Abstracts
Objective
The aim of this study was to investigate the association between the rs7903146 (C/T) polymorphism in the TCF7L2 gene and type 2 diabetes mellitus, in a Southern-Brazilian population.
Materials and methods
The TCF7L2 rs7903146 polymorphism was genotyped in 953 type 2 diabetic patients and 535 non-diabetic subjects. All subjects were white. The polymorphism was genotyped by Real-Time PCR using TaqMan MGB probes (Life Technologies). Odds ratios (OR) and 95% confidence intervals (CI) were calculated for additive, recessive and dominant inheritance models.
Results
Genotype and allele frequencies of the rs7903146 polymorphism differed significantly between type 2 diabetic patients and non-diabetic subjects (P = 0.001 and P = 0.0001, respectively). The frequency of the minor allele was 38% in type 2 diabetes group and 31% in non-diabetic subjects, and this allele was significantly associated with type 2 diabetes risk (OR = 1.42, 95% CI 1.15 – 1.76 for the dominant model of inheritance). Moreover, the T/T genotype was associated with a higher risk for type 2 diabetes (OR = 1.83, 95% CI 1.3-2.5) than the presence of only one copy of the T allele (OR = 1.31, 95% CI 1.1-1.6). Both results were adjusted for age and gender.
Conclusions
Our results confirm the association between the TCF7L2 rs7903146 polymorphism and increase risk for type 2 diabetes in Southern-Brazil. Arq Bras Endocrinol Metab. 2014;58(9):918-25
Single nucleotide polymorphism; type 2 diabetes mellitus; transcription factor 7-like 2 (TCF7L2)
Objetivo
O objetivo deste estudo foi investigar a associação entre o polimorfismo rs7903146 (C/T) no gene TCF7L2 e o diabetes melito tipo 2 em uma população do sul do Brasil.
Materiais e métodos
O polimorfismo rs7903146 (C/T) no gene TCF7L2 foi genotipado em 953 pacientes com diabetes melito tipo 2 e em 535 indivíduos não diabéticos. Todos os indivíduos estudados eram brancos. O polimorfismo foi genotipado por meio da técnica de PCR em tempo real, utilizando sondas TaqMan MGB (Life Technologies). A razão de chances e o intervalo de confiança de 95% foram calculados para os modelos de herança: aditivo, recessivo e dominante.
Resultados
As frequências genotípicas e alélicas do polimorfismo rs7903146 diferiram significativamente entre os pacientes com diabetes melito tipo 2 e indivíduos não diabéticos (P = 0,001 e P = 0,0001, respectivamente). A frequência do menor alelo foi 38% no grupo dos pacientes com diabetes melito tipo 2 e 31% no grupo dos indivíduos não diabéticos, sendo esse alelo significativamente associado com risco para o diabetes melito tipo 2 (RC = 1,42; IC 95% 1,15 – 1,76 para o modelo de herança dominante). Do mesmo modo, o genótipo T/T foi associado com risco maior para o diabetes melito tipo 2 (RC = 1,83; IC 95% 1,3 – 2,5) do que a presença de apenas uma cópia do alelo T (RC = 1,31; IC 95% 1,1 – 1,6). Ambos os resultados foram ajustados para idade e gênero.
Conclusões
Nossos resultados confirmam a associação entre o polimorfismo rs7903146 no gene TCF7L2 e o risco para o diabetes melito tipo 2 em uma população do sul do Brasil. Arq Bras Endocrinol Metab. 2014;58(9):918-25
Diabetes melito tipo 2; polimorfismos de DNA; fator de transcrição 7-like 2 (TCF7L2)
INTRODUCTION
Type 2 diabetes mellitus (T2DM) is a heterogeneous group of disorders usually characterized by the incapability of pancreatic beta cells to increase insulin secretion to compensate the insulin resistance in peripheral tissues (11 Stumvoll M, Goldstein B, van Haeften T. Type 2 diabetes: principles of pathogenesis and therapy. Lancet. 2005;365(9467):1333-46.). T2DM is a multifactorial disease, and the susceptibility to it is determined by several genetic and environmental factors, in an orchestrated manner (22 Vimaleswaran KS, Loos RJ. Progress in the genetics of common obesity and type 2 diabetes. Expert Rev Mol Med. 2010;12:e7.). The most likely explanation for the remarkable increase in T2DM prevalence observed over the past decades is changing patterns of diet, as well as lack of physical activity practice. However, it is supposed that these lifestyle changes may lead to T2DM, but only in the presence of genetic risk factors for this condition (22 Vimaleswaran KS, Loos RJ. Progress in the genetics of common obesity and type 2 diabetes. Expert Rev Mol Med. 2010;12:e7.). For that reason, great effort has been made in an endeavor to identify genes associated with T2DM, and many loci associated with this disease have been uncovered by genetic association studies and genome-wide association scan (GWAS).
In this scenario, in early 2006, a large scale GWAS study reported that some single
nucleotide polymorphisms (SNPs) in the TCF7L2 gene were strongly
associated with risk to T2DM in an Iceland case-control sample (33 Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu
A, Sainz J, et al. Variant of transcription factor 7-like 2 (TCF7L2) gene
confers risk of type 2 diabetes. Nat Genet. 2006;38(3):320-3.). The results presented in this study were
substantial, with each additional copy of the risk allele being associated with an
odds ratio (OR) of 1.5, and with an outstanding P value of 7.8 x 10-15
(33 Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu
A, Sainz J, et al. Variant of transcription factor 7-like 2 (TCF7L2) gene
confers risk of type 2 diabetes. Nat Genet. 2006;38(3):320-3.). Afterwards, this association has been
replicated by numerous groups among different ethnicities, also with very low P
values [reviewed in (44 Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr
Metab Care. 2007;10(4):391-6.)]. Up to now, all of
these studies firmly establish TCF7L2 gene as the strongest genetic
risk factor for T2DM (44 Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr
Metab Care. 2007;10(4):391-6.
5 Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between
TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a
large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet.
2009;10:15.
6 Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms
and type 2 diabetes risk: a comprehensive and updated meta-analysis involving
121,174 subjects. Mutagenesis. 2013;28(1):25-37.
7 Dou H, Ma E, Yin L, Jin Y, Wang H. The association between gene
polymorphism of TCF7L2 and type 2 diabetes in Chinese Han population: a
meta-analysis. PLoS One. 2013;8(3):e59495.-88 Wang J, Hu F, Feng T, Zhao J, Yin L, Li L, et al. Meta-analysis of
associations between TCF7L2 polymorphisms and risk of type 2 diabetes mellitus
in the Chinese population. BMC Med Genet. 2013;14:8.). Amongst the TCF7L2 variants, two intronic
SNPs (rs12255372 and rs7903146) are the most closely associated with T2DM, and
although both have showed a significant linkage disequilibrium (LD), the rs7903146
(C/T) variant seems to have the strongest effect in Caucasian populations (44 Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr
Metab Care. 2007;10(4):391-6.,99 Ip W, Chiang YT, Jin T. The involvement of the wnt signaling pathway
and TCF7L2 in diabetes mellitus: The current understanding, dispute, and
perspective. Cell Biosci. 2012;2(1):28.).
The TCF7L2 gene encodes a transcription factor involved in the Wnt
signaling pathway, which plays an important role in pancreatic islet development and
adipogenesis (1010 Prestwich TC, Macdougald OA. Wnt/beta-catenin signaling in
adipogenesis and metabolism. Curr Opin Cell Biol.
2007;19(6):612-7.). TCF7L2 forms heterodimers
with b-catenin, inducing the expression of various genes, including the
insulinotropic hormone glucagon-like peptide 1 (GLP-1) gene, the
insulin gene, and other genes that encode proteins involved in
processing and exocytose of insulin granules (99 Ip W, Chiang YT, Jin T. The involvement of the wnt signaling pathway
and TCF7L2 in diabetes mellitus: The current understanding, dispute, and
perspective. Cell Biosci. 2012;2(1):28.,1111 da Silva Xavier G, Loder MK, McDonald A, Tarasov AI, Carzaniga R,
Kronenberger K, et al. TCF7L2 regulates late events in insulin secretion from
pancreatic islet beta-cells. Diabetes. 2009;58(4):894-905.
12 Loder MK, da Silva Xavier G, McDonald A, Rutter GA. TCF7L2 controls
insulin gene expression and insulin secretion in mature pancreatic beta-cells.
Biochem Soc Trans. 2008;36(Pt 3):357-9.-1313 Yi F, Brubaker PL, Jin T. TCF-4 mediates cell type-specific
regulation of proglucagon gene expression by beta-catenin and glycogen synthase
kinase-3beta. J Biol Chem. 2005;280(2):1457-64.). As GLP-1 and insulin play a key role in blood glucose
homeostasis, it was hypothesized that TCF7L2 variants may modify
T2DM susceptibility by indirectly reducing GLP-1 secretion from enteroendocrine
cells (1414 Smith U. TCF7L2 and type 2 diabetes--we WNT to know. Diabetologia.
2007;50(1):5-7.). On the other hand, as the Wnt
pathway seems to be important for pancreas development during embryonic growth, it
is also possible that the beta-cell mass, pancreatic beta-cell development and/or
beta-cell function are also affected by this pathway (1515 Weedon MN. The importance of TCF7L2. Diabetic Medicine.
2007;24(10):1062-6.). However, the exact molecular mechanism underlying the
association of TCF7L2 polymorphisms with T2DM remains to be
enlightened (1515 Weedon MN. The importance of TCF7L2. Diabetic Medicine.
2007;24(10):1062-6.,1616 Schäfer SA, Machicao F, Fritsche A, Häring HU, Kantartzis K. New
type 2 diabetes risk genes provide new insights in insulin secretion mechanisms.
Diabetes Res Clin Pract. 2011;93 Suppl 1:S9-24.).
Because the frequency of the TCF7L2 rs7903146 T allele has been
shown variable among different populations (1717 Ezzidi I, Mtiraoui N, Cauchi S, Vaillant E, Dechaume A, Chaieb M, et
al. Contribution of type 2 diabetes associated loci in the Arabic population
from Tunisia: a case-control study. BMC Med Genet. 2009;10:33.
18 Gonzalez-Sanchez JL, Martinez-Larrad MT, Zabena C, Perez-Barba M,
Serrano-Rios M. Association of variants of the TCF7L2 gene with increases in the
risk of type 2 diabetes and the proinsulin:insulin ratio in the Spanish
population. Diabetologia. 2008;51(11):1993-7.
19 Cauchi S, Meyre D, Dina C, Choquet H, Samson C, Gallina S, et al.
Transcription factor TCF7L2 genetic study in the French population: expression
in human beta-cells and adipose tissue and strong association with type 2
diabetes. Diabetes. 2006;55(10):2903-8.
20 Wen J, Ronn T, Olsson A, Yang Z, Lu B, Du Y, et al. Investigation of
type 2 diabetes risk alleles support CDKN2A/B, CDKAL1, and TCF7L2 as
susceptibility genes in a Han Chinese cohort. PLoS One.
2010;5(2):e9153.
21 Chang YC, Chang TJ, Jiang YD, Kuo SS, Lee KC, Chiu KC, et al.
Association study of the genetic polymorphisms of the transcription factor
7-like 2 (TCF7L2) gene and type 2 diabetes in the Chinese population. Diabetes.
2007;56(10):2631-7.
22 Franco LF, Crispim F, Pereira AC, Moises RS. Variants of
transcription factor 7-like 2 (TCF7L2) gene and incident glucose intolerance in
Japanese-Brazilians. Braz J Med Biol Res. 2011;44(3):240-4.-2323 Barra GB, Dutra LA, Watanabe SC, Costa PG, Cruz PS, Azevedo MF, et
al. Association of the rs7903146 single nucleotide polymorphism at the
Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian
subjects. Arq Bras Endocrinol Metabol. 2012;56(8):479-84.), which could influence the
effect of this SNP on T2DM susceptibility, in the present study, we investigated the
potential association of the TCF7L2 rs7903146 (C/T) polymorphism
with T2DM, in white Brazilian subjects. In addition, the genetic association of this
SNP with T2DM has not yet been studied in Southern Brazil.
MATERIALS AND METHODS
Subjects
A total of 1,488 unrelated subjects were enrolled in this case-control study. The diabetic sample comprised 953 T2DM patients participating in a multicentre study that began recruiting patients in Southern Brazil in 2002. That project was originally designed to study risk factors associated with T2DM and its chronic complications. It included four Centers in teaching hospitals located in the Brazilian state of Rio Grande do Sul. A detailed description of that study can be found elsewhere (2424 Canani L, Capp C, Ng D, Choo S, Maia A, Nabinger G, et al. The fatty acid-binding protein-2 A54T polymorphism is associated with renal disease in patients with type 2 diabetes. Diabetes. 2005;54(11):3326-30.). T2DM was diagnosed according to the American Diabetes Association criteria (2525 American Diabetes Association. Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 2013; 35(Suppl. 1):S64-S71.). The main characteristics of the T2DM patients were as follows: mean age was 59.3 ± 10.7 years, mean T2DM duration was 12.5 ± 9.5 years, mean age at T2DM diagnosis was 46.3 ± 11.4 years, mean glycated hemoglobin (HbA1c) was 7.7 ± 1.7%, and mean body mass index (BMI) was 28.7 ± 5.1 kg/m2. Males comprised 51.0% of the sample, 71.0% of all patients had arterial hypertension (AH), and 34.2% had obesity.
The non-diabetic group comprised 535 healthy volunteers attending the blood donation facility at Hospital de Clínicas de Porto Alegre (Porto Alegre, Brazil; mean age = 44.0 ± 7.8 years; males = 51.0%). None of these subjects reported presence of diabetes or a family history of this disease. All subjects had Caucasian ancestry (mostly of Portuguese, Spanish, Italian and German descent), and were self defined as white.
A standard questionnaire was used to collect information regarding age, age at T2DM diagnosis, and drug treatment. All T2DM patients underwent physical examination and laboratory evaluations, as previously reported (2626 Bouças AP, Brondani LA, Souza BM, Lemos NE, de Oliveira FS, Canani LH, et al. The A allele of the rs1990760 polymorphism in the IFIH1 gene is associated with protection for arterial hypertension in type 1 diabetic patients and with expression of this gene in human mononuclear cells. PLoS One. 2013;8(12):e83451.). BMI was calculated as weight (kg)/height square (meters). Presence of obesity was defined as BMI ≥ 30 kg/m2. Office blood pressure (BP) was measured in sitting position, on the left arm, after a 5-min rest by a trained researcher, with a mercury sphygmomanometer. The mean of two measurements taken 1 min apart was used to calculate systolic and diastolic BP. Arterial hypertension (AH) was defined as BP levels higher than 140/90 mmHg at the initial visit and at two follow-up visits within 1 month of the initial visit, or if the presence of AH was previously registered on medical records.
Serum and plasma from T2DM patients were taken after a 12 hours of fasting for laboratory analyses (2626 Bouças AP, Brondani LA, Souza BM, Lemos NE, de Oliveira FS, Canani LH, et al. The A allele of the rs1990760 polymorphism in the IFIH1 gene is associated with protection for arterial hypertension in type 1 diabetic patients and with expression of this gene in human mononuclear cells. PLoS One. 2013;8(12):e83451.). Plasma glucose levels were determined using the glucose oxidase method. HbA1c measurements were performed by different methods and results were traceable to the Diabetes Control and Complications Trial (DCCT) method by off-line calibration or through conversion formulae (2727 Camargo JL, Zelmanovitz T, Paggi A, Friedman R, Gross JL. Accuracy of conversion formulae for estimation of glycohaemoglobin. Scand J Clin Lab Invest. 1998;58(6):521-8.). Total plasma cholesterol, HDL cholesterol and triglycerides were assayed using enzymatic methods.
The information obtained from the study did not influence patients’ diagnosis or treatment. The study protocol was approved by the Ethic Committee in Research from Hospital de Clínicas de Porto Alegre and all patients and non-diabetic subjects provided written informed consent.
Genotyping
DNA was extracted from peripheral blood leucocytes by a standardized salting-out procedure (2828 Lahiri DN, Urnberger J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991;19(19):5444.). TCF7L2 rs7903146 (C/T) SNP was genotyped using primers and probes contained in the 40x Human Custom TaqMan Genotyping Assay (Life Technologies, Foster City, CA, USA), as previously reported (2929 de Souza BM, Assmann TS, Kliemann LM, Marcon AS, Gross JL, Canani LH, et al. The presence of the -866A/55Val/Ins haplotype in the uncoupling protein 2 (UCP2) gene is associated with decreased UCP2 gene expression in human retina. Exp Eye Res. 2012;94(1):49-55.). Sequences of primers and probes were: TCF7L2-5’CCTCAAAACCTAGCACAGCTGTTAT3’ (forward primer), TCF7L2-5’ TGAAAACTAAGGGTGCCTCATACG3’ (reverse primer), TCF7L2-FAM-5’ AAGCACTTTTTAGATATTATAT3’; TCF7L2-VIC-5’ CTAAGCACTTTTTAGATACTATAT3’. Reactions were conducted in 96-well plates, in a total of 5 mL volume using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Life Technologies) and Custom TaqMan Genotyping Assay 1x. Plates were then loaded in a real-time PCR thermal cycler (7500 Fast Real PCR System; Life Technologies) and heated for 10 min at 95ºC, followed by 50 cycles of 95ºC for 15s and 62ºC for 1 min. The genotyping success rate was better than 95%, with a calculated error based on PCR duplicates of less than 1%.
Statistical analyses
Allelic frequencies were determined by gene counting and departures from the Hardy–Weinberg equilibrium (HWE) were verified using c2 tests. Clinical and laboratory characteristics were compared between groups by using One-way ANOVA, unpaired Student’s t test or c2, as appropriate. Variables with normal distribution are presented as mean ± SD or percentage. Variables with skewed distribution were log-transformed before analyses and are shown as median (range).
The magnitude of associations of the TCF7L2 rs7903146 SNP with T2DM were estimated using odds ratio (OR) with 95% confidence interval (CI). Multivariate logistic regression analyses were performed to assess the independent association of this SNP with T2DM, adjusting for age and gender. Moreover, in T2DM patients, logistic regression analysis was also performed using obesity as a dependent variable and age and gender as independent variables. Associations between the rs7903146 SNP and T2DM characteristics (continuous variables) were tested using general linear model (GLM) analyses, adjusting for covariates.
Results for which the P value was under 0.05 were considered statistically significant. Bonferroni correction was used to account for multiple comparisons. These statistical analyses were performed using SPSS version 18.0 (SPSS, Chicago, IL). Power calculations were done using the software PEPI, version 4.0, and showed that this study has a power of approximately 80% at a significance level of 0.05 to detect an OR of 1.4 or higher, for the presence of the minor allele.
RESULTS
Genotype and allele frequencies of rs7903146 (C/T) SNP in T2DM patients and non-diabetic subjects are shown in table 1. All genotypes were in agreement with those predicted by the HWE in non-diabetic subjects (P = 0.208). Both genotype and allele frequencies of the rs7903146 SNP were differently distributed between T2DM and non-diabetic subjects after Bonferroni corrections (P = 0.001 and P = 0.0001, respectively). Genotype frequencies of the rs7903146 SNP remained significantly associated with T2DM after adjustment for age and gender (Table 1). In agreement with this data, the T allele was significantly associated with risk for T2DM under a dominant model of inheritance, adjusting for age and gender (OR = 1.42, 95% CI 1.15 – 1.76; P = 0.001). Moreover, homozygosis for the T allele was associated with a higher risk for T2DM (OR = 1.83, 95% CI 1.3-2.5, P = 0.001) than the presence of only one copy of this allele (OR = 1.31, 95% CI 1.1 – 1.6; P = 0.017), adjusting for age and gender.
Table 2 summarizes the clinical and laboratory data for T2DM patients according to the different genotypes of the rs7903146 SNP. There were no significant differences among the three rs7903146 SNP genotypes in terms of systolic and diastolic BP, BMI, total cholesterol, HDL cholesterol, LDL cholesterol, HbA1c, fasting plasma glucose or triglyceride levels, and prevalence of diabetic retinopathy or diabetic nephropathy, adjusting for covariables. It is worth mentioning that none of these variables attained statistical significance irrespective of whether recessive (C/C - C/T vs. T/T), dominant (C/C vs. C/T - T/T) or additive (C/C vs. T/T) models of inheritance were assumed for the T allele (data not shown).
DISCUSSION
TCF7L2 gene is considered one of the most important candidate genes for T2DM, playing a key role in blood-glucose homeostasis and beta-cell function (3030 Uma Jyothi K, Jayaraj M, Subburaj KS, Prasad KJ, Kumuda I, Lakshmi V, et al. Association of TCF7L2 gene polymorphisms with T2DM in the population of Hyderabad, India. PLoS One. 2013;8(4):e60212.). Following the initial report by Grant and cols. (33 Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, et al. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006;38(3):320-3.) showing that TCF7L2 variants were strongly associated with T2DM risk, several other studies consistently replicated this association in different ethnicities [reviewed in (44 Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr Metab Care. 2007;10(4):391-6.)]. Among the TCF7L2 variants, the rs7903146 (C/T) SNP seems to have the more robust effect in Caucasian populations (44 Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr Metab Care. 2007;10(4):391-6.,99 Ip W, Chiang YT, Jin T. The involvement of the wnt signaling pathway and TCF7L2 in diabetes mellitus: The current understanding, dispute, and perspective. Cell Biosci. 2012;2(1):28.). Here, we successfully replicated the association between the TCF7L2 rs7903146 SNP and risk for T2DM in Caucasian-Brazilian subjects from Southern of Brazil, probably under an additive inheritance model given that the risk conferred by the T/T genotype was higher than that conferred by heterozygous genotype.
The consistency in the data showing the association between TCF7L2
gene variants and risk for T2DM reported by many studies in different populations is
believed to be a reliable indicative of a universal contribution of this gene to
T2DM development (3131 Cauchi S, El Achhab Y, Choquet H, Dina C, Krempler F, Weitgasser R,
et al. TCF7L2 is reproducibly associated with type 2 diabetes in various ethnic
groups: a global meta-analysis. J Mol Med (Berl).
2007;85(7):777-82.), even though some
studies have reported weak or no association with the disease, mainly in Asian
populations (2121 Chang YC, Chang TJ, Jiang YD, Kuo SS, Lee KC, Chiu KC, et al.
Association study of the genetic polymorphisms of the transcription factor
7-like 2 (TCF7L2) gene and type 2 diabetes in the Chinese population. Diabetes.
2007;56(10):2631-7.,3232 Guo T, Hanson RL, Traurig M, Muller YL, Ma L, Mack J, et al. TCF7L2
is not a major susceptibility gene for type 2 diabetes in Pima Indians: analysis
of 3,501 individuals. Diabetes. 2007;56(12):3082-8.
33 Kifagi C, Makni K, Boudawara M, Mnif F, Hamza N, Abid M, et al.
Association of genetic variations in TCF7L2, SLC30A8, HHEX, LOC387761, and EXT2
with Type 2 diabetes mellitus in Tunisia. Genet Test Mol Biomarkers.
2011;15(6):399-405.
34 Park SE, Lee WY, Oh KW, Baek KH, Yoon KH, Kang MI, et al. Impact of
common type 2 diabetes risk gene variants on future type 2 diabetes in the
non-diabetic population in Korea. J Hum Genet.
2012;57(4):265-8.-3535 Zheng X, Ren W, Zhang S, Liu J, Li S, Li J, et al. Association of
type 2 diabetes susceptibility genes (TCF7L2, SLC30A8, PCSK1 and PCSK2) and
proinsulin conversion in a Chinese population. Mol Biol Rep.
2012;39(1):17-23.). Thus, to date,
around 10 meta-analyses evaluated the pooled effect of TCF7L2
rs7903146 SNP in T2DM risk (55 Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between
TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a
large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet.
2009;10:15.
6 Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms
and type 2 diabetes risk: a comprehensive and updated meta-analysis involving
121,174 subjects. Mutagenesis. 2013;28(1):25-37.
7 Dou H, Ma E, Yin L, Jin Y, Wang H. The association between gene
polymorphism of TCF7L2 and type 2 diabetes in Chinese Han population: a
meta-analysis. PLoS One. 2013;8(3):e59495.-88 Wang J, Hu F, Feng T, Zhao J, Yin L, Li L, et al. Meta-analysis of
associations between TCF7L2 polymorphisms and risk of type 2 diabetes mellitus
in the Chinese population. BMC Med Genet. 2013;14:8.,3131 Cauchi S, El Achhab Y, Choquet H, Dina C, Krempler F, Weitgasser R,
et al. TCF7L2 is reproducibly associated with type 2 diabetes in various ethnic
groups: a global meta-analysis. J Mol Med (Berl).
2007;85(7):777-82.,3636 Luo Y, Wang H, Han X, Ren Q, Wang F, Zhang X, et al. Meta-analysis
of the association between SNPs in TCF7L2 and type 2 diabetes in East Asian
population. Diabetes Res Clin Pract. 2009;85(2):139-46.
37 Takeuchi M, Okamoto K, Takagi T, Ishii H. Ethnic difference in
patients with type 2 diabetes mellitus in inter-East Asian populations: a
systematic review and meta-analysis focusing on gene polymorphism. J Diabetes.
2009;1(4):255-62.
38 Berhouma R, Kouidhi S, Ammar M, Abid H, Baroudi T, Ennafaa H, et al.
Genetic susceptibility to type 2 diabetes: a global meta-analysis studying the
genetic differences in Tunisian populations. Hum Biol.
2012;84(4):423-35.
39 Wang J, Li L, Zhang J, Xie J, Luo X, Yu D, et al. Association of
rs7903146 (IVS3C/T) and rs290487 (IVS3C/T) polymorphisms in TCF7L2 with type 2
diabetes in 9,619 Han Chinese population. PLoS One.
2013;8(3):e59053.-4040 Song Y, Yeung E, Liu A, Vanderweele TJ, Chen L, Lu C, et al.
Pancreatic beta-cell function and type 2 diabetes risk: quantify the causal
effect using a Mendelian randomization approach based on meta-analyses. Hum Mol
Genet. 2012;21(22):5010-8.).
In 2009, Tong and cols. (55 Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet. 2009;10:15.) published a large meta-analysis of 36 genetic association studies examining the association of T2DM with four TCF7L2 polymorphisms (rs7903146, rs7901695, rs12255372 and rs11196205), totalizing 39,123 controls and 35,843 cases from different ethnicities. Results from the overall meta-analysis of the rs7903146 SNP showed that heterozygous carried just over a 1.4-fold increased risk for T2DM, while T/T homozygous carried near a 2.0-fold increase in T2DM risk, when compared with C/C homozygous. Moreover, the authors computed attributable risk (PAR) for the T/T-T/C genotypes of 16.9% for overall, 23.2% for Caucasians, 14.1% for North Europeans, 2.5% for East Asians, 17.9% for Indians, and 27.0% for Africans, suggesting that this polymorphism may contribute with approximately 1/5 of all T2DM risk in the globe, except for East Asians. The other three analyzed TCF7L2 variants were also significantly associated with T2DM risk in different ethnicities, and the authors suggested that the rs7903143 and rs12255372 can be taken as reference loci for exploring T2DM susceptibility since they were associated with the highest pooled OR (55 Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet. 2009;10:15.).
In 2012, the meta-analysis of Song and cols. (4040 Song Y, Yeung E, Liu A, Vanderweele TJ, Chen L, Lu C, et al. Pancreatic beta-cell function and type 2 diabetes risk: quantify the causal effect using a Mendelian randomization approach based on meta-analyses. Hum Mol Genet. 2012;21(22):5010-8.) also confirmed the association of the rs7903146 SNPs with T2DM in 66 studies (OR = 1.41, 95% CI 1.37-1.46 for the T allele). Overall, they observed significant differences in the T allele frequencies of this SNP across different populations: this allele was quite common (0.16-0.48%) in all Caucasians, Africans and Hispanics except for Pima Indians, but less frequent (0.02-0.04) in all East Asian populations. Despite these differences in the frequencies of the rs7903146 SNP, they found similar association results across diverse ethnic groups. These authors also quantified the associations of the rs7903146 SNP with measures of beta-cell function among 35,052 non-diabetic subjects from 31 studies. In general, T allele carriers had significantly lower levels of fasting insulin and homeostasis model assessment of insulin secretion (HOMA-%B) and higher fasting glucose and 2h post-load glucose levels when compared to C/C homozygous.
Recently, Peng and cols. (66 Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms and type 2 diabetes risk: a comprehensive and updated meta-analysis involving 121,174 subjects. Mutagenesis. 2013;28(1):25-37.) conducted a comprehensive and updated meta-analysis regarding the association between TCF7L2 variants and T2DM. Eight TCF7L2 polymorphisms in 155 studies with 121,174 subjects (53,385 cases and 67,789 controls) were addressed in their meta-analysis. Significant associations were found between T2DM risk and rs7903146, rs12255372, rs11196205, rs7901695, rs7895340 and rs4506565 SNPs under an additive inheritance model. The highest pooled ORs were found for the rs7903146, rs12255372 and rs4506565 SNPs (OR = 1.39, 95% CI 1.34-1.45; OR = 1.33, 95% CI 1.27-1.40; and OR = 1.39, 95% CI 1.29-1.49; respectively), all of them in strong LD with each other across various populations. Subgroups analyses showed that no significant associations were found between the analyzed SNPs and T2DM in some ethnic groups as, for example, in American Pima Indians (66 Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms and type 2 diabetes risk: a comprehensive and updated meta-analysis involving 121,174 subjects. Mutagenesis. 2013;28(1):25-37.), showing the necessity of evaluating TCF7L2 in different populations and ethnicities.
Three previous Brazilian studies have evaluated the association between the TCF7L2 rs7903146 SNP and T2DM. Marquezine and cols. (4141 Marquezine GF, Pereira AC, Sousa AG, Mill JG, Hueb WA, Krieger JE. TCF7L2 variant genotypes and type 2 diabetes risk in Brazil: significant association, but not a significant tool for risk stratification in the general population. BMC Med Genet. 2008;9:106.) evaluated the effect of the rs7903146 SNP on diabetes risk in 560 subjects with known coronary disease enrolled in the MASS II Trial and also in 1,449 residents from Vitoria, in Southeast Brazil. They confirmed the association between the rs7903146 SNP and T2DM risk (OR = 1.57 per T allele, 95% CI 1.16-2.11), but the inclusion of this SNP in an established clinical risk prediction score did not increase model accuracy. Franco and cols. (2222 Franco LF, Crispim F, Pereira AC, Moises RS. Variants of transcription factor 7-like 2 (TCF7L2) gene and incident glucose intolerance in Japanese-Brazilians. Braz J Med Biol Res. 2011;44(3):240-4.) assessed whether the rs7903146 SNP could predict the development of glucose intolerance in Japanese-Brazilians in a population-based 7-year prospective study. In their study population, the T allele frequency was only 5%. No significant association was found between this SNP and glucose intolerance incidence; however, C/T genotype carriers had significantly lower insulin levels 2h after a 75-g glucose load than carriers of the C/C genotype. Barra and cols. (2323 Barra GB, Dutra LA, Watanabe SC, Costa PG, Cruz PS, Azevedo MF, et al. Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects. Arq Bras Endocrinol Metabol. 2012;56(8):479-84.) reported that the T/T genotype was significantly associated with T2DM risk (OR = 3.92, 95% CI 1.49-10.3 for the recessive model) in a small sample from the population of Brasilia, in the Central Western region of Brazil. Although they analyzed a sample of mixed ethnicity, the frequency of the T allele in their study was similar to that presented here.
The underlying mechanisms of action of TCF7L2 variants in the etiology of T2DM is still uncertain given that all the TCF7L2 SNPs identified so far are located in the intronic regions. Interestingly, none of the variants found in TCF7L2 exons were associated with T2DM (3030 Uma Jyothi K, Jayaraj M, Subburaj KS, Prasad KJ, Kumuda I, Lakshmi V, et al. Association of TCF7L2 gene polymorphisms with T2DM in the population of Hyderabad, India. PLoS One. 2013;8(4):e60212.). Thus, it is necessary to clarify how the intronic variants affect TCF7L2 gene expression. In this context, Lyssenko and cols. (4242 Lyssenko V, Lupi R, Marchetti P, Del Guerra S, Orho-Melander M, Almgren P, et al. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest. 2007;117(8):2155-63.) found that rs7903146 T allele carriers exhibited a significant elevation of TCF7L2 mRNA expression in human pancreatic islets, which was associated with impaired insulin secretion and incretin effects. Moreover, T allele carriers had enhanced rates of hepatic glucose production (4242 Lyssenko V, Lupi R, Marchetti P, Del Guerra S, Orho-Melander M, Almgren P, et al. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest. 2007;117(8):2155-63.). Gaulton and cols. (4343 Gaulton KJ, Nammo T, Pasquali L, Simon JM, Giresi PG, Fogarty MP, et al. A map of open chromatin in human pancreatic islets. Nat Genet. 2010;42(3):255-9.) reported that in human islets the chromatin state at the TCF7L2 locus is more open in chromosomes carrying the rs7903146 T allele. They also created allele-specific luciferase reporter constructs and measured enhancer activity in two beta-cell lines (MIN6 and 832/13). Interestingly, T allele constructs showed significantly greater enhancer activity than the C allele. The authors concluded that the T allele affects T2DM susceptibility by altering cis regulation and local chromatin structure in human pancreatic islets. Palmer and cols. (4444 Palmer ND, Hester JM, An SS, Adeyemo A, Rotimi C, Langefeld CD, et al. Resequencing and analysis of variation in the TCF7L2 gene in African Americans suggests that SNP rs7903146 is the causal diabetes susceptibility variant. Diabetes. 2011;60(2):662-8.), through evaluation of tagging SNPs, showed that T2DM risk was limited to a 4.3-kb region in the TCF7L2 gene, where is located the rs7903146 SNP. After sequencing this region in DNA from 96 African Americans, they reported that results of imputation, haplotype, and conditional analyses of the SNPs in this region were consistent with the rs7903146 SNP being the trait-defining variant. Thus, to date, both genetic and functional studies make a reliable case for a functional role for the rs7903146 SNP.
Some factors could have interfered with the findings of the present study. First, we
cannot rule out the possibility of population stratification bias when analyzing our
samples, even though only white subjects were studied and both T2DM patients and
non-diabetic subjects were recruited from the same hospital, thus reducing the risk
of false-positive/negative associations due to this bias. Second, we did not perform
a replication of the observed association in another sample from Southern Brazil,
although our data is in agreement with the majority of studies performed in
different populations (55 Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between
TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a
large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet.
2009;10:15.
6 Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms
and type 2 diabetes risk: a comprehensive and updated meta-analysis involving
121,174 subjects. Mutagenesis. 2013;28(1):25-37.
7 Dou H, Ma E, Yin L, Jin Y, Wang H. The association between gene
polymorphism of TCF7L2 and type 2 diabetes in Chinese Han population: a
meta-analysis. PLoS One. 2013;8(3):e59495.-88 Wang J, Hu F, Feng T, Zhao J, Yin L, Li L, et al. Meta-analysis of
associations between TCF7L2 polymorphisms and risk of type 2 diabetes mellitus
in the Chinese population. BMC Med Genet. 2013;14:8.,3131 Cauchi S, El Achhab Y, Choquet H, Dina C, Krempler F, Weitgasser R,
et al. TCF7L2 is reproducibly associated with type 2 diabetes in various ethnic
groups: a global meta-analysis. J Mol Med (Berl).
2007;85(7):777-82.,3636 Luo Y, Wang H, Han X, Ren Q, Wang F, Zhang X, et al. Meta-analysis
of the association between SNPs in TCF7L2 and type 2 diabetes in East Asian
population. Diabetes Res Clin Pract. 2009;85(2):139-46.
37 Takeuchi M, Okamoto K, Takagi T, Ishii H. Ethnic difference in
patients with type 2 diabetes mellitus in inter-East Asian populations: a
systematic review and meta-analysis focusing on gene polymorphism. J Diabetes.
2009;1(4):255-62.
38 Berhouma R, Kouidhi S, Ammar M, Abid H, Baroudi T, Ennafaa H, et al.
Genetic susceptibility to type 2 diabetes: a global meta-analysis studying the
genetic differences in Tunisian populations. Hum Biol.
2012;84(4):423-35.
39 Wang J, Li L, Zhang J, Xie J, Luo X, Yu D, et al. Association of
rs7903146 (IVS3C/T) and rs290487 (IVS3C/T) polymorphisms in TCF7L2 with type 2
diabetes in 9,619 Han Chinese population. PLoS One.
2013;8(3):e59053.-4040 Song Y, Yeung E, Liu A, Vanderweele TJ, Chen L, Lu C, et al.
Pancreatic beta-cell function and type 2 diabetes risk: quantify the causal
effect using a Mendelian randomization approach based on meta-analyses. Hum Mol
Genet. 2012;21(22):5010-8.)
and also with another Brazilian study (2323 Barra GB, Dutra LA, Watanabe SC, Costa PG, Cruz PS, Azevedo MF, et
al. Association of the rs7903146 single nucleotide polymorphism at the
Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian
subjects. Arq Bras Endocrinol Metabol. 2012;56(8):479-84.).
Third, we only analyzed one SNP in the TCF7L2 gene. Therefore, even
though the TCF7L2 rs7903146 SNP seems to be one of the
trait-defining variants (4444 Palmer ND, Hester JM, An SS, Adeyemo A, Rotimi C, Langefeld CD, et
al. Resequencing and analysis of variation in the TCF7L2 gene in African
Americans suggests that SNP rs7903146 is the causal diabetes susceptibility
variant. Diabetes. 2011;60(2):662-8.), we can not
exclude the possibility that another polymorphism in this gene could contribute to
the T2DM pathogenesis in our population. Fourth, the presence of diabetes in the
non-diabetic sample was only evaluated by questionnaire. Thus, a few number of
undiagnosed T2DM subjects could be present in the non-diabetic sample. However, this
is a conservative bias, which only could contribute to decrease the observed OR and
not to give a false-positive association.
In conclusion, in Southern Brazil, the TCF7L2 rs7903146 SNP is also associated with T2DM susceptibility. The risk conferred by the T/T genotype was higher than that of the heterozygous genotype, which is an indicative of an additive model of inheritance, and it is in agreement with the literature reported so far.
REFERENCES
-
1Stumvoll M, Goldstein B, van Haeften T. Type 2 diabetes: principles of pathogenesis and therapy. Lancet. 2005;365(9467):1333-46.
-
2Vimaleswaran KS, Loos RJ. Progress in the genetics of common obesity and type 2 diabetes. Expert Rev Mol Med. 2010;12:e7.
-
3Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, et al. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006;38(3):320-3.
-
4Florez JC. The new type 2 diabetes gene TCF7L2. Curr Opin Clin Nutr Metab Care. 2007;10(4):391-6.
-
5Tong Y, Lin Y, Zhang Y, Yang J, Liu H, Zhang B. Association between TCF7L2 gene polymorphisms and susceptibility to type 2 diabetes mellitus: a large Human Genome Epidemiology (HuGE) review and meta-analysis. BMC Med Genet. 2009;10:15.
-
6Peng S, Zhu Y, Lü B, Xu F, Li X, Lai M. TCF7L2 gene polymorphisms and type 2 diabetes risk: a comprehensive and updated meta-analysis involving 121,174 subjects. Mutagenesis. 2013;28(1):25-37.
-
7Dou H, Ma E, Yin L, Jin Y, Wang H. The association between gene polymorphism of TCF7L2 and type 2 diabetes in Chinese Han population: a meta-analysis. PLoS One. 2013;8(3):e59495.
-
8Wang J, Hu F, Feng T, Zhao J, Yin L, Li L, et al. Meta-analysis of associations between TCF7L2 polymorphisms and risk of type 2 diabetes mellitus in the Chinese population. BMC Med Genet. 2013;14:8.
-
9Ip W, Chiang YT, Jin T. The involvement of the wnt signaling pathway and TCF7L2 in diabetes mellitus: The current understanding, dispute, and perspective. Cell Biosci. 2012;2(1):28.
-
10Prestwich TC, Macdougald OA. Wnt/beta-catenin signaling in adipogenesis and metabolism. Curr Opin Cell Biol. 2007;19(6):612-7.
-
11da Silva Xavier G, Loder MK, McDonald A, Tarasov AI, Carzaniga R, Kronenberger K, et al. TCF7L2 regulates late events in insulin secretion from pancreatic islet beta-cells. Diabetes. 2009;58(4):894-905.
-
12Loder MK, da Silva Xavier G, McDonald A, Rutter GA. TCF7L2 controls insulin gene expression and insulin secretion in mature pancreatic beta-cells. Biochem Soc Trans. 2008;36(Pt 3):357-9.
-
13Yi F, Brubaker PL, Jin T. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by beta-catenin and glycogen synthase kinase-3beta. J Biol Chem. 2005;280(2):1457-64.
-
14Smith U. TCF7L2 and type 2 diabetes--we WNT to know. Diabetologia. 2007;50(1):5-7.
-
15Weedon MN. The importance of TCF7L2. Diabetic Medicine. 2007;24(10):1062-6.
-
16Schäfer SA, Machicao F, Fritsche A, Häring HU, Kantartzis K. New type 2 diabetes risk genes provide new insights in insulin secretion mechanisms. Diabetes Res Clin Pract. 2011;93 Suppl 1:S9-24.
-
17Ezzidi I, Mtiraoui N, Cauchi S, Vaillant E, Dechaume A, Chaieb M, et al. Contribution of type 2 diabetes associated loci in the Arabic population from Tunisia: a case-control study. BMC Med Genet. 2009;10:33.
-
18Gonzalez-Sanchez JL, Martinez-Larrad MT, Zabena C, Perez-Barba M, Serrano-Rios M. Association of variants of the TCF7L2 gene with increases in the risk of type 2 diabetes and the proinsulin:insulin ratio in the Spanish population. Diabetologia. 2008;51(11):1993-7.
-
19Cauchi S, Meyre D, Dina C, Choquet H, Samson C, Gallina S, et al. Transcription factor TCF7L2 genetic study in the French population: expression in human beta-cells and adipose tissue and strong association with type 2 diabetes. Diabetes. 2006;55(10):2903-8.
-
20Wen J, Ronn T, Olsson A, Yang Z, Lu B, Du Y, et al. Investigation of type 2 diabetes risk alleles support CDKN2A/B, CDKAL1, and TCF7L2 as susceptibility genes in a Han Chinese cohort. PLoS One. 2010;5(2):e9153.
-
21Chang YC, Chang TJ, Jiang YD, Kuo SS, Lee KC, Chiu KC, et al. Association study of the genetic polymorphisms of the transcription factor 7-like 2 (TCF7L2) gene and type 2 diabetes in the Chinese population. Diabetes. 2007;56(10):2631-7.
-
22Franco LF, Crispim F, Pereira AC, Moises RS. Variants of transcription factor 7-like 2 (TCF7L2) gene and incident glucose intolerance in Japanese-Brazilians. Braz J Med Biol Res. 2011;44(3):240-4.
-
23Barra GB, Dutra LA, Watanabe SC, Costa PG, Cruz PS, Azevedo MF, et al. Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects. Arq Bras Endocrinol Metabol. 2012;56(8):479-84.
-
24Canani L, Capp C, Ng D, Choo S, Maia A, Nabinger G, et al. The fatty acid-binding protein-2 A54T polymorphism is associated with renal disease in patients with type 2 diabetes. Diabetes. 2005;54(11):3326-30.
-
25American Diabetes Association. Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 2013; 35(Suppl. 1):S64-S71.
-
26Bouças AP, Brondani LA, Souza BM, Lemos NE, de Oliveira FS, Canani LH, et al. The A allele of the rs1990760 polymorphism in the IFIH1 gene is associated with protection for arterial hypertension in type 1 diabetic patients and with expression of this gene in human mononuclear cells. PLoS One. 2013;8(12):e83451.
-
27Camargo JL, Zelmanovitz T, Paggi A, Friedman R, Gross JL. Accuracy of conversion formulae for estimation of glycohaemoglobin. Scand J Clin Lab Invest. 1998;58(6):521-8.
-
28Lahiri DN, Urnberger J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991;19(19):5444.
-
29de Souza BM, Assmann TS, Kliemann LM, Marcon AS, Gross JL, Canani LH, et al. The presence of the -866A/55Val/Ins haplotype in the uncoupling protein 2 (UCP2) gene is associated with decreased UCP2 gene expression in human retina. Exp Eye Res. 2012;94(1):49-55.
-
30Uma Jyothi K, Jayaraj M, Subburaj KS, Prasad KJ, Kumuda I, Lakshmi V, et al. Association of TCF7L2 gene polymorphisms with T2DM in the population of Hyderabad, India. PLoS One. 2013;8(4):e60212.
-
31Cauchi S, El Achhab Y, Choquet H, Dina C, Krempler F, Weitgasser R, et al. TCF7L2 is reproducibly associated with type 2 diabetes in various ethnic groups: a global meta-analysis. J Mol Med (Berl). 2007;85(7):777-82.
-
32Guo T, Hanson RL, Traurig M, Muller YL, Ma L, Mack J, et al. TCF7L2 is not a major susceptibility gene for type 2 diabetes in Pima Indians: analysis of 3,501 individuals. Diabetes. 2007;56(12):3082-8.
-
33Kifagi C, Makni K, Boudawara M, Mnif F, Hamza N, Abid M, et al. Association of genetic variations in TCF7L2, SLC30A8, HHEX, LOC387761, and EXT2 with Type 2 diabetes mellitus in Tunisia. Genet Test Mol Biomarkers. 2011;15(6):399-405.
-
34Park SE, Lee WY, Oh KW, Baek KH, Yoon KH, Kang MI, et al. Impact of common type 2 diabetes risk gene variants on future type 2 diabetes in the non-diabetic population in Korea. J Hum Genet. 2012;57(4):265-8.
-
35Zheng X, Ren W, Zhang S, Liu J, Li S, Li J, et al. Association of type 2 diabetes susceptibility genes (TCF7L2, SLC30A8, PCSK1 and PCSK2) and proinsulin conversion in a Chinese population. Mol Biol Rep. 2012;39(1):17-23.
-
36Luo Y, Wang H, Han X, Ren Q, Wang F, Zhang X, et al. Meta-analysis of the association between SNPs in TCF7L2 and type 2 diabetes in East Asian population. Diabetes Res Clin Pract. 2009;85(2):139-46.
-
37Takeuchi M, Okamoto K, Takagi T, Ishii H. Ethnic difference in patients with type 2 diabetes mellitus in inter-East Asian populations: a systematic review and meta-analysis focusing on gene polymorphism. J Diabetes. 2009;1(4):255-62.
-
38Berhouma R, Kouidhi S, Ammar M, Abid H, Baroudi T, Ennafaa H, et al. Genetic susceptibility to type 2 diabetes: a global meta-analysis studying the genetic differences in Tunisian populations. Hum Biol. 2012;84(4):423-35.
-
39Wang J, Li L, Zhang J, Xie J, Luo X, Yu D, et al. Association of rs7903146 (IVS3C/T) and rs290487 (IVS3C/T) polymorphisms in TCF7L2 with type 2 diabetes in 9,619 Han Chinese population. PLoS One. 2013;8(3):e59053.
-
40Song Y, Yeung E, Liu A, Vanderweele TJ, Chen L, Lu C, et al. Pancreatic beta-cell function and type 2 diabetes risk: quantify the causal effect using a Mendelian randomization approach based on meta-analyses. Hum Mol Genet. 2012;21(22):5010-8.
-
41Marquezine GF, Pereira AC, Sousa AG, Mill JG, Hueb WA, Krieger JE. TCF7L2 variant genotypes and type 2 diabetes risk in Brazil: significant association, but not a significant tool for risk stratification in the general population. BMC Med Genet. 2008;9:106.
-
42Lyssenko V, Lupi R, Marchetti P, Del Guerra S, Orho-Melander M, Almgren P, et al. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. J Clin Invest. 2007;117(8):2155-63.
-
43Gaulton KJ, Nammo T, Pasquali L, Simon JM, Giresi PG, Fogarty MP, et al. A map of open chromatin in human pancreatic islets. Nat Genet. 2010;42(3):255-9.
-
44Palmer ND, Hester JM, An SS, Adeyemo A, Rotimi C, Langefeld CD, et al. Resequencing and analysis of variation in the TCF7L2 gene in African Americans suggests that SNP rs7903146 is the causal diabetes susceptibility variant. Diabetes. 2011;60(2):662-8.
-
Funding: this study was partially supported by grants from Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (Fapergs), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundo de Incentivo à Pesquisa e Eventos (Fipe) at the Hospital de Clínicas de Porto Alegre, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes). Daisy Crispim and Luís H. Canani are recipients of scholarships from CNPq. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Publication Dates
-
Publication in this collection
Dec 2014
History
-
Received
3 June 2014 -
Accepted
14 Sept 2014