SciELO - Scientific Electronic Library Online

 
vol.55 issue5Impact of a minimum program of supervised exercises in the cardiometabolic risk in patients with morbid obesityConservative management of pituitary tumor apoplexy author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivos Brasileiros de Endocrinologia & Metabologia

On-line version ISSN 1677-9487

Arq Bras Endocrinol Metab vol.55 no.5 São Paulo June 2011

https://doi.org/10.1590/S0004-27302011000500007 

ARTIGO ORIGINAL

 

Efeito da triiodotironina na expressão das proteínas ósseas durante a diferenciação osteogênica de células-tronco mesenquimais

 

Effect of triiodothyronine on the bone proteins expression during osteogenic differentiation of mesenchymal stem cells

 

 

Rafaela C. R. HellI; Jankerle N. BoeloniI; Natália M. OcarinoI; Juneo F. SilvaI; Alfredo M. GoesII; Rogéria SerakidesI

INúcleo de Células-tronco e Terapia Celular, Departamento de Clínica e Cirurgia Veterinárias, Escola de Veterinária da Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG, Brasil
IILaboratório de Imunologia Celular e Biologia Molecular, Departamento de Bioquímica e Imunologia, Instituto de Ciências Biológicas, UFMG, Belo Horizonte, MG, Brasil

Correspondência para

 

 


RESUMO

OBJETIVO: O objetivo deste estudo foi avaliar o efeito da T3 na expressão da osteocalcina, osteo­pontina e colágeno I durante a diferenciação osteogênica das células-tronco mesenquimais (CTM).
MATERIAIS E MÉTODOS: As células da medula óssea de ratas Wistar jovens foram extraídas, cultivadas e separadas em cinco grupos: controle (indiferenciado), diferenciado (estímulo osteogênico) e diferenciado com T3 (10-3 nM, 10-2 nM e 100 nM). Para cada grupo, foram cultivadas quatro amostras que foram analisadas por RT-PCR tempo real aos 7, 14 e 21 dias, para quantificação dos transcritos gênicos para osteocalcina, osteopontina e colágeno I.
RESULTADOS: Todos os grupos diferenciados sem T3 ou com T3 independentemente da concentração apresentaram expressão de colágeno I significativamente menor e expressão de osteocalcina e osteopontina significativamente maior em comparação a das CTM indiferenciadas. Mas o grupo T3 100 nM apresentou concentração de osteocalcina mais elevada e semelhante à da cultura de osteoblastos.
CONCLUSÃO: Conclui-se que a triiodotironina não altera a expressão de osteopontina e de colágeno pelas CTM, mas aumenta a expressão da osteocalcina durante a diferenciação osteogênica in vitro, sendo esse efeito dose-dependente.

Descritores: Célula-tronco; diferenciação osteogênica; triiodotironina; proteínas ósseas


ABSTRACT

OBJECTIVE: The aim of this study was to evaluate the effect of T3 on the expression of osteocalcin, osteopontin and collagen I during osteogenic differentiation of mesenchymal stem cells (MSC).
MATERIALS AND METHODS: The bone marrow cells of Wistar rats with 30 days of age were extracted, cultured and separated into five groups: control (undifferentiated), differentiated (osteogenic stimulus) and differentiated with T3 (10-3 nM, 10-2 nM and 100 nM). For each group, four samples were cultured and were analyzed by real time RT-PCR at 7, 14 and 21 days for quantification of gene transcripts for osteocalcin, osteopontin and collagen I.
RESULTS: All the different groups without T3 or with T3 regardless of the concentration, showed the collagen I expression significantly lower expression, and osteocalcin and osteopontin expression significantly greater than that of undifferentiated MSC. Nevertheless, the group T3 100 nM showed higher expression of osteocalcin and a similar expression of the osteoblast culture.
CONCLUSION: In conclusion, the triiodothyronine does not affect the expression of osteopontin and collagen I, but increases ostecalcin expression during osteogenic differentiation in vitro of the MSC, and this effect is dose-dependent.

Keywords: Stem cell; osteogenic differentiation; triiodothyronine; bone proteins


 

 

INTRODUÇÃO

Durante o processo de diferenciação das células osteoprogenitoras, que são células mais evoluídas que as células-tronco, a expressão de colágeno I, fosfatase alcalina, osteonectina, sialoproteína óssea, osteocalcina e osteopontina é identificada como um marcador do estágio de diferenciação osteogênica (1).

A osteopontina, por estar presente nas periferias da matriz óssea neoformada, é importante iniciadora do processo de mineralização óssea, sendo, portanto, um marcador precoce da diferenciação osteogênica, também prevenindo a precipitação prematura dos cristais de fosfato de cálcio na matriz colagênica. Já a osteocalcina é encontrada mais tardiamente no processo de diferenciação celular, sendo importante na progressão da mineralização (2) e no controle da formação dos cristais de hidroxiapatita (3).

A triiodotironina (T3) e a tiroxina (T4) estimulam a expressão de genes nos osteoblastos para a produção principalmente de osteocalcina (4-6) e colágeno (7), importantes para a síntese e mineralização da matriz óssea (8). No entanto, não há pesquisas sobre a influência de T3 e T4 na expressão de mRNA para as proteínas da matriz óssea durante o processo de diferenciação osteogênica das células-tronco mesenquimais (CTM).

Inúmeras pesquisas já demonstraram o efeito in vitro dos hormônios tireoidianos sobre a atividade de síntese dos osteoblastos (4,6,9-11). Mas, por ser o osteoblasto uma célula que deriva da diferenciação osteogênica das CTM da medula óssea, nossa hipótese é de que os hormônios tireoidianos possam estimular a diferenciação osteogênica in vitro das CTM por aumentar a expressão de mRNA para as proteínas da matriz óssea. O efeito da T3 na diferenciação osteogênica das CTM somente foi pesquisado recentemente, mas sem, no entanto, estudar o efeito desse hormônio na expressão das proteínas responsáveis pela mineralização da matriz óssea (12).

A importância de se estudar estratégias, como o uso de T3, para tentar aumentar in vitro a diferenciação osteogênica das CTM, antes de sua inoculação para o tratamento de doenças ou defeitos ósseos, tem a intenção de maximizar os efeitos da terapia celular. Por isso, o objetivo deste estudo foi avaliar os efeitos de diferentes doses de T3 na expressão de mRNA para as proteínas não colagênicas e colagênicas da matriz óssea durante a diferenciação osteogênica in vitro das CTM.

 

MATERIAIS E MÉTODOS

Extração e cultivo das CTM

A extração e o cultivo de células-tronco foram realizados de acordo com protocolos já padronizados e previamente publicados (12,13). Foram utilizadas CTM de oito ratas Wistar com 30 dias de idade que foram eutanasiadas por punção cardíaca, após anestesia, sendo esse procedimento aprovado pelo Comitê de Ética em Experimentação Animal da UFMG (protocolo nº 134/2008). Os ossos longos (fêmur e tíbia bilaterais) foram dissecados de tecidos musculares e conectivos adjacentes e as epífises foram retiradas, de forma asséptica, para obtenção da medula óssea da diáfise. No fluxo laminar, a medula óssea foi lavada com Dulbecco's Modified Eagle Médium (DMEM - Gibco, Grand Island, NY, USA) enriquecido com gentamicina, penicilina (10.000 μg/mL), estreptomicina (1.000 μg/mL) e anfotericina (25 μg/mL) (Sigma-Aldrich, St. Louis, MO, USA). Após centrifugação por 10 minutos a 1.400 rpm, as células foram cultivadas em garrafas T75 contendo DMEM enriquecido com antibióticos e antimicóticos e 10% de soro fetal bovino em estufa a 37ºC e 5% de CO2. Após 24 horas, as células foram lavadas com PBS (solução tampão de fosfato padrão) para remoção das células não aderidas. O meio de cultivo foi trocado duas vezes por semana. Após quatro repiques e até que se obtivesse a confluência de 80% a 90% das células, realizou-se a caracterização fenotípica das células por citometria de fluxo.

Caracterização fenotípica das CTM

Para a realização da caracterização fenotípica, as células foram tripsinizadas, contadas em câmara de Neubauer e distribuídas em placas de 96 poços com concentração de 1x106 células/poço. Em seguida, foram centrifugadas por 10 minutos a 1.400 rpm e 10ºC e incubadas com anticorpo primário (1:50) por 30 minutos a 4ºC. As células foram lavadas com PBS 0,15M, centrifugadas por 10 minutos a 1.400 rpm e 10ºC e incubadas com anticorpo secundário (1:200) por 30 minutos a 4ºC. As células foram lavadas novamente com PBS 0,15M, centrifugadas por 10 minutos a 1.400 rpm e 10ºC e fixadas em formaldeído a 4%. A leitura e as análises foram realizadas em um citômetro de fluxo FACScan (Fluorescence Activated Cell Analyser) (Becton Dickinson Immunocytometry, San Jose, CA, USA) empregando o software Cell Quest (The Cell QuestTM Software, Becton Dickinson Dicknson Immunocytometry Systems, San Jose, CA, USA), com aquisição de 20.000 eventos, tendo como parâmetros FSC (Forward scatter) e SSC (Side scatter) em escala linear e FL1 (fluorescência relativa) em escala logarítmica que detecta luz de comprimento de onda de 530 nm, que corresponde a fluorescência verde, para análises pelo programa WinMDI por gráficos de dot plot e histogramas. Os anticorpos primários utilizados foram: anti-CD45, anti-CD90, anti-CD73 e anti-CD54 (BD Biosciences, San Jose, CA USA).

Diferenciação osteogênica das CTM e quantificação relativa da expressão das proteínas ósseas

Após o cultivo em DMEM, quatro passagens e obtenção de confluência de 80% a 90% das células, o meio foi substituído por meio osteogênico enriquecido com ácido ascórbico (50 μmg/mL), ß-glicerofosfato (10 μM) (Sigma-Aldrich, St. Louis, MO, USA) e dexametasona (0,1 μM), acrescido de 10% de soro fetal bovino. As células foram mantidas em estufa a 37ºC e 5% de CO2. As células foram cultivadas, em quadruplicata, em garrafas T25 com diferentes doses de 3,3',5-triiodo-L-tironina (Sigma-Aldrich, St. Louis, MO, USA), 100, 10-2 e 10-3 nM, em três períodos de tempo (7, 14 e 21 dias). As doses de T3 foram estabelecidas conforme estudo anterior (12). Assim, foram constituídos quatro grupos: 1) 100 nM de T3, 2) 10-2 nM de T3, 3) 10-3 nM de T3 e 4) controle (sem T3). As CTM de cada grupo foram cultivadas por sete, 14 e 21 dias. Como controle positivo, foram utilizados osteoblastos extraídos da calvária de ratos neonatos e cultivados em Rosewell Park Memorial Institute medium (RPMI - Gibco, Grand Island, NY, USA) de acordo com protocolos preestabelecidos (14,15).

A quantificação relativa da expressão de colágeno I, osteocalcina e osteopontina foi realizada pela técnica de RT-PCR em tempo real. A extração do RNA total das células foi feita em quatro garrafas T25 por grupo pelo uso do Trizol (Invitrogen, USA) conforme instruções do fabricante. A concentração de RNA de cada grupo foi determinada pela leitura da absorbância a 260/280 nm por espectrofotometria. Foram realizadas as reações de transcrição reversa utilizando-se Kit comercial (SuperScriptTM III Platinum® Two-Step qRT-PCR Kit with SYBR Green, Invitrogen, CA, USA), sendo que se utilizou 1 μg de RNA total para a síntese de cDNA com um volume final de 20 μL. Realizaram-se ainda as reações de RT-PCR em tempo real utilizando-se 2 μg de cDNA, 5 pM de cada iniciador e 12,5 μL do reagente syber Green em um volume final de 25 μL de reação, no aparelho SmartCycler System (SmartCycler® System, Cepheid, Sunnyvale, CA, USA). Os parâmetros utilizados para amplificação foram: 50°C por 120 segundos, 95°C por 150 segundos e 45 ciclos de 95°C por 15 segundos e 60°C por 30 segundos. Os iniciadores foram delineados com base na sequência do mRNA rattus norvergicus e foram os seguintes: osteocalcina (Oc) foward-5'CATCTATGGCACCACCGTTT3', reverse-5'AGAGAGAGGGAACAGGGAGG3'; osteopontina (Osp) foward-5'ATCTCACCATTCCG ATGAATCT3', reverse-5'TCAGTCCATAAGCCAAGCTATCA3'; colágeno I (Col1) foward-5'GCAAGGTGTTGTGCGATGACG3', reverse-5'GGGAGACCACGAGGAC CAGAG3' e Gapdh foward-5'CAACTCCCTCAAGATTGTCAGCAA3', reverse-5'GGCATGGACTGTGGTCATGA3'. A expressão gênica foi calculada usando o método 2-∆∆CT, em que os resultados obtidos para cada grupo foram comparados quantitativamente após a normalização baseada na expressão de gliceraldeído-3-fosfato desidrogenase (GAPDH) rattus norvergicus.

O delineamento foi inteiramente ao acaso com fatorial 4x3 (quatro grupos e três períodos). Realizou-se análise de variância (ANOVA) e, para cada variável, foram determinados a média e o desvio-padrão. As alterações na expressão medidas pelo RT-PCR em tempo real foram comparadas pelo teste de Student Newman-Keuls (SNK) pós-transformação logarítmica dos dados. Diferenças foram consideradas significativas se p < 0,05.

 

RESULTADOS

As células da medula óssea das ratas apresentaram expressão de CD45, CD90, CD73 e CD54 em 3,06%, 86,77%, 93,99% e 95,10% das células, respectivamente (Figura 1).

Todos os grupos de CTM diferenciadas sem T3 ou com T3 independentemente da concentração apresentaram expressão de colágeno I significativamente menor em comparação ao das CTM indiferenciadas (Figura 2).

 

 

No entanto, a expressão de osteopontina e osteocalcina pelas CTM diferenciadas sempre foi significativamente maior em comparação a das CTM indiferenciadas, o que comprova a diferenciação osteogênica, uma vez que o osteoblasto também apresenta maior expressão dessas proteínas em relação às células indiferenciadas (Figuras 3 e 4).

 

 

 

A expressão de osteopontina nas CTM diferenciadas (com ou sem T3) foi bem mais elevada que a dos osteoblastos em todos os períodos estudados. Mas a expressão de osteopontina não sofreu alteração significativa com o tratamento hormonal (Figura 3).

No entanto, a expressão de osteocalcina, embora mais elevada nas CTM diferenciadas em relação às CTM indiferenciadas, sempre foi menor que a do osteoblasto com exceção das CTM que foram tratadas com T3 na concentração de 100 nM que apresentaram expressão de osteocalcina significativamente mais elevada aos 21 dias, igualando-se a expressão dos osteoblastos (Figura 4).

 

DISCUSSÃO

A caracterização fenotípica das células antes da diferenciação é fundamental para informar sobre o grau de pureza da cultura, pois a medula óssea pode apresentar CTM, células hematopoéticas (16,17) e fibroblastos (18). As células hematopoéticas expressam, entre outras moléculas, CD45 (17), que também pode ser expressa em fibroblastos (18). A molécula CD73 pode ser expressa tanto em fibroblastos (17) quanto em CTM (18). Mas as moléculas CD90 e CD54 expressas em mais de 90% das células deste estudo são expressas nas CTM, não sendo expressas em fibroblastos e em células hematopoéticas (17,19,20). O resultado da caracterização fenotípica das células deste estudo está de acordo com as características de CTM propostas pelo Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy (21).

Proteínas não colagênicas como a osteopontina e a osteocalcina, entre outras, apresentam papel importante na diferenciação osteogênica e na atividade das células ósseas, bem como na maturação e mineralização da matriz óssea (22). Tanto a expressão de osteopontina quanto a de osteocalcina foram significativamente mais elevadas nas CTM diferenciadas em relação às CTM indiferenciadas, o que confirma a diferenciação osteogênica, além da produção de nódulos de mineralização que somente foi observada na cultura das CTM diferenciadas (dados não demonstrados). Neste estudo, embora a expressão de osteopontina não tenha se alterado com o tratamento hormonal, o tratamento com T3 na concentração de 100 nM elevou significativamente a concentração de osteocalcina aos 21 dias a ponto de igualá-la à expressão dos osteoblastos. Boeloni e cols. (12) observaram que todas as doses utilizadas neste estudo elevaram significativamente a síntese de nódulos de mineralização quando comparada a cultura de CTM não tratada com T3, mas sem, no entanto, mencionar seu efeito sobre a expressão das proteínas ósseas não colagênicas. Pode-se afirmar que a adição de T3 em culturas de CTM é eficiente para incrementar a diferenciação osteogênica e que a adição de 100 nM de T3 é a melhor escolha para o cultivo antes do uso da CTM em defeitos ou doenças ósseas, pois, além de aumentar o número de nódulos de mineralização (12), aumenta também a expressão de osteocalcina. Possivelmente, o aumento do número de nódulos de mineralização observados por Boeloni e cols. (12) seja decorrente desse aumento da osteocalcina, uma vez que essa proteína é considerada a mais importante no processo de mineralização e é encontrada mais tardiamente no processo de diferenciação osteogênica (2). Semelhantemente ao observado neste estudo com CTM, a T3 também estimula a expressão de genes para a produção principalmente de osteocalcina em osteoblastos (4-6).

Embora grande parte da matriz óssea seja constituí­da por colágeno I, na cultura de CTM diferenciadas, grande parte dessa matriz colagênica encontra-se mineralizada e por isso a expressão de colágeno I foi maior nas CTM indiferenciadas quando comparada a cultura das CTM diferenciadas, independentemente do tratamento hormonal. A expressão de colágeno na cultura de osteoblastos, que se apresenta totalmente diferenciada, também foi menor aos sete e 21 dias em comparação a das CTM indiferenciadas, o que reforça ainda mais essa assertiva. Mas, além disso, a expressão de colágeno I também diminui com a diferenciação das CTM (23).

Conclui-se que a triiodotironina não altera a expressão de osteopontina e de colágeno I nas CTM da medula óssea, mas aumenta a expressão da osteocalcina durante a diferenciação osteogênica in vitro, sendo esse efeito dose-dependente.

Agradecimentos: ao apoio financeiro concedido pela Fundação de Amparo à Pesquisa de Minas Gerais (Fapemig) e Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

Declaração: os autores declaram não haver conflitos de interesse científico neste estudo.

 

REFERÊNCIAS

1. Liu F, Malaval L, Aubin EJ. Global amplification polymerase chain reaction reveals novel transitional stages during osteoprogenitor differentiation. J Cell Sci. 2003;116:1787-96.         [ Links ]

2. Roach HI. Why does bone matrix contain non-collegenous protein? The possible roles of osteocalcin, osteonectin, osteopontin and bone sialoprotein in bone mineralization and reabsorption. Cell Biol Int. 1994;18:617-28.         [ Links ]

3. Doi Y, Horigushi T, Kim SH, Moriwaki Y, Wakamatsu N, Adachi M, et al. Effects of non-collagenous proteins of the formation of apatite in Ca-b-glycerophosphate solution. Arch Oral Biol. 1992;37:15-21.         [ Links ]

4. Varga F, Rumpler M, Luegmayr E, Fratzl-Zelman N, Glantshnig H, Klaushofer K. Triiodothyronine, a regulator of osteoblastic differentiation: depression of histone H4, attenuation of c-fos/c-fun, and induction of osteocalcin expression. Calcif Tissue Int. 1997;61:404-11.         [ Links ]

5. Varga F, Spitzer S, Klaushofer K. Triiodothyronine (T3) and 1,25-dihydroxyvitamin D3 (1,25D3) inversely regulate OPG gene expression in dependence of the osteoblastic phenotype. Calcif Tissue Int. 2004;74:382-7.         [ Links ]

6. Gouveia CH, Schultz JJ, Bianco AC, Brent GA. Thyroid hormone stimulation of osteocalcin gene expression in ROS 17/2.8 cells is mediated by transcriptional and post-transcriptional mechanisms. J Endocrinol. 2001;170:667-75.         [ Links ]

7. Klaushofer K, Varga F, Glantschnig H, Fratzl-Zelman N, Czerwenka E, Leis HJ, et al. The regulatory role of thyroid hormones in bone cell growth and differentiation. J Nutr. 1995;125:1996S-2003S.         [ Links ]

8. Huang BK, Golden LA, Tarjan G, Madison LD, Stern PH. Insulin-like growth factor I production is essential for anabolic effects of thyroid hormone in osteoblasts. J Bone Miner Res. 2000;15:188-97.         [ Links ]

9. Ohishi K, Ishida H, Nagata T, Yamauchi N, Tsurumi C, Nishikawa S, et al. Thyroid hormone suppresses the differentiation of osteoprogenitor cells to osteoblasts, but enhances functional activities of mature osteoblasts in cultured rat calvaria cells. J Cell Physiol. 1994;161:544-52.         [ Links ]

10. Fratzl-Zelman N, Hörandner H, Luegmayr E, Varga F, Ellinger A, Erlee MP, et al. Effects of triiodothyronine on the morphology of cells and matrix, the localization of alkaline phosphatase, and the frequency of apoptosis in long-term cultures of MC3T3-E1 cells. Bone. 1997;20:225-36.         [ Links ]

11. Rumpler M, Woesz A, Varga F, Manjubala I, Klaushofer K, Fratzl P, et al. Three-dimensional growth behavior of osteoblasts on biomimetic hydroxylapatite scaffolds. J Biomed Mater Res A. 2007;81:40-50.         [ Links ]

12. Boeloni JN, Ocarino NM, Melo AB, Silva JF, Castanheira P, Goes AM, et al. Dose-dependent effects of triiodothyronine on the osteogenic differentiation of rat bone marrow mesenchymal stem cells. Horm Res. 2009;72:88-97.         [ Links ]

13. Ocarino NM, Boeloni JN, Goes AM, Silva JF, Marubayashi U, Serakides R. Osteogenic differentiation of mesenchymal stem cells from osteopenic rats subjected to physical activity with and without nitric oxide synthase inhibition. Nitric Oxide. 2008;19:320-5.         [ Links ]

14. Andrade AL, Valério P, Goes AM, Leite MF, Domingues RZ. Influence of recovering collagen with bioactive glass on osteoblast behavior. J Biomed Mater Res B Appl Biomater. 2007;83:481-9.         [ Links ]

15. Valério P, Pereira MM, Goes AM, Leite MF. BG60S dissolution interferes with osteoblast calcium signals. J Mater Sci Mater Med. 2007;18:265-71.         [ Links ]

16. Bianco P, Riminucci SG, Gronthos S, Robey PG. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 2001;19:180-92.         [ Links ]

17. Bobis S, Jarocha D, Majka M. Mesenchymal stem cells: characteristics and clinical applications. Folia Histochem Cytobiol. 2006;44(4):215-30.         [ Links ]

18. Ishii M, Koike C, Igarashi A, Yamanaka K, Pan H, Higashi Y, et al. Molecular markers distinguish bone marrow mesenchymal stem cells from fibroblasts. Biochem Biophys Res Commun. 2005;332:297-303.         [ Links ]

19. Covas DT, Siufi JL, Silva AR, Orellana, MD. Isolation and culture of umbilical vein mesenchymal stem cells. Braz J Med Biol Res. 2003;36:1179-83.         [ Links ]

20. Tocci A, Forte L. Mesenchymal stem cells: use and perspectives. Hematol J. 2003;4:92-6.         [ Links ]

21. Schäffler A, Büchler C. Concise review: adipose tissue-derived stromal cells - basic and clinical implications for novel cell-based therapies. Stem Cells. 2007;25:818-27.         [ Links ]

22. Nefussi JR, Brami G, Modrowski D, Oboeuf M, Forest N. Sequential expression of bone matrix proteins during rat calvaria osteoblast differentiation and bone nodule formation in vitro. J Hitochem Citochem. 1997;45:493-503.         [ Links ]

23. Granchi D, Ochoa G, Leonard E, Devescovi V, Baglio SR, Osaba L, et al. Gene expression patterns related to osteogenic differentiation of bone marrow-derived mesenchymal stem cells during ex vivo expansion. Tissue Eng Part C. 2010;16:511-24.         [ Links ]

 

 

Correspondência para:
Rogéria Serakides
Núcleo de Células-tronco e Terapia Celular, Departamento de Clínica e Cirurgia Veterinárias, Escola de Veterinária, UFMG
Av. Presidente Antônio Carlos, 6627
30161-970 - Belo Horizonte, MG, Brasil
serakidesufmg@gmail.com

Recebido em 24/Fev/2010
Aceito em 25/Maio/2011

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License