mohali	MG584595	MG584574
C. siamense	CSM 166	Coffea arabica-ripe fruit	Venezuela	S. R. Mohali	MG584594	MG584573
C. siamense	CSM 167	Coffea arabica-ripe fruit	Venezuela	S. R. Mohali	MG584593	MG584572
Colletotrichum theobromicola	CBS 124945, ICMP18649	Theobroma cacao	Panama	E. J. Rojas	JX010139	KC790726
C. ti	ICMP 4832	Cordyline sp.	New Zealand	J.M. Dingley	JX010123	KM360146
C. tropicale	CBS 124949	Theobroma cacao	Panama	E.I. Rojas/L.C. Mejia/ Z. Maynard	JX010097	KC790728
C. viniferum	CBS 130644	Vitis vinifera, cv. ‘Hongti’	China	L.J. Peng	JN412784	KJ623242
C. xanthorrhoeae	CBS 127831	Xanthorrhoea preissii	Australia	F.D. Podger	JX010138	KC790689

• ICMP: International Collection of Microorganisms from Plants, Auckland, New Zealand; LC: Working collection of Lei Cai, housed at CAS, China; LF: Working collection of Fang Liu, housed at CAS, China; CBS: Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The Netherlands; CSM: Personal culture collection deposited in the Department of Bioagricultural Sciences & Pest Management, Colorado State University, USA.

Bayesian and maximum likelihood phylogenetic trees were generated for a concatenated dataset of ApMat and GS loci with 1838 base pairs. The phylogenies included 21 isolates of Colletotrichum species from the present study and 26 additional closely-related taxa and were rooted with C. xanthorrhoeae CBS 127831 (Table 1). Sixteen C. siamense isolates and five Colletotrichum alienum B. Weir & P.R. Johnst. isolates formed two separate and well-supported clades with values of BS/PP = 78/0.98 for Colletotrichum siamense and BS/PP = 94/0.97 for C. alienum (Figure 2).

Figure 2
Phylogenies generated from Bayesian analysis based on combined ApMat and GS sequences of Colletotrichum species. The phylogenies were rooted with C. xanthorrhoeae CBS 127831. Bootstrap test ≥ 50%: 1000 replicates and Bayesian posterior probabilities ≥ 0.50 (BS/PP) are highlighted by arrows. The isolates included in the current is study are in oblique and coffee isolates are in bold and oblique. The phylogeny includes annotation of species boundaries for taxa that belong to the C. gloeosporioides complex. Bootstrap (BS) values below 50% are marked with a hyphen (-) on the phylogenetic trees.

Coffee production has often been limited by CBD, which is caused by Colletotrichum kahawae in Kenya and other countries of Eastern Africa. At high altitudes, CBD is particularly devastating, damaging green berries and inducing premature fruit drop and fruit mummification, leading to production losses of 50 to 80% (¹⁶, ³⁴). Interestingly, Colletotrichum siamense was isolated from symptomatic CBD in green and mature fruits, infested or not with CBB, and from twigs with anthracnose symptoms, whereas C. alienum was only isolated from twigs with anthracnose. Colletotrichum siamense was first identified and reported in isolates from lesions in healthy berry tissues, as well as from the surface of coffee berries in northern Thailand (⁴²). In three municipalities in Puebla State, Mexico, C. siamense was isolated from leaves showing typical and atypical Cercospora lesions, as well as from symptomatic unripe fruits of coffee trees (⁵). In Chiapas, Mexico, 21 fungal genera were isolated from coffee berries infested with CBB by Hypothenemus hampei; however, Colletotrichum was not present in these isolates (⁴⁰). In the current study, C. siamense was found associated with CBB in coffee grown in Venezuela.

Colletotrichum alienum was isolated and identified for the first time on ripe fruit rot from Persea americana in Australia (⁵⁴), later in Israel (⁴⁷), on Malus domestica fruit rot in New Zealand (⁵⁴), associated with anthracnose diseases on Proteaceae in Australia, South Africa and Europe (²⁴), and on Nerium oleander in Australia (⁴⁸). This is the first report of such a species affecting coffee in Venezuela; however, as this species was recently named and separated from the C. gloeosporioides complex, it will likely be found in numerous regions where species within the C. gloeosporioides complex have been found (⁵⁴). Recently, 80 Colletotrichum isolates from an Australian culture collection were analyzed on a molecular phylogenetic level, and C. alienum was distinguished from other species within the C. gloeosporioides species complex using GS sequences (⁴⁹, ⁵⁴).

Sequence data of the concatenated ApMat and GS loci have served as a barcode for species identification of isolates belonging to the C. gloeosporioides species complex. Recently, Lui et al. (²⁶) used these loci to re-construct a phylogenetic tree of Colletotrichum species from Camellia spp., highlighting that the topology of ApMat-GS phylogram was similar to that of a phylogram encompassing sequence data from 8 loci (²⁵). Mating-related genes have been suggested to evolve at a faster rate and have a higher sequence variability, which dominates the topology of the multi-locus phylogram (²⁵), allowing ApMat-GS to be informative for species identification.

Fusarium Link ex Grey

Four isolates of Fusarium spp. (CSM 134, CMS 135, CMS 137, CMS 138) had cultures showing dense aerial mycelia, initially white to beige or brown with age; Chlamydospores present; Macroconidia 3 to 5 septate, apical cell curved and tapering to a point, basal cell foot-shaped, 20-41.5 x 2.0-4.5 μm (mean = 19.3 x 3.1 μm, n = 50). Other cultures of five isolates (CSM 136, CMS 139, CSM 140, CSM 141, CSM 142) usually are white to cream with sparse mycelium; Chlamydospores abundant; Macroconidia 5 to 7 septate, wide and straight, apical cell blunt and rounded, basal cell straight to almost cylindrical, 13.5-44 x 3.0-6 μm (mean = 20.5 x 3.6 μm, n = 50); Microconidia oval to ellipsoid, 0 or 1 septum (²³, ²⁸) (Table 2).

Table 2
_GenBank and culture collection accession numbers of Fusarium spp. included in the current study.

Species	Accession number	Host	Locality	Collector	GenBank accession number
					TEF1	RPB2
Fusarium avenaceum	FRC R-09495	-	-	-	GQ915502	GQ915486
F. aywerte	RBG5743	-	Australia	RBG	KP083250	KP083278
F. beomiforme	RBG4549	-	Australia	RBG	HQ667157	HQ646396
F. burgessii	RBG5319	Soil	Australia	B.Wang/A. Fraser	HQ667149	HQ646392
F. coicis	RBG5368	Coix gasteenii	Australia	RBG	KP083251	KP083274
F. commune	NRRL28387	Dianthus caryophyllus	The Netherlands	NRRL	AF246832	JX171638
F. culmorum	RBG3558	-	Australia	RBG	HQ667167	HQ646401
F. fujikuroi	NRRL13566	Oryza sativa	Taiwan	NRRL	AF160279	EF470116
F. gaditjirri	F15048	H. triticeus	Australia	L.W. Burgess	AY639634	HQ662690
F. goolgardi	RBG5411	Xanthorrhoea glauca	Australia	D.M Robinson/M.H. Laurence	KP101123	KP083280
F. hostae	RBG3994	-	Australia	RBG	HQ667160	HQ646390
F. incarnatum	CBS 132194	-	-	-	KF255470	KF255542
F. incarnatum	CBS 132894	-	-	-	KF255480	KF255545
F. incarnatum	CSM 134	Coffea arabica	Venezuela	S. R. Mohali	MG049934	MG049943
F. incarnatum	CSM 135	Coffea arabica	Venezuela	S. R. Mohali	MG049933	MG049942
F. incarnatum	CSM 137	Coffea arabica	Venezuela	S. R. Mohali	MG049932	MG049941
F. incarnatum	CSM 138	Coffea arabica	Venezuela	S. R. Mohali	MG049931	MG049940
F. lyarnte	RBG5331	-	Australia	RBG	EF107118	HQ662691
F. miscanthi	RBG4177	-	Australia	RBG	HQ667166	HQ662693
F. mundagurra	RBG5717	From soil Carnarvon Gorge National Park	Australia	S.M. Dunstan/M.H. Laurence	KP083256	KP083276
F. napiforme	NRRL13604	Pennisetum typhoides	Namibia	A.Lübben	AF160266	EF470117
Fusarium nelsonii	NRRL13338	Soil	Australia	NRRL	GQ505402	GQ505466
F. newnesense	RBG5443	-	Australia	RBG	KJ397074	KP083277
F. nisikadoi	RBG4043	-	Australia	RBG	HQ667165	HQ662692
Fusarium nelsonii	NRRL13338	Soil	Australia	NRRL	GQ505402	GQ505466
F. newnesense	RBG5443	-	Australia	RBG	KJ397074	KP083277
F. nisikadoi	RBG4043	-	Australia	RBG	HQ667165	HQ662692
F. oxysporum	RBG5413	-	Australia	RBG	HQ667161	HQ646385
F. oxysporum	RBG5414	-	Australia	RBG	HQ667163	HQ646388
F. oxysporum	CSM 105	Theobroma cacao	Venezuela	S. R. Mohali	MF436042	MF447156
F. oxysporum	CSM 109	Theobroma cacao	Venezuela	S. R. Mohali	MF436041	MF447155
F. proliferatum	NRRL43665	Contact lens	USA	NRRL	EF452996	EF470035
F. pseudograminearum	RBG3580	-	Australia	RBG	HQ667168	HQ646400
F. redolens	RBG4173	-	Australia	RBG	HQ667159	HQ646391
F. sibiricum	NRRL53429	Avena sativa	Russia	L. S. Malinovskaya/ E. A. Pirjazeva	HM744683	HQ154471
F. solani	CBS 138564	Homo sapiens	Turkey	-	KT272100	KT272102
F. solani	CBS 131775	wheat	Iran	M. Davari	JX118990	JX237778
F. solani	CSM 103	Theobroma cacao	Venezuela	S. R. Mohali	MF436040	MF436050
F. solani	CSM 250	Theobroma cacao	Venezuela	S. R. Mohali	MF436033	MF436046
F. solani	CSM 136	Coffea arabica	Venezuela	S. R. Mohali	MG049930	MG049938
F. solani	CSM 139	Coffea arabica	Venezuela	S. R. Mohali	MG049929	MG049939
F. solani	CSM 140	Coffea arabica	Venezuela	S. R. Mohali	MG049928	MG049937
F. solani	CSM 141	Coffea arabica	Venezuela	S. R. Mohali	MG049927	MG049936
F. solani	CSM 142	Coffea arabica	Venezuela	S. R. Mohali	MG049926	MG049935
F. tjaetaba	RBG5361	Sorghum interjectum	Australia	J.L. Walsh.	KP083263	KP083275
F. verticillioides	NRRL43656	Contact lens	USA	NRRL	EF452987	EF470026

• RBG: Royal Botanic Gardens Trust, Sydney, New South Wales, Australia; NRRL: Agricultural Research Service Culture Collection, Peoria, Illinois USA; F: University of Sydney, Sydney, New South Wales, Australia; CBS: Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The Netherlands. CSM: Personal culture collection deposited in the Department of Bioagricultural Sciences & Pest Management, Colorado State University, USA; FRC: Fusarium Research Center, Penn State University, University Park, USA; -: not provided in literatures.

The combined datasets of the partial TEF1 and RPB2 was comprised of 1659 base pairs from 27 taxa collected from this study and 43 reference species (Table 2). Fusarium lyarnte RBG5331 served as the outgroup. Four F. incarnatum (Roberge) Sacc (= Fusarium semitectum Berk. & Ravenel) isolates clustered together with reference species, forming a Fusarium incarnatum-equiseti species complex (FIESC). Five Fusarium solani (Mart.) Sacc)/ sexual morph Neocosmospora solani (Mart.) L. Lombard & Crous isolates clustered together. The BS and PP values for each F. incarnatum and F. solani well-support clades were BS/PP = 100/1 (Figure 3).

Figure 3
Phylogenies generated from Bayesian analysis based on combined EF1 and RPB2 sequences of Fusarium species. The phylogenies were rooted with Fusarium lyarnte (RBG 5331). Bootstrap test ≥ 50%:1000 replicates and Bayesian posterior probabilities ≥ 0.70 (BS/PP) are highlighted by arrows. The new coffee isolates included in the current study are in oblique and bold.

Fusarium species have long been known as latent pathogens of different tree species, existing as endophytes before causing disease (³). Numerous Fusarium species have previously been reported on coffee, as an endophyte or as a pathogen. The present study found Fusarium incarnatum and F. solani associated with anthracnose and as endophytes. In Colombia, Hawaii, Mexico and Puerto Rico, Fusarium sp. was the second most common endophyte out of 843 isolated fungi, while Colletotrichum sp. was the most commonly isolated species (⁵²). A survey conducted from 1979 to 1981 in Puerto Rico, to evaluate anthracnose incidence and severity, found that Fusarium stilboides (Wollenw.), F. oxysporum (Schltdl.) and F. semitectum were associated with anthracnose symptoms (³²), indicating that multiple Fusarium are capable of causing anthracnose on coffee. In Minas Gerais, Brazil, Fusarium equiseti (Corda) Sacc. and F. semitectum were found to be associated with the mycobiota, both internally and externally, on four coffee bean cultivars (C. arabica) without observable symptoms (³⁹) and, similar to our study, Fusarium incarnatum was reported on coffee beans in Campo Elias Municipality, Trujillo State, Venezuela (⁵¹).

Fusarium solani and Fusarium sp. have been reported as part of the mycobiota associated with the cuticle, gut, feces and galleries of CBB, Hypothenemus hampei, in coffee plantations in Chiapas, Mexico (⁴⁰). Interestingly, in the current study, Fusarium incarnatum and F. solani were isolated from ripe coffee fruits, with or without CBD infestations in Mérida, Venezuela, indicating that there may not be a close association of these Fusarium species with CBB.

Diaporthe Nitschke (asexual morph Phomopsis (Sacc.) Bubák).

Three isolates (CSM 133, CSM 222, CSM 224) with similar characteristics to genus Phomopsis/sexual morph Diaporthe produced cultures with a surface dirty white to ochreous, reverse umber, very large, coalescing stromata with lodged, elongated pycnidia necks forming dense, cream-colored droplets of conidia. Alpha conidia abundant, base truncate, smooth, aseptate, hyaline, guttulate, fusiform, tapering towards both ends, apex acutely rounded, 5.5-10 x 2-3 μm (mean = 8.0 x 2.5 μm, n = 50), beta conidia not seen (¹³) (Table 3).

Table 3
GenBank and culture collection accession numbers of Diaporthe spp. included in the current study.

Species	Accession number	Host	Locality	Collector	GenBank accession number
					ITS	TEF1	TUB2	CAL
Diaporthe acutispora	LC6161	Coffea sp.	China	W.J.Duan	KX986764	KX999155	KX999195	KX999274
D. arecae	CBS 161.64	Areca catechu	India	H.C. Srivastava	KC343032	KC343758	KC344000	KC343274
D. arengae	CBS 114979	Arenga engleri	Hong Kong	K.D. Hyde	KC343034	KC343760	KC344002	KC343276
D. cf. heveae 2	CBS 681.84	Hevea brasiliensis	India	K. Jayarathnam	KC343117	KC343843	KC344085	KC343359
D. eugeniae	CBS 444.82	Eugenia aromatica	West Sumatra	R. Kasim	KC343098	KC343824	KC344066	KC343340
D. fraxini-angustifoliae	BRIP 54781	Fraxinus-angustifolia subsp. oxycapa	Australia	L. Smith	JX862528	JX852534	KF170920	-
D. hongkongensis	CBS 115448	Dichora febrifuga	Hong Kong	K.D. Hyde	KC343119	KC343845	KC344087	KC343361
D. litchicola	BRIP 54900	Litchi chinensis	Australia	K.R.E. Grice	JX862533	JX862539	KF170925	-
D. lithocarpus	LC0785	Lithocarpus glabra	China	W. Sun	KF576274	KF576249	KF576298	KF576226
D. lithocarpus	CGMCC 3.17095	Lithocarpus glabra	China	W. Sun	KF576285	KF576260	KF576309	KF576234
D. musigena	CBS 129519	Musa sp.	Australia	P.W. Crous & R.G. Shivas	KC343143	KC343869	KC344111	KC343385
D. pascoei	BRIP 54847	Persea americana	Australia	I.G. Pascoe	JX862532	JX862538	KF170924	-
D. perseae	CBS 151.73	Perseae gratissima	Netherlands Antilles	E. Laville	KC343173	KC343899	KC344141	KC343415
D. pescicola	MFLUCC 16-0105	Prunus persica	China	X. H. Li	KU557555	KU557623	KU557579	KU557603
D. podocarpi-macrophylli	LC6194	Podocarpus macrophyllus	China	W.J. Duan	KX986785	KX999156	KX999196	KX999275
D. pseudomangiferae	CBS 101339	Mangifera indica	Dominican Republic	P. de Leeuw	KC343181	KC343907	KC344149	KC343423
D. pseudomangiferae	CBS 388.89	Mangifera indica	Mexico	P. de Leeuw	KC343182	KC343908	KC344150	KC343424
D. pseudomangiferae	CSM 133	Coffea arabica	Venezuela	S.R. Mohali	MG576129	MG584619	MG584622	MG584616
D. pseudomangiferae	CSM 222	Coffea arabica	Venezuela	S.R. Mohali	MG576128	MG584618	MG584621	MG584615
D. pseudomangiferae	CSM 224	Coffea arabica	Venezuela	S.R. Mohali	MG576127	MG584617	MG584620	MG584614
D. pseudophoenicicola	CBS 462.69	Phoenix dactylifera	Spain	H.A. van der Aa	KC343184	KC343910	KC344152	KC343426
D. pseudophoenicicola	CBS 176.77	Mangifera indica	Iraq	M.S.A. Al-Momen	KC343183	KC343909	KC344151	KC343425
D. pterocarpicola	MFLUCC 10-0580a	Piterocarpus indicus	Thailand	D. Udayanga	JQ619887	JX275403	JX275441	JX197433
D. pterocarpicola	MFLUCC 10- 0580b	Piterocarpus indicus	Thailand	D. Udayanga	JQ619888	JX275404	JX275442	JX197434
D. sennae	CFCC 51636	Senna bicapsularis	China	Q. Yang	KY203724	KY228885	KY228891	KY228875
D. taoicola	MFLUCC 16-0117	Prunus persica	China	X.H. Li	KU557567	KU557635	KU557591	-
D. tectonigena	MFLUCC 12-0767	Tectona grandis	Thailand	M. Doilom	KU712429	KU749371	KU743976	KU749358
D. undulata	LC8110	Unknown host	China	F. Liu	KY491545	KY491555	KY491565	-
D. xishuangbanica	LC6744	Camellia sinensis	China	F. Liu	KX986784	KX999176	KX999217	-
D. yunnanensis	LC8106	Coffea sp.	China	W.J. Duan	KY491541	KY491551	KY491561	KY491571
D. yunnanensis	LC8107	Coffea sp.	China	W.J. Duan	KY491542	KY491552	KY491562	KY491572
Diaporthella corylina	CBS 121124	Corylus sp.	China	L.N. Vassiljeva	KC343004	KC343730	KC343972	KC343246

• CSM: Personal culture collection deposited in the Department of Bioagricultural Sciences & Pest Management, Colorado State University, USA; CBS: Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The Netherlands; MFLUCC: Mae Fah Luang University Culture Collection; BRIP: Australian plant pathogen culture collection, Queensland; CGMCC: China General Microbiological Culture Collection Center; CFCC: China Forestry Culture Collection Center; LC: Working collection of Lei Cai, housed at Institute of Microbiology, CAS, China. -: not provided in literatures.

A concatenated dataset of four gene regions was used for Diaporthe species identification. The ITS, TEF1, CAL and TUB2 data had 2095 base pairs and included 03 taxa isolated in the current study plus 31 reference species of Diaporthe. Diaporthella corylina was included as an outgroup CBS 121124 (Table 3). Three Diaporthe pseudomangiferae R.R. Gomes, C. Glienke & Crous isolates were clustered with BS/PP = 76/0.99 (Figure 4).

Figure 4
Phylogenies generated from Bayesian analysis based on combined ITS, TEF1, CAL and TUB2 sequences of Diaporthe species. The phylogenies were rooted with Diaporthella corylina CBS 121124. Bootstrap test ≥ 75%:1000 replicates and Bayesian posterior probabilities ≥ 0.99 (BS/PP) are highlighted by arrows. The new coffee isolates included in the current study are in oblique and bold.

Diaporthe species (asexual morph = Phomopsis) have been previously isolated from coffee as both pathogens and endophytes around the globe; however, Diaporthe species have varied depending on location. In the present study, Diaporthe pseudomangiferae could be isolated from coffee twigs with anthracnose symptoms in Venezuela. Phomopsis sp. was previously isolated in Venezuela from a coffee leaf spot in Trujillo (⁵¹). In Puerto Rico, Phomopsis sp. was found on branches and dead nodes of coffee trees with C. gloeosporioides and mummified berries (³²). Furthermore, Diaporthe acutispora Y.H. Gao & L. Cai and Diaporthe yunnanensis Y.H. Gao & L. Cai were also isolated from healthy leaves of Coffea sp. in Yunnan Province of China (¹⁰).

In Kenya, Rayner (⁴⁴) isolated and reported Phomopsis sp. as a coffee endophyte after having sterilized the surfaces of healthy leaves, pedicels, stems, and green berries; an endophyte was also isolated from asymptomatic coffee tissues of berries and leaves in Colombia, Hawaii, Mexico and Puerto Rico (⁵²). Diaporthe liquidambaris (C.Q. Chang, Z.D. Jiang & P.K. Chi) Udayanga & Castl., and D. phaseolorum (Cooke & Ellis) Sacc. are endophytic fungi which have been isolated from mature healthy leaves of Coffea Arabica, in both conventional and organic coffee production systems, in the municipality of Garanhuns, Pernambuco, Brazil (³⁶). Diaporthe acutispora Y.H. Gao & L. Cai and Diaporthe yunnanensis Y.H. Gao & L. Cai were also isolated from healthy leaves of Coffea sp. in Yunnan Province of China (¹⁰). It is not entirely clear whether Diaporthe spp. play a role as latent pathogens in Coffea spp., but species in these genera are known as endophytes and pathogens (¹³).

Although CBD caused by C. kahawae is so far restricted to Africa, in 1986 and 1994 isolates similar to C. gloeosporioides that cause coffee berry diseases were reported in the states of Lara, Portuguesa and Trujillo States, Venezuela, based on morphological identification. This species has been reported as the cause of anthracnose on leaves and branches, fruit diseases and dieback in coffee crops (²⁹, ³⁰, ⁵¹). In the current study, both morphological and molecular species identification detected absence of C. gloeosporioides but presence of other Colletotrichum species, including C. siamense and C. alienum. These reported Colletotrichum species are capable of and known for causing berry diseases and anthracnose on Coffea spp. shoots. Thus, appropriate management measures for pathogen control must be adopted to prevent the introduction of this disease to other coffee growing areas, specially to neighboring regions in South America. The current study is the first report of D. pseudomangiferae associated with anthracnose in coffee plantations in Venezuela. The pathogen can be considered an endophyte or a latent pathogen together with Fusarium species in the global trade market.

ACKNOWLEDGEMENTS

We are grateful to the U. S. Department of State Fulbright Scholar Program for supporting a one-year exchange visit and providing financial support to Prof. Sari R. Mohali Castillo, ID assigned: PS00236102, as researcher in the Department of Agricultural Biology, Colorado State University. We also thank Kristen Otto for excellent laboratory assistance.

REFERENCES

• ¹
  Avelino, J.; Cristancho, M.; Georgiou, S.; Imbach, P.; Aguilar, L.; Bornemann, G.; Morales, C. The coffee rust crises in Colombia and Central America (2008-2013): impacts, plausible causes and proposed solutions. Food Security, Springer Netherlands, v.7, n.2, p.303-321, 2015.
• ²
  Carbone, I.; Kohn, L. M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia, USA, v.91, n.3, p.553-556, 1999.
• ³
  Carroll, G. Fungal endophytes in stems and leaves: from latent pathogen to mutualistic symbiont. Ecology, Washington, DC, USA, v.69, n.1, p.2-9. 1998.
• ⁴
  Choi, Y.W.; Hyde, K.D.; Ho, W. Single spore isolation of fungi. Fungal Diversity, Kunming, China, v.3, p.29-38, 1999.
• ⁵
  Cristóbal-Martínez, A.L.; Yáñez-Morales, M.; Solano-Vidal, R.; Segura-León, O.; Hernández-Anguiano, A.M. Diversity of Colletotrichum species in coffee (Coffea arabica) plantations in Mexico. European Journal of Plant Pathology, Springer Netherlands, v.147, n.3, p.605-614, 2017.
• ⁶
  Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Crous, P.W. The Colletotrichum acutatum species complex. Studies in Mycology, Utrecht, v.73, p.37-113, 2012.
• ⁷
  Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, Oxford, v.29, n.8, p.1969-1973, 2012.
• ⁸
  Freeman, S. Genetic diversity and host specificity of Colletotrichum species on various fruits. In: Prusky, D.; Freeman, S.; Dickman, M.B. (ed.). Colletotrichum, host specificity, pathology, and host-pathogen interaction, St Paul: APS Press, 2000. p.131-144.
• ⁹
  Freitas, R.L.; Maciel-Zambolim, E.; Zambolim, L.; Lelis, D.T.; Caixeta, E.T.; Lopes, U.P.; Pereira, O.L. Colletotrichum boninense causing anthracnose on coffee trees in Brazil. Plant Disease, St. Paul, v.97, n.9, p.1255, 2013.
• ¹⁰
  Gao, Y.; Liu, F.; Duan, W.; Crous, P. W.; Cai, L. Diaporthe is paraphyletic. IMA FUNGUS, USA, v.8, n.1, p.153-187, 2017.
• ¹¹
  Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts. Molecular Ecology, United Kingdom, v.2, n.2, p.113-118, 1993.
• ¹²
  Glass, N.L.; Donaldson, G. Development of primer sets designed for use with PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology, USA, v.61, n.4, p.1323-1330, 1995.
• ¹³
  Gomes, R.R.; Glienke, C.; Videira, S.I.R.; Lombard, L.; Groenewald, J.Z.; Crous, P.W. Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia, Leiden, Netherlands, v.31, p.1-41, 2013.
• ¹⁴
  Griffiths, E.; Gibbs, J.N.; Waller, J.M. Control of coffee berry disease. Annals of Applied Biology, United Kingdom, v.67, n.1, p.45-74, 1971.
• ¹⁵
  Hall, T.A. BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, Oxford, v.41, n.2, p.95-98, 1999.
• ¹⁶
  Hindorf, H.; Omondi, C.O. A review of three major fungal diseases of Coffea arabica L. in the rainforests of Ethiopia and progress in breeding for resistance in Kenya. Journal of Advanced Research, Egypt, v.2, n.2, p.109-120, 2011.
• ¹⁷
  Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogeny. Bioinformatics, Oxford, v.17, n.8, p.754-755, 2001.
• ¹⁸
  Index Mundi. Green Coffee Arabica Production by Country in 1000, 60 KG BAGS [S. l]: Index Mundi, 2022. Available at: <https://www.indexmundi.com/agriculture/?Commodity=green-coffee&graph=arabica-production>. Accessed on: 15 Nov. 2022, USA.
  » https://www.indexmundi.com/agriculture/?Commodity=green-coffee&graph=arabica-production
• ¹⁹
  Jayawardena, R.S.; Hyde, K.D.; Damm, U.; Cai, L.; Liu, M.; Li, X. H.; Zhang, W.; Zhao, W.S.; Yan. J.Y. Notes on currently accepted species of Colletotrichum Mycosphere, Guangzhou, China, v.7, n.8, p.1192-1260, 2016.
• ²⁰
  Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: improvements in program usability. Molecular Biology and Evolution, Oxford, v.30, n.4, p.772-780, 2013.
• ²¹
  Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; Thierer, T.; Ashton, B.; Mentjies, P.; Drummond, A. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, Oxford, v.28, n.12, p.1647-1649, 2012.
• ²²
  Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; Thompson, J. D.; Gibson, J.; Higgins, D.G. Clustal W and Clustal X v. 2.0. Bioinformatics, Oxford, v.23, n.21, p.2947-2948, 2007.
• ²³
  Leslie, J.F.; Summerell, B.A. The Fusarium laboratory manual Ames: Blackwell Professional, 2006. 388p.
• ²⁴
  Liu, F.; Damm, U.; Cai, L.; Crous, P. W. Species of the Colletotrichum gloeosporioides complex associated with anthracnose diseases of Proteaceae. Fungal Diversity, Kunming, China, v.61, p.89-105, 2013.
• ²⁵
  Liu, F.; Wang, M.; Damm, U.; Crous, P. W.; Cai, L. Species boundaries in plant pathogenic fungi: a Colletotrichum case study. BMC Evolutionary Biology, United Kingdom, v.16, n.81, 1-14. 2016.
• ²⁶
  Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum species associated with Camellia: employing ApMat and GS loci to resolve species in the C. gloeosporioides complex. Persoonia, Leiden, Netherlands, v.35, p.63-86, 2015.
• ²⁷
  Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Molecular Biology and Evolution, Oxford, v.16, n.12, p.1799-1808, 1999.
• ²⁸
  Lombard, L.; Van der Merwe, N.A.; Groenewald, J.Z.; Crous, P.W. Generic concepts in Nectriaceae. Studies in Mycology, Utrecht, v.80, p.189-245, 2015.
• ²⁹
  Martínez de Carrillo, M.; Zambrano, C. Identificación y patogenicidad de cepas del genero Colletotrichum asociados al cultivo del café Coffea aribica L. en la región Centro Occidental de Venezuela. Agronomía Tropical, Maracay, v.44, n.4, p.567-577, 1994.
• ³⁰
  Martínez de Carrillo, M.; Zambrano, C. Variantes morfológicas de cepas del genero Colletotrichum asociadas al cultivo del café Coffea arabica L. en diferentes pisos altitudinales de la región Centro Occidental de Venezuela. Agronomía Tropical, Maracay, v.44, n.4, p.679-692, 1994.
• ³¹
  Masaba, D.; Waller, J. M. Coffee berry disease: the current status. In: Bailey, J.A.; Jeger, M.J. (ed.). Colletotrichum: biology, pathology and control. Wallingford: CAB International, 1992. p.237-249.
• ³²
  Mignucci, J.S.; Hepperly, P.R.; Ballester, J.; Rodríguez-Santiago, C. Anthracnose and berry disease of coffee in Puerto Rico. The Journal of Agriculture of the University of Puerto Rico, Puerto Rico, v.69, n.1, p.107-117, 1985.
• ³³
  Minin, V.; Abdo, Z.; Joyce, P.; Sullivan, J. Performance-based selection of likelihood models for phylogeny estimation. Systematic Biology, Oxford, v.52, n.5, p.674-683, 2003.
• ³⁴
  Motisi, N.; Ribeyre, F.; Poggi, S. Coffee tree architecture and its interactions with microclimates drive the dynamics of coffee berry disease in coffee trees. Scientific reports, London, United Kingdom, v.9, n.2544, 1-12, 2019.
• ³⁵
  Nguyen, P.T.H.; Pettersson, O.V.; Olsson, P.; Liljeroth, E. Identification of Colletotrichum species associated with anthracnose disease of coffee in Vietnam. European Journal of Plant Pathology, Springer Netherlands, v.127, n.1, p.73-87, 2010.
• ³⁶
  Oliveira, R.; Souza, R.; Lima, T.; Cavalcanti, M. Endophytic fungal diversity in coffee leaves (Coffea arabica) cultivated using organic and conventional crop management systems. Mycosphere, Guangzhou, China, v.5, n.4, p.523-530, 2014.
• ³⁷
  Omondi, C.O.; Ayiecho, P.O.; Mwang’Ombe, A.W.; Hindorf, H. Reaction of some Coffea arabica genotypes to strains of Colletotrichum kahawae, the cause of coffee berry disease. Journal of Phytopathology, United Kingdom, v.148, n.1, p.61-63, 2000.
• ³⁸
  O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences, USA, v.95, n.5, p.2044-2049, 1998.
• ³⁹
  Pereira-Pasin, L.A.A.; Almeida, J.R.; Abreu, M.S. Fungos associados a grãos de cinco cultivares de café (Coffea arabica L.). Acta Botanica Brasilica, Brasília, Brazil, v.23, n.4, p.1129-1132, 2009.
• ⁴⁰
  Pérez, J.; Infante, F.; Vega, F.E.; Holguín, F.; Macías, J.; Valle, J.; Nieto, G.; Peterson, S.W.; Kurtzman, C.P.; O’Donnell, K. Mycobiota associated with the coffee berry borer (Hypothenemus hampei) in Mexico. Mycological Research, Amsterdam, The Netherlands, v.107, n.7, p.879-887, 2003.
• ⁴¹
  Phoulivong, S.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Abdelsalam, K.; Hyde, K.D.; Chukeatirote, E. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Diversity, Kunming, v.44, p.33-43, 2010.
• ⁴²
  Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Diversity, Kunming, China, v.39, 89-109, 2009.
• ⁴³
  Rakotoniriana, E.F.; Scauflaire, J.; Rabemanantsoa, C.; Urveg- Ratsimamanga, S.; Corbisier, A.M.; Quetin-Leclercq, J.; Declerck, S.; Munaut, F. Colletotrichum gigasporum sp. nov., a new species of Colletotrichum producing long straight conidia. Mycological Progress, Germany, v.12, n.2, p.403-412, 2013.
• ⁴⁴
  Rayner, R.W. Latent infection in Coffea arabica L. Nature, Cambridge, v.161, p.245-246, 1948.
• ⁴⁵
  Rayner, R.W. A mycological colour chart Surrey: Commonwealth Mycological Institute, 1970. 34p.
• ⁴⁶
  Ronquist, F.; Teslenko, M.; Van der Mark, P.; Ayres, D.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.; Huelsenbeck, J. MrBayes v.3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, Oxford, v.61, n.3, p.539-542, 2012.
• ⁴⁷
  Sharma, G.; Maymon, M.; Freeman, S. Epidemiology, pathology and identifcation of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in Israel. Scientific Reports, London, United Kingdom, v.7, n.15839, 1-16, 2017.
• ⁴⁸
  Schena, L.; Mosca, S.; Cacciola, S.O.; Faedda, R.; Sanzani, S.M.; Agosteo, G. E.; Sergeeva, V.; Magnano di San Lio, G. Species of the Colletotrichum gloeosporioides and C. boninense complexes associated with olive anthracnose. Plant Pathology, Sutton Bonington, v.63, n.2, p.437-446, 2014.
• ⁴⁹
  Shivas, R.G.; Tan, Y.P.; Edwards, J.; Dinh, Q.; Maxwell, A.; Andjic, V.; Liberato, J.R.; Anderson, C.; Beasley, D.R.; Bransgrove, K.; Coates, L.M.; Cowan, K.; Daniel, R.; Dean, J.R.; Lomavatu, M.F.; Mercado-Escueta, D.; Mitchell, R.W.; Thangavel, R.; Tran-Nguyen, L.T.T.; Weir, B.S. Colletotrichum species in Australia. Australasian Plant Pathology, Netherlands, v.45, n.5, p.447-464, 2016.
• ⁵⁰
  Silva, D.N.; Talhinhas, P.; Várzea, V.; Cai, L.; Paulo, O.S.; Batista, D. Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia, USA, v.104, n.2, p.396-409, 2012.
• ⁵¹
  Urtiaga, R. Índice de enfermedades en plantas de Venezuela y Cuba Barquisimeto: Impresos Nuevo Siglo, 1986. 324p.
• ⁵²
  Vega, F.E.; Simpkins, A.; Aime, M.C.; Posada, F.; Peterson, S.W.; Rehner, S. A.; Infante, F.; Castillo, A.; Arnold, A.E. Fungal endophyte diversity in coffee plants from Colombia, Hawai’i, Mexico and Puerto Rico. Fungal ecology, Netherlands, v.3, n.3, p.122-138, 2010.
• ⁵³
  Waller, J.M. Colletotrichum diseases of perennial and other cash crops. In: Bailey, J.A.; Jeger, M.J. (ed.). Colletotrichum: biology, pathology and control. Wallingford: CAB International, 1992. p.131-142.
• ⁵⁴
  Weir, B.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Studies in Mycology, Netherlands, v.73, p.115-180, 2012.
• ⁵⁵
  White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J.L. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.; Gelfand, D.H.; Sninsky, J.J.; White. T.J. (ed.). PCR protocols: a guide to methods and applications. London: Academic Press Inc., 1990. chap.38, p.315-322.

Publication Dates

• Publication in this collection
  28 Nov 2022
• Date of issue
  Apr-Jun 2022

History

• Received
  24 Nov 2020
• Accepted
  30 Aug 2022