In Silico Identification of MicroRNAs with B/CYDV Gene Silencing Potential

ABSTRACT

Computational investigation of a set of publicly available plant microRNAs revealed 19 barley- and other plants-encoded miRNAs and their near-complement reverse sequences (miRNA^*) that have potential to bind all B/CYDV open reading frames (ORFs) except ORF0 and ORF6. These miRNAs/miRNAs^*, their binding positions and targets are discussed in the context of biological protection of cereals against B/CYDV, based on antiviral silencing.

Key words:
Barley/Cereal Yellow Dwarf virus (B/CYDV); microRNA; Gene silencing; Host defense

Barley/Cereal Yellow Dwarf Virus (B/CYDV) infects cereal crops worldwide, causing severe leaf symptoms and decreased yield. B/CYDV is a positive sense single-stranded RNA virus, belonging to the Luteoviridae family and its subspecies are assigned either to Polerovirus genus (CYDV-RPV), or to Luteovirus (BYDV-PAV and BYDV-MAV). Several aphid species transmit the B/CYDV viral particles following a persistent and circulative mode ¹. The genome of B/CYDVs contains six Open Reading Frames (ORFs) ². ORF1 is involved in RNA replication; ORF2 encodes the RNA-dependent RNA polymerase (RdRp) and is expressed only fused to ORF1 via ribosomal frame-shifting ³, resulting in a high ratio of the ORF1 product (P1) to the ORF1-ORF2 product (P1-P2 fusion); ORF3 encodes the major coat protein (CP) of 22 kDa, which has peptide motifs involved in viral transmission ⁴; ORF4, entirely included in ORF3, but in a different reading frame ², encodes a 17 kDa movement protein (MP) involved in systemic infection ⁵; ORF5 is the product of a translational readthrough the ORF3 stop codon and it is involved in aphid transmission and in long distance movement of viral particles ⁵; moreover, it exists, in Luteoviruses, a small and variable ORF6 near the 3' end of RNA whose function is unknown ⁶. Finally, Poleroviruses have an ORF0 at the 5′ end that induces virus symptoms ⁷ and is probably a suppressor of RNA silencing ⁶. In addition, ORF1 of Poleroviruses encodes a proteinase motif and the viral genome-linked protein (VPg) ⁸, which is absent in Luteoviruses. As soon as a phytovirus infects the host plant, a host-pathogen arms race is initiated, the outcome of which determines the fate of viral survival. There are several operative defense mechanisms in plants, among them microRNA responses that are an important and decisive factor in conferring resistance to pathogens ⁹. MicroRNAs (miRNAs or miRs) are a class of endogenous non-coding small (18-25 nucleotides) RNAs, encoded by so called MIR genes. In plants, miRNAs play fundamental roles such as organogenesis, meristem development, leaf and flower morphogenesis, signal transduction and response to environmental stresses ^10-12. MicroRNA-mediated gene silencing is a widespread mechanism of host defense against viral ¹³ and bacterial infections ⁹. Currently, many miRNAs interfering with the cycles of a number of phytopathogenic viruses have been identified in Solanaceae, such as potato ¹⁴, and in cereal plants, such as rice ¹⁵, barley ¹⁶, wheat ¹⁷ and sorghum ¹⁸. Moreover, an over-expression of the carrier/passenger strand called miRNA^* (miRNA star) ¹⁹, in response to viral infection, has been demonstrated in several plant species, such as Arabidopsis thaliana²⁰ and Solanum lypersicum²¹. In this latter species, it was demonstrated that miRNA^* sequences have a potential to bind to most of the tomato leaf curl virus (ToLCV) open reading frames (ORFs). In order to limit the expanding of B/CYDV over the world, it has become imperative to set up novel strategies, involving miRNAs (and/or miRNAs^*) interactions with cereal hosts. The present paper describes the bioinformatic identification of several barley and non-barley miRNA/miRNA^* sequences that were shown, through database mining and computational prediction, to have potential to interact with B/CYDV genome.

A total of 5,000 mature miRNA sequences were used in the study. These miRNAs belong to three groups: (a) Group I, consisting of 71 mature barley miRNAs (hvu-miRs), was collected from miRBase ²² (http://www.mirbase.org/cgi-bin/query.pl?terms=hvu&submit=Search); (b) Group II was initially made of 2,441 mature miRNAs from 15 MIR families, conserved among 67 plant species, among which barley. From this preliminary set, twelve hvu-miRs already contained in group I were excluded, keeping 2,429 mature miRNAs in group II; and (c) Group III was built from 2,500 complement reverse miRNAs (miRNAs^*) belonging to groups I and II.

Using RNA hybrid software version 2.2 (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html) ²³, a total of 19 sequences were shown to target B/CYDV viral ORFs. These miRNAs/miRNAs^*, their binding positions and targets are described in Table 1. Thirteen out of 19 sequences belonged to barley (hvu-miRNAs/miRNAs^*), three to A. thaliana, two to rice, and a unique miRNA^* sequence to Lotus japonicus. Among this identified set, eight miRNAs were barley-specific miRNAs (group I), eight were miRNAs conserved across several plant genomes (group II) and three were miRNAs^* (group III). The targeted regions were associated with replication (ORF1), RNA-dependent RNA polymerase (ORF2), coat protein (ORF3), viral transmission (ORF3-ORF5) and movement protein (ORF4-ORF5) ⁶. In strain BYDV-PAV genome, eleven miRNAs and two

Table 1
miRNAs/miRNAs^* and their candidate targets in the B/CYDV genome and the barley transcriptome (DFCI barley contigs, Release 12).

No.	miRNA/miRNA*		B/CYDV target			Barley transcriptome best expectation target
	miRBase ID (accession no.)	5'-3' sequence	Isolate/genomic region	Alignment start position	Barley DFCI accession	Target annotation	Expect-ation	Inhibition mode
1†	osa-miR166a-5p (MIMAT0022855)	GGAAUGUUGUCUGGUUCAAGG	RPV/ORF1	1077	-	-	-	-
2†	hvu-miR168-5p (MIMAT0018215)	UCGCUUGGUGCAGAUCGGGAC	PAV-III/ORF3,4	3096	NP315934	Flame chlorosis virus-like agent [Hordeum vulgare]	3.0	Translation
3†	hvu-miR169 (MIMAT0018218)	AAGCCAAGGAUGAGUUGCCUG	PAV-I/ORF3,4	3072	TC242386	Similar to UniRef100_Q0DX39; Oryza sativa Japonica Group (Rice)	0.0	Cleavage
4†	hvu-miR171-5p (MIMAT0022971)	UGUUGGCUCGACUCACUCAGA	PAV-I/ORF1	343	-	-	-	-
5†	ath-miR172a (MIMAT0000203)	AGAAUCUUGAUGAUGCUGCAU	PAV-I/ORF5 PAV-II/ORF5 PAV-III/ORF5	3664 3664 3647	TC278536	Similar to UniRef 100_Q0DL60 Cluster: Os05g0121600 protein; Oryza sativa Japonica Group	0.5	Cleavage
6†	ath-miR390b-5p (MIMAT0000932)	AAGCUCAGGAGGGAUAGCGCC	PAV-I/ORF3,4 PAV-II/ORF3,4	3217 3217	-	-	-	-
7†	osa-miR393a (MIMAT0000957)	UCCAAAGGGAUCGCAUUGAUC	MAV/ORF5	4190	-	-	-	-
8†	ath-miR394a (MIMAT0000936)	UUGGCAUUCUGUCCACCUCC	PAV-III/ORF1 MAV/NC	367 5252	TC240366	Similar to UniRef100_Q0JGH1; Oryza sativa Japonica Group (Rice)	0.0	Cleavage
9‡	hvu-miR5048a (MIMAT0020544)	UAUUUGCAGGUUUUAGGUCUAA	MAV/ORF5	4744	TC250387	Similar to UniRef100_Q0ITC3; Oryza sativa Japonica Group (Rice)	0.0	Cleavage
10‡	hvu-miR5049b (MIMAT0024797)	AGUAUUUAGGUACAGAGGGAG	PAV-II/NC	5501	-	-	-	-
11‡	hvu-miR6177 (MIMAT0024800)	UACCAUGGACAGAAGGCACUUA	PAV-II/ORF2 MAV/ORF2	1751 1715	-	-	-	-
12‡	hvu-miR6182 (MIMAT0024806)	UGAGUGUGUGAUGGAUGGCUUU	MAV/ORF2	923	-	-	-	-
13‡	hvu-miR6196 (MIMAT0024822)	AGGACGAGGAGAUGGAGAGGA	PAV-II/ORF2	2703	-	-	-	-
14‡	hvu-miR6199 (MIMAT0024825)	CCACAGAAUUCUCACAGUGAUGG	RPV/ORF2	3210	-	-	-	-
15‡	hvu-miR6211 (MIMAT0024839)	CAGAUCAAGACGCUCCGGCA	PAV-III/ORF1	379	-	-	-	-
16‡	hvu-miR6214 (MIMAT0024842)	CGACGACGACGAGCACGACA	PAV-I/ORF2	2373	-	-	-	-
17*	hvu-miR166a* (MIMAT0018213)	UCGGACCAGGCUUCAUUCCCC	MAV/ORF1	391	CV063912	Weakly similar to UniRef100_A7R0J5; Vitis vinifera (Grape)	3.0	Cleavage
18*	lja-miR171d-3p* (MIMAT0029317)	GCGAUGUUGGUGAGGUUCAAUC	PAV-II/ORF5 PAV-III/ORF5	4365 4342	-	-	-	-
19*	hvu-miR6177* (MIMAT0024800)	GCAAGUGCUUUCAUGUCCAUGGGU	PAV-I/ORF5	4497	-	-	-	-

• ORF: Open Reading Frame; NC: Non coding genome; ^†: conserved miRNAs (group II), ^‡: barley-specific miRNAs (group I) ; ^*: microRNA^* sequences (group III).

miRNAs* were predicted to target all ORFs except ORF6. In strain BYDV-MAV genome, only three ORFs (ORF1, ORF2 and ORF5) had putative miRNAs/miRNAs^* counterparts. Finally, in strain CYDV-RPV genome, only two miRNAs, osa-miR166a-5p and hvu-miR6199, were able to target ORF1 and ORF 2 of this strain, respectively. The identification of three miRNA^* species with potential to silence ORFs of B/CYDV, provides a valuable support to the hypothesized role of miRNAs^* in host defense ^14,20,24. In animals, it has been demonstrated that certain miRNAs^* can be functionally active ^25,26. If such a mechanism operates in plants, we expect that the present study will broaden our understanding of miRNAs^* as potential contributors to host-pathogen interactions.

Using psRNATarget software (http://plantgrn.noble.org/psRNATarget/), predicted targets of miRNAs/miRNAs^* were obtained from H. vulgare Expressed Sequence Tags (ESTs, DFCI gene index). Results showed that among 19 miRNA/miRNA^* sequences identified by RNA hybrid analysis, six, namely hvu-miR168-5p, hvu-miR169, ath-miR172a, ath-miR394a, hvu-miR5048a, and hvu-miR166a^*, had also potential targets among barley ESTs (Table 1). Among these, hvu-miR168-5p showed complementarities with NP315934, a barley EST corresponding to flame chlorosis virus-like agent. Flame chlorosis (FC) is a soil-borne virus-like disease of cereals, associated with a double-stranded linear RNA, containing at least one ORF ²⁷. Based on this, we speculate that miR168 plays an important role through its hybridization potential to viral/virus-like genomes (e.g. B/CYDV and FC).

In conclusion, results of our study suggest that at least 16 miRNAs and three miRNAs^*, here reported, would play a regulatory role in conferring barley/cereals resistance to B/CYDV infection. Future research focuses will encompass the expression profiling and mechanistic investigation of this role, as well as the establishment of a balance between barley yield and antiviral defense.

ACKNOWLEDGEMENTS

This study was financially supported by the Tunisian Ministry of Higher Education and Scientific Research.

REFERENCES

• ¹
  Oswald JW, Houston BR. A new virus disease of cereals transmissible by aphids. Plant Dis. 1951; 15: 471-475
• ²
  Miller WA, Waterhouse PM, Gerlach WL. Sequence and organization of barley yellow dwarf virus genomic RNA. Nucl Acids Res. 1988; 16: 6097-6112.
• ³
  Paul CP, Barry JK, Dinesh-Kumar SP, Brault V, Miller WA. A sequence required for -1 ribosomal frameshifting located four kilobases downstream of the frameshift site. J Mol Biol. 2001; 310: 987-999.
• ⁴
  Gildow FE. Luteovirus transmission and mechanisms regulating vector specificity. In: Smith HG, Barker H, editors. The Luteoviridae. Oxon, CAB International; 1999. p. 88-113.
• ⁵
  Chay C, Smith DM, Vaughan R and Gray SM. Diversity among isolates within the PAV serotype of barley yellow dwarf virus. Phytopathol. 1996; 86: 370-377.
• ⁶
  King AMQ, Adams MJ, Lefkowitz EJ and Carstens EB. Virus taxonomy: classification and nomenclature of viruses. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, editors. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, San Diego, USA; 2012.
• ⁷
  Van der Wilk F, Houterman P, Molthoff J, Hans F, Dekker B, van den Heuvel J, Huttinga H, Goldbach R. Expression of the potato leafroll virus ORF0 induces viral-disease-like symptoms in transgenic potato plants. Mol Plant Microbe Interact. 1997; 10: 153-159.
• ⁸
  Van der Wilk F, Verbeek M, Dullemans AM and van den Heuvel JF. The genome-linked protein of potato leafroll virus is located downstream of the putative protease domain of the ORF1 product. Virol. 1997; 234: 300-303.
• ⁹
  Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JD. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science. 2006; 312: 436-439.
• ¹⁰
  Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP. Prediction of plant microRNA targets. Cell. 2002; 110: 513-520.
• ¹¹
  Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116: 281-297.
• ¹²
  Nikovics K, Blein T, Peaucelle A, Ishida T, Morin H, Aida M, Laufs P. The balance between the MIR164A and CUC2 genes controls leaf margin serration in Arabidopsis. Plant Cell. 2006; 18: 2929-2945.
• ¹³
  Li F, Ding SW. Virus counterdefense: Diverse strategies for evading the RNA-silencing immunity. Ann Rev Microbiol. 2006; 60: 503-531.
• ¹⁴
  Kim HJ, Baek KH, Lee BW, Choi D, Hur CG. In silico identification and characterization of microRNAs and their putative target genes in Solanaceae plants. Genome. 2011; 54: 91-98.
• ¹⁵
  Guo W, Wu G, Yan F, Lu Y, Zheng H, Lin L, Chen H, Chen J. Identification of Novel Oryza sativa miRNAs in Deep Sequencing-Based Small RNA Libraries of Rice Infected with Rice Stripe Virus. PLoS One. 2012; 7: e46443. doi: 10.1371/journal.pone.0046443.
  » https://doi.org/10.1371/journal.pone.0046443
• ¹⁶
  Shuzuo L, Xiaojun N, Le W, Xianghong D, Siddanagouda SB, Xiaoou J, Song W. Identification and Characterization of MicroRNAs from Barley (Hordeum vulgare L.) by High-Throughput Sequencing. Int J Mol Sci. 2012; 13: 2973-2984.
• ¹⁷
  Colaiacovo M, Subacchi A, Bagnaresi P, Lamontanara A, Cattivelli L, Faccioli P. A computational-based update on microRNAs and their targets in barley (Hordeum vulgare L.). BMC Genomics. 2010; 11: 595.
• ¹⁸
  Katiyar A, Smita S, Chinnusamy V, Pandey DM, Bansal KC. Identification of miRNAs in sorghum by using bioinformatics approach. Plant Signal Behav. 2012; 7: 246-259.
• ¹⁹
  O'Toole AS, Miller S, Haines N, Zink MC, Serra MJ. Comprehensive thermodynamic analysis of 3' double-nucleotide overhangs neighboring Watson-Crick terminal base pairs. Nucl Acids Res. 2006; 34: 3338-3344.
• ²⁰
  Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV, Carrington JC. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev. 2004; 18: 1179-1186.
• ²¹
  Naqvi AR, Choudhury NR, Mukherjee SK, Haq QM. In silico analysis reveals that several tomato microRNA/microRNA* sequences exhibit propensity to bind to tomato leaf curl virus (ToLCV) associated genomes and most of their encoded open reading frames (ORFs). Plant Physiol Biochem. 2011; 49: 13-17.
• ²²
  Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucl Acids Res. 2008; 36 Database: 154-158.
• ²³
  Rehmsmeier M, Steffen P, Hoechsmann M, Giegerich R. Fast and effective prediction of microRNA/target duplexes RNA. RNA. 2004; 10: 1507-1517.
• ²⁴
  Okamura K, Phillips MD, Tyler DM, Duan H, Chou Y, Lai EC. The regulatory activity of microRNA* species has substantial influence on microRNA and 3' UTR evolution. Nature Struct Mol Biol. 2008; 15: 354-363.
• ²⁵
  Ghildiyal M, Xu J, Seitz H, Weng Z, Zamore PD. Sorting of Drosophila small silencing RNAs partitions microRNA* strands into the RNA interference pathway. RNA. 2010; 16: 43-56.
• ²⁶
  Guo L, Lu Z. The fate of miRNA* strand through evolutionary analysis: implication for degradation as merely carrier strand or potential regulatory molecule? PLoS ONE. 2010; 5: e11387. doi:10.1371/journal.pone.0011387.
  » https://doi.org/10.1371/journal.pone.0011387
• ²⁷
  Haber S, Rymerson RT, Procunier JD. Diagnosis of flame chlorosis by Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Plant Dis. 1995; 79: 626-630.

Publication Dates

• Publication in this collection
  01 Dec 2016
• Date of issue
  Jan-Dec 2016

History

• Received
  09 June 2016
• Accepted
  22 June 2016