Effect of osmopriming on germination and initial growth of Physalis angulata L. under salt stress and on expression of associated genes

ABSTRACT

This study aimed to evaluate the effects of priming on seed germination under salt stress and gene expression in seeds and seedlings of P. angulata L. After priming for 10 days, seed germination was tested in plastic trays containing 15 ml of water (0 dS m^-1 - control) or 15 ml of NaCl solution (2, 4, 6, 8, 10, 12, 14 and 16 dS m^-1). Fresh and dry weight of shoots and roots of seedlings were evaluated at 0, 2, 4, 6, 8 dS m^-1. Total RNA was extracted from whole seeds and seedlings followed by RT-qPCR. The target genes selected for this study were: ascorbate peroxidase (APX), glutathione-S-transferase (GST), thioredoxin (TXN), high affinity potassium transporter protein 1 (HAK1) and salt overly sensitive 1 (SOS1). At an electroconductivity of 14 dS m^-1 the primed seeds still germinated to 72%, in contrast with the non-primed seeds which did not germinate. The relative expression of APX was higher in primed seeds and this may have contributed to the maintenance of high germination in primed seeds at high salt concentrations. GST and TXN displayed increased transcript levels in shoots and roots of seedlings from primed seeds. Priming improved seed germination as well as salt tolerance and this is correlated with increased expression of APX in seeds and SOS1, GST and TXN in seedlings.

Key words:
RT-qPCR; germinability; seedling growth; salinity

RESUMO

Este estudo teve como objetivo avaliar os efeitos do osmocondicionamento na germinação de sementes submetidas ao estresse salino e expressão gênica em sementes e plântulas de P. angulata. Após serem osmocondicionadas por 10 dias, a germinação foi tes­tada em bandejas plásticas contendo 15 ml de água (0 dS m^-1 - controle) ou 15 ml de solução de NaCl (2, 4, 6, 8, 10, 12, 14 e 16 dS m^-1). Avaliou-se massa fresca e seca da parte aérea e raízes de plântulas a 0, 2, 4, 6, 8 dS m^-1. O RNA total foi extraído de sementes e plântulas seguido de RT-qPCR. Os genes-alvo selecionados para este estudo foram: ascorbato peroxidase (APX), glutationa-S-transferase (GST), thioredoxina (TXN), proteína transportadora para o potássio 1 (HAK1) pro­teína altamente sensível ao sal 1 (SOS1). A uma eletrocondutividade de 14 dS m^-1 as sementes osmo­condicionadas apresentaram germinação de 72%, em contraste com as sementes não osmocondicionadas que não germinaram. A expressão relativa de APX foi maior em sementes osmocondicionadas, o que pode ter contribuído para a manutenção de uma alta taxa de germinação em concentrações salinas elevadas. GST e TXN apresentaram aumento nos níveis de transcritos na parte aérea e raízes de plântulas provenientes de sementes osmocondicionadas. O osmocondicionamento incrementou a germinação de sementes, bem como a tolerância à salinidade, o que está correlacionado com o aumento da expressão de APX em sementes e SOS1, GST e TXN em plântulas.

Palavras-chave:
RT-qPCR; germinabilidade; cresci­mento de plântulas; salinidade

INTRODUCTION

In most plant species salinity affects germination and development of the seedling, which is consider­ed the developmental stage that is most sensitive and vulnerable to abiotic stresses (Sosa et al. 2005, Belaqziz et al 2009). Delay of germination (Foolad 2004) and growth inhibition due to salinity are caused by low external water potential, ion imbalance and specific ion toxicity (Munns 2002, Khajeh-Hosseini et al. 2003, Miranda et al 2010). Under these conditions there is a decrease in water absorption and an excessive absorption of ions (Akram et al. 2010).

Salt stress leads to oxidative stress and severe impairment of germination and seedling growth. Although there is extensive knowledge on physiological and molecular mechanisms that regulate salt tolerance in Arabidopsis thaliana (L.) Heynh (Peng et al. 2009, Tian et al. 2011), much less is known for wild species, such as Physalis angulata (Solanaceae). Physalis angulata is widely used in ethnomedicine due to the presence of sec-steroid (physalins) that are produced in stems and leaves (Bastos et al. 2008). The anti-inflammatory and immunomodulatory effects of the physalins B, D, F and G, have been well documented (Vieira et al. 2005, Magalhães et al 2006, Soares et al. 2006, Damu et al. 2007, Guimarães et al. 2009, Yu et al. 2010). Despite its important chemical and food properties, research on growth and improvement of stress tolerance of P. angulata is lagging behind. In this study we describe the sensitivity of germination and seedling growth P. angulata, to salt stress, in addition to the effect of a method involving controlled hydration of seeds followed by drying (collectively called 'seed priming') on these phenotypes. Priming is generally used to improve seed performance with respect to germination rate, uniformity and seedling emergence of vegetable and ornamental seeds (Heydecker et al. 1973, Iqbal and Ashraf 2007, Varier et al. 2010). However, seed priming can also improve resistance or tolerance of seeds to high temperatures (Yoon et al. 1997, Ligterink et al. 2007), drought (Wang et al. 2003) and salt (Sivritepe et al. 2003).

The maintenance of metabolic processes required for germination under stress may be attributed to the expression of genes specific to certain types of abiotic stresses. An increase of salinity in the medium is often associated with the expression of genes involved in water homeostasis, inorganic ion transport and metabolism, cell wall biogenesis, and signal transduction mechanisms (Bertorello and Zhu 2009, Peng et al. 2009).

The expression and activity of antiporters are highly regulated by salt stress (Bertorello and Zhu 2009), including SOS1 (salt overly sensitive) which is a member of the SOS family of antiporters. These antiporters regulate cell homeostasis by exporting Na⁺ and their expression is activated when plants are subjected to saline environments (Munns and Tester 2008). Transporters with high affinity to K⁺ (HKT1, HAK1), transporters with low affinity for cations (LCT1) and non-selective ion channels are considered the most likely transport systems specific to regulating the Na⁺ cell influx (Davenport and Tester 2000, Amtmann et al. 2001). HAKs (High Affinity K⁺ transport) are known to capture both Na⁺ and K⁺ in saline environments (Mian et al. 2011).

The ability of plants to counteract the produc­tion of reactive oxygen species (ROS) is an impor­tant component in the ability to withstand stress (Flors et al. 2007, Peng et al. 2009). In general, the ability to induce a high level of antioxidant sys­tems results in higher tolerance towards stress.

The enzymatic antioxidant systems existing in seeds are superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione peroxidase (GPX) and catalase (CAT) (Apel and Hirt 2004, Besse and Buchanan 1997, Dos Santos and Rey 2006). Thioredoxin (TXN) can also provide protection against antioxidants by allowing photochemical detoxification of H₂O₂ produced in the chloroplasts during stress (Dietz et al. 2006).

This study aimed at evaluating the effects of priming on seed germination and seedling growth under salt stress as well as changes in expression of genes related to stress signaling mechanisms in seeds and seedlings of P. angulata.

MATERIALS AND METHODS

Plant Material

Physalis angulata plants were cultivated in a green house at the State University of Feira de Santana (State of Bahia, Brazil) in December 2010. The seeds were isolated from fruits collected at a uniform stage of maturation and placed to dry over saturated KCl solution (85% RH). Water content was determined on a fresh weight basis by placing samples of 200 seeds for 17 h in an oven set at 103 ºC (ISTA 2007). Remaining seeds were placed in 5 ml tubes and stored at 4 ºC until further use.

Seed Priming and Germination

P. angulata seeds were used in two conditions: non-primed (control) and primed. To prime the seeds, samples of 1000 seeds were placed in 50 ml tubes containing 25 ml aerated -1.2 MPa polyethylene glycol solution (PEG 8000, Sigma), i.e. osmoprim­ing, and kept in an incubator at 35° C in the dark (Villela and Beckert 2001, Souza et al. 2011). After priming for 10 days, seeds were washed with distilled water and kept at room temperature for 2 days to achieve the initial fresh weight.

Germination of non-primed and primed seeds was tested by sowing seeds on top of filter paper soaked with 15 ml of water (0 dS m^-1 - control) or NaCl solution (2, 4, 6, 8, 10, 12, 14 and 16 dS m^-1, corresponding to 17, 34, 55, 75, 92, 113, 134 and 154 mM, respectively) within plastic trays (15x21cm). The germination test was carried out in 4 replicates of 50 seeds per treatment incubated at 35° C in the dark. Germination was monitored during 10 days and seeds were considered germinated when the radicle had protruded the seed coat by at least 2 mm. Germination was assessed by measuring maximum germination percentage (G_max), germination rate expressed as time to reach 50% germination (t₅₀), and germination uniformity by measuring the time interval between 16% and 84% germination of viable seeds (u₈₄₁₆) using the curve-fitting module of the 'Germinator software package' which enables the analysis of cumulative germination data (Joosen et al 2010).

Seedling Growth

Seedlings were grown from non-primed and primed seeds sown on top of filter paper soaked with water (0 dS m-1 - control) or 15 ml of saline solutions (2, 4, 6, and 8 dS m^-1 , i.e. normal seedlings) incubated at 35 ºC and 12/12 h photoperiod. To measure root length, pictures were taken of ten day old seedlings using a digital camera (Nikon D80 with Nikkor AF-S Micro 60 mm f/2.8 G ED, Nikon), after which the seedlings were separated in shoots, roots and fresh and dry weight were determined. Dry weight was measured after placing shoots and roots at 104 °C for 24 h. The seedlings were grown randomized with 4 replicates of 25 seedlings per treatment and the data was statistically analyzed using the SISVAR software (Ferreira 2011).

RNA Isolation from Seeds and Seedlings

RNA from seeds

Total RNA was obtained from non-primed (control) and primed seeds, both dry and 24 h imbibed in 14 dS m^-1 NaCl solution. Total RNA was extracted from samples of 50 seeds per treatment previously frozen in liquid nitrogen and stored at -80 °C. Frozen seeds were ground in a dismembrator at 1.200 rpm for 2 min and added to a tube containing 1.5 ml of phenol (pH 8.0):chloroform (5:1) plus 5 ml TLE grinding buffer (0.18 M Tris, 0.09 M LiCl, 4.5 mM EDTA, 1% SDS, adjusted to pH 8.2) with 5μl of β-mercaptoethanol. After subsequent centrifugation at maximum speed for 10 min, the upper phase was transferred to a new tube with 1000μl of phenol-chloroform (1:1), centrifuged at 12,000 g for 5 min and the supernatant was extracted with 1000μl of chloroform. RNA was precipitated overnight at -20 °C by adding 100μl of 10M LiCl. The samples were then centrifuged for 30 min at 12,000 g at 4 °C, the supernatant was removed, and the pellet was washed with 70% ice cold ethanol. The samples were centrifuged again for 5 min at 10,000 g at 4 °C, the supernatant was removed and the pellet was resuspended in 20μl DEPC water. The samples were DNAse treated (RQ1 DNase, Promega) and further purified with RNEasy spin columns (Qiagen) following the manufacturer's instructions.

RNA from seedlings

Total RNA was obtained from ± 150 shoots and roots of 10 days old seedlings grown from non-primed and primed seeds imbibed in water or in 2, 4, and 6 dS m^-1 NaCl. Shoots and roots were initially placed in Eppendorf tubes, frozen in liquid nitrogen and stored at -80 °C. Subsequently they were homogenized in a dismembrator at 200 rpm for 1 min and RNA extraction was performed using the RNeasy Plant Mini Kit (Qiagen) following the manufacturers recommendations including a DNAse treatment.

The RNA samples from seeds and seedlings (roots and shoots) were stored at -80 ºC until further use. RNA quality was analyzed on a 1.2% agarose gel, stained with gel red. Concentration and purity of total RNA was assessed with a NanoDrop-ND 1000 UV-Vis Spectrophotometer (NanoDrop Technologies, New Zealand), using 1μl of total RNA. RNA purity was estimated from the A260/A280 absorbance ratio.

Synthesis of cDNA

A cDNA iScript kit (Bio Rad, Hercules, CA, USA) was used to synthesize cDNA following the manufacturer's protocol by using 1µg of total seeds or seedlings RNA. The cDNA synthesis was carried out in a thermocycler (iCycler, Bio Rad, Hercules, CA, USA) using the following steps: 5 min at 25 °C, 30 min at 42 °C and 5 min at 85 °C. A negative control, where no RNA was added to the reaction mix, was also included to check for contamination of the reagents and of the water used in the reactions.

Primer Design and Quantitative Real-Time PCR (RT-qPCR)

The target genes selected for this study were: ascor­bate peroxidase (APX), glutathione S-transferase (GST), thioredoxin (TXN), high affinity potassium transporter protein 1 (HAK1) and salt overly sensitive 1 (SOS1). The reference genes used for normalization were SGN U-584254 and a catalytic subunit of protein phosphatase 2A (SGN U-567355) (Dekkers et al. 2012). Specific primers used for RT-qPCR reactions with seeds and seedlings (Table I) were designed based on gene sequences available in GenBank/NCBI (http://www.ncbi.nlm.nih.gov/) and the Sol genomics database (http://solgenomics.net/), from several Solanaceae species, e.g. Lyco­persicon esculentum, Solanum habrochaites, Capsicum annuum, Nicotiana benthamiana using the GeneFisher software (http://bibiserv.techfak.uni-bielefeld.de/genefisher/old.html) (Giegerich et al. 1996).

TABLE I
Specific primers used in the real-time RT-qPCR reactions.

Gene	Forward (sequences written 5' to 3')	Reverse (sequences written (5' to 3´)	Amplicon length
APX	AGGACCTGATGTTCCCTTTCAC	AAGGTATGGGCACCAGAGAG	168
GST	AGYCCTCTGCTTTTGCAGATG	AAGGATCAGAAGGGAGCAAAGG	148
TXN	GGGYGTYGAWGAAATCCTCTG	TTTCCAGCTCCATCAGCAAG	114
HAK1	CGTGAGACCTGAAGAAAGGTTC	CAAACTCTACGTCGTCCATGTG	116
SOS1	CCTTGTTGTGCTGTGAAGT	TCGGCTTTGGTATTGCTTT	165
SGN-U 584254	GAGAGTCATGCCTAGTGGTTGG	CGAAGACAAGGCCTGAAATGTG	172
SGN-U 567355	CGATGTGTGATCTCCTATGGT	AAGCTGATGGGCTCTAGAAAT	148

Reactions were performed using a CFX96 (Bio Rad, Hercules, CA, USA) with gene specific prim­ers, cDNA and iQ SYBR green supermix (Bio Rad, Hercules, CA, USA). The amplification protocol consisted of 3 min at 95 °C; then 40 cycles of 15 s at 95 °C followed by 1 min at 60 °C. A negative control was used in every PCR plate. Efficiency of the primers in RT-qPCR reactions was evaluated based on a standard curve generated by two-fold serial dilutions of a pooled cDNA sample, and all primer pairs had efficiencies between 90 and 110%. Gene expression was measured twice in 3 biologi­cal replicates (6x in total) for each treatment. Values of fold change in gene expression in relation to the control (dry non-primed seeds) were calculated using the 2^-ΔΔCt method (Livak and Schmittgen 2001) with help of the qBase software (Biogazelle, Ghent, Belgium) and plotted on graphs for comparison. Stable expression of the reference genes for the studied samples was confirmed by geNORM as incorporated in the qBase software (Vandesompele et al. 2002, Hellemans et al. 2007)

RESULTS AND DISCUSSION

Seed Priming and Germination under Salt Stress

The effect of priming was tested on germination and seedling growth of P. angulata under different salt concentrations. All physiological tests were done at 35 °C since this is the optimum temperature for P. angulata germination and seedling growth (C.L.M. Souza, personal communi­cation, 2010). We tested the effect of salt stress due to the severe problems with saline soils in places where P. angulata is grown, like for example in the northeast of Brazil (De Nys et al. 2005). Germination of both non-primed and primed seeds decreased when seeds were submitted to imbibition under increasing salt concentrations up to 16 dS m^-1. Differences in germination parameters between non-primed and primed seeds became significant at salt solutions with electroconductivity (EC) of 6 dS m^-1 or higher (Fig. 1a). At 6 dS m^-1 EC the germination percentage was 90% in non-primed seeds, against 100% in primed, and the difference in germination percentage increased gradually, becoming the largest at 12 dS m^-1 EC, i.e 10% in non-primed, against 87% in primed seeds. Non-primed seeds failed to germinate at 14 dS m^-1 EC or higher in contrast with primed seeds which still germinated up to 72% at this salt concentration (Fig. 1a).

Figure 1
Germination of non-primed (black bars) and primed seeds (white bars) of P. angulata under saline stress. (a) Maximum germination percentage (%); (b) Germination rate expressed as time (h) to reach 50% germination (t₅₀); (c) Germination uniformity expressed as the time (h) interval between 16% and 84% germination of viable seeds (u₈₄₁₆). Salt concentrations expressed as salt electric conductivity from zero (water) up to 16 dS m^-1. All values are means ± SE of 4 replicates of 50 seeds each. Asterisks represent significant differences between non-primed and primed seeds (Student t-test at P < 0.05).

Besides germination, the non-primed P. angulata seeds that germinated in different salt concentrations from 8 dS m^-1 EC or higher, showed significantly slower germination (higher t₅₀), as well as worse uniformity (higher u₈₄₁₆) compared to primed seeds (Fig. 1b, c). The largest difference in t₅₀ between non-primed and primed seeds was at EC 8 dS m^-1 EC, at which t₅₀ of non-primed seeds became significantly slower (higher t₅₀), keeping similar levels up to 10 dS m^-1 EC, above which non-primed seeds failed to germinate. Primed seeds initially kept a higher germination rate (lower t₅₀), but then gradually became slower (higher t₅₀) with increasing salt concentrations (Fig. 1b). Uniformity (u₈₄₁₆) was better in primed seeds imbibed in water as well as in all salt solutions, but difference became larger in seeds subjected to higher salt concentrations from 8 dS m^-1 EC upwards (Fig. 1c).

The germination data demonstrate the positive effect of priming on germination of P. angulata seeds subjected to salt stress, which is consistent with the work performed by Souza et al. (2011), who demonstrated that the benefits caused by priming seeds of P. angulata included higher germination percentage and rate, and better uniformity in saline conditions. Priming has been confirmed as a technique to improve seed germination performance in various crops using PEG or salt solutions as osmotic agents, which control the entry of water into the cell, thereby preventing germination during the priming treatment and allowing the seed germination process to be resumed faster in suitable conditions (McDonald 2000, Sivritrepe et al2003, Soeda et al. 2005, Varier et al. 2010, Souza et al. 2011, Nakaune et al. 2012).

Many studies have shown that priming is a useful technique, especially for seed lots with low vigor (Varier et al 2010, Flors et al. 2007, Soeda et al. 2005). Agriculture has benefited from the effects of priming applied to seeds of many domesticated crop species, whereas the present results show that it can be extended to seeds of P. angulata, which are yet undomesticated but has increasing relevance as a plant species with significant therapeutic properties. This study shows that priming of P. angulata seeds results in higher percentages and rates of germination, as well as better germination uniformity, especially under adverse environmental conditions. Thus, PEG osmopriming of P. angulata seeds may be used to standardize and decrease the time for germination, especially when these seeds are planted under salt stress conditions.

It has been shown that germination of Physalis peruviana and Physalis ixocarpa decreased with increasing NaCl concentration. P. peruviana had higher germination rates than P. ixocarpa with increasing salt concentrations, indicating a higher level of tolerance of P. peruviana to salt stress during germination. In contrast, P. peruviana became more sensitive to salt during emergence and early seedling stages (Yildirim et al. 2011). In fact, P. peruviana plants have been considered as moderately tolerant to saline conditions as measured by relative growth rate and net assimilation rate at moderate salt stress (30 mM NaCl), which corresponds to a salt solution of around 3.5 dS m^-1 EC (Miranda et al. 2010). In the present study primed P. angulata seeds became vigorous enough to withstand salt stress and germinate well at salt concentrations between 6 and 12 dS m^-1 EC.

Effect of Priming on Seedling Growth under Saline Stress

Shoot Growth

Salinity had a significant impact on initial seedlings growth of P. angulata. For both fresh and dry weight, seedlings of primed seeds produced more biomass than seedlings of non-primed seeds (Fig. 2). However, the magnitude of the response to treatment with salt varied with the salt concentration. There was a tendency to stimulate the production of biomass in milder salt concentrations between 2, 4 and 6 dS m^-1. At the highest concentration (8 dS m^-1), the biomass of shoots was affected regardless of the initial treatment of the seeds (Fig. 2a, b).

Figure 2
Fresh and dry weights (mg/seedling) of shoots and roots of seedlings derived from non-primed (black bars) and primed seeds (white bars) of P. angulata grown under saline stress. (a) Shoot fresh weight; (b) Shoot dry weight; (c) Fresh root weight; (d) Root dry weight. Salt concentrations expressed as salt electric conductivity from zero (water) up to 8 dS m^-1. All values (mg/seedling) are means ± SE of 4 replicates of 25 seedlings each. Asterisks represent significant differences between non-primed and primed seedlings (Student t-test at P < 0.05).

These results show that, even under saline con­ditions, P. angulata seedlings show relatively nor­mal growth, which can be attributed to mechanisms that prevent ions from acting as toxic substances. Biomass production was even stimulated by moderate salinity. This suggests that physiological mechanisms are active in P. angulata, especially osmotic adjustment and synthesis of important proteins involved in protection against free radicals.

The differences between shoots of seedlings grown from non-primed and primed seeds were more pronounced from 2 dS m^-1 upwards, in which fresh weight was increased as salt concentration increased. The values ​​of fresh shoots obtained from plants grown from primed seeds were 4.8, 5.41 and 5.97 mg in saline solutions of 2, 4 and 6 dS m^-1 EC, respectively.

In saline solution of 6 dS m^-1 EC, the values ​​of dry mass of shoots of seedlings from non-primed and primed seeds were 0.23 mg and 0.28 mg, respectively (Fig. 2b).

The accumulation of Na⁺ and Cl in tissues has been related to reduced plant growth (García-Legaz et al. 2005). In Phlomis purpurea it was observed that the reduction in plant growth in a saline solution of 4 dS m^-1 EC, which would reflect the tolerance of this species to salinity (Álvarez et al. 2012).

Salt stress significantly reduced the fresh and dry weight of two species of Physalis. Fresh weights of P. peruviana and P. ixocarpa were reduced by 60%-75% at 30 mM NaCl (3.5 dS m^-1) and 72%-100% at 60 mM (7 dS m^-1), respectively (Yildirim et al. 2011). In that respect we can conclude that P. angulata seedlings are much more tolerant than its family members and this tolerance can even be increased by osmopriming of the seeds that are used to grow these seedlings.

Root Growth

Different salt concentrations had a positive effect on fresh roots weight (Fig. 2c), but no significant differences were observed when comparing root weight of non-primed with primed seeds. The length of roots of P. angulata showed a trend towards longer roots for seedlings grown from primed as compared to non-primed seeds and subjected to different salt concentrations, however, this difference was only statistically significant in EC 6 dS m^-1 where the roots from primed seedlings were much longer (Table II). Yet in EC 8 dS m^-1 roots, there was no significant difference between the length of roots from non-primed seedlings as compared to primed seedlings, probably reflecting a mechanism in which the effect of priming on root length is only favorable at lower salt concentration.

TABLE II
Seedling root lengths (cm) derived from non-primed and primed seed of Physalis angulata grown under saline stress. Salt concentration expressed as the salt electric conductivity from zero (water) up to 8 dS m-1.

• Means followed by same lower-case letter in a column do not differ by Student t-test at P < 0.05.

Sodium in the soil inhibits the uptake of potassium by the root which is an essential mineral for all plants. Furthermore, high concentrations of sodium salts hinder water absorption by the roots. Finally, the accumulation of sodium in the cytoplasm of plant cells can inhibit metabolic enzymes and may cause oxidative stress (Katiyar-Agarwal et al. 2006).

Our results suggest that the roots of P. angulata may have been able to osmotically adjust themselves keeping intracellular Na⁺ and Cl concentrations at affordable levels, reducing the water potential and maintaining cellular metabolism without toxic effects.

Gene Expression in P. angulata Seeds under Saline Stress

To find a link between the observed physiological effects of osmopriming of P. angulata seeds with respect to germination and seedling growth with changes in gene, we studied the expression of genes with a described role in tolerance towards stress, in other species. The SOS1 gene encodes a plasma membrane Na⁺/H⁺ antiporter responsible for the exclusion of sodium from the apoplast (Liu et al. 2000), whereas HAK1 is a high affinity carrier for K⁺, which also regulates the influx of Na⁺ in the cell (Amtmann et al. 2001).

The relative expression of SOS1 and HAK1 in seeds (Figs. 3a1 and 3b1, respectively) did hardly differed between treatments. Only HAK1 expression was significantly lower in dry primed seeds as compared to non-primed dry seeds and seeds that were exposed to salt for 24 h. This incubation time was probably not sufficient to increase expression of both genes, and higher expression values of especially HAK1 might be expected after longer exposure times, but additional experiments would be needed to prove this.

Figure 3
Relative expression of SOS1 (a), HAK1 (b), APX (c), GST (d) and TXN (e) in non-primed and primed seeds, and in shoots and roots of seedlings derived from non-primed and primed seeds submitted to saline stress. (1) relative expression of the respective genes in non-primed and primed dry seeds and in non-primed and primed seeds subjected to saline stress for 10 days in 14 dS m^-1 salt solution; (2), (3) relative expression of the respective genes in shoots (2) and roots (3) of seedling derived from non-primed (black bars) and primed seeds (white bars) that were grown under saline stress from zero (water) up to 6 dS m^-1 salt solution. Salt concentrations expressed as salt electric conductivity (dS m^-1). Error bars indicate ± SE of 3 biological replicates. Lower-case letters indicate significant differences (Student t-test at P < 0.05).

To further explore the correlation between the effect of priming on salt tolerance in P. angulata seeds and gene expression, we measured the expression of some antioxidant enzymes. The increase in reactive oxygen species (ROS) as a response to different types of stress, including salinity, triggers mechanisms to minimize the damaging effects caused by the presence of ROS in plant tissues. Among these mechanisms are the actions of antioxidant enzymes (Munns and Tester 2008). These enzymes include, among others, glutathione peroxidase (GPX), glutathione-S-transferase (GST), superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and thioredoxin (TXN) (McFarland et al 1999, Wedderburn et al. 2000, Apel and Hirt 2004, Ashraf et al. 2008). We tested the expression of genes for APX, GST and TXN. All these genes code for important detoxifying enzymes with a proven role in general stress responses in other plant species, because of their antioxidant activity (Besse and Buchanan 1997, Su et al. 2002, Dos Santos and Rey 2006).

Expression of APX was induced upon salt stress with a higher up-regulation in primed seeds (Fig. 3c1). Expression of GST did change significantly as a result of priming in dry seeds, but its expression was lower in seeds exposed to salt for 24 h with no differences between non-primed and primed seeds (Fig. 3d1).

We observed a negative effect of priming on the expression of TXN, since the expression in the dry non-primed seeds was higher than in the dry primed seeds (Figs. 3e1). The expression of TXN in imbibed seeds is lower, which indicates that TXN expression might be generally repressed upon imbibition under salt stress (Figs. 3e1).

According to Varier et al (2010) the metabolic energy of dried primed seeds is greater than that of unprimed seeds during imbibition. This might be one of the aspects of the positive effect of priming on the vigor of seeds. According to Soeda et al. (2005) expression of genes that encode for components of the protein synthesis machinery, such as protein initiation factors and translation and elongation factors, increase during priming. This fact may also partly explain why primed seeds had the highest germination percentages (Fig. 1a). It is probable that Physalis angulata primed seeds possess mechanisms to protect against salt stress through gene expression that adjust the enzymatic machinery, providing continuous tissue growth and radicle protrusion.

Gene Expression in Seedlings of P. angulata under Saline Stress

The changes caused by salt/oxidative stress result in molecular changes in the cell and in architectural and phenotypical patterns. Changes in molecular phenotype include changes in patterns of gene expression and protein synthesis. Changes may occur in the cytoskeleton due to a disproportionate increase in cell size, which leads to disorganized cells, resulting in impairment of physiological functions (Bertorello and Zhu 2009).

Expression of SOS1 and HAK1 hardly changed in the shoots and roots at the different salt concen­trations to which the seedlings were subjected to the non-primed samples (Figs. 3a-2, a-3, b-2 and b-3). However, expression was higher in the shoots of seedlings that originated from primed seeds, especially at 2 dS m^-1 in the shoots for SOS1 (Fig. 3a-2) with a tendency for higher expression at 4 and 6 dS m^-1 and higher expression in the roots for both SOS1 and HAK1 at 6 dS m^-1 (Figs. 3a-3 and b-3).

These results might partly be explained by the fact that priming has an important role in expression of proteins that retain the organization of the cell membranes. Many genes expressed during priming, encode for membrane proteins, which probably provided beneficial effects to the maintenance of cell functions and regulation of the ions present in greater amounts during salt stress (Varier et al 2010). Studies with Arabidopsis thaliana showed that SOS1 is not essential to plant growth and normal development, but is critical to the development of tolerance to salt (Wu et al. 1996, Shi et al. 2002). In studies with tomato Olías et al. (2009) showed that SOS1 gene silencing resulted in negative effects on plant growth under salt stress. It was shown that, besides its main action in the extrusion of Na⁺ out of the root tissue, SOS1 is critical for the partitioning of Na⁺ in plant organs, besides participating in the retention of Na⁺ in stems of tomato, to prevent it from reaching photosynthetic tissues.

According to Su et al. (2002) salt stress increased the expression of family members of the AKT and KAT genes, including HAK1 in common ice plant. Potassium channels are also important in the regulation of homeostasis. They have high affinity for K⁺, but also have affinity for Na⁺. Therefore, they can also transport Na⁺, especially when the K⁺/Na⁺ ratio is low (Pardo and Quintero 2002). The K⁺ transporting function of HAK1 is competitively inhibited by the presence of high concentrations of Na⁺, thereby sharing the transport route of the two monovalent cations (Santa Maria et al. 1997, Mian et al. 2011). This may partially explain the higher level of HAK1 expression in the roots of P. angulata when the concentration of salt was increased.

The expression of APX, GST and TXN was mainly up regulated in plants that originated from primed seeds in shoots (Figs. 3c-2, d-2 and e-2) and roots (Figs. 3c-3, d-3 and e-3), although, this was partly the result of lower expression in shoots and roots of seedlings grown under control conditions. In the shoots, up-regulation was especially observed for GST and TXN at all salt concentrations. Very similar patterns were observed for GST and TXN in the roots, whereas APX expression increased with increasing salt concentration in seedlings originated from both non-primed and primes seeds.

The production of reactive oxygen species in cellular compartments such as mitochondria and chloroplasts can change the nuclear transcriptome, indicating that there is a signal transmitted from these organelles to the nucleus. Although, the identity of this signal remains unknown, ROS sensors can be activated, inducing signaling cascades, and ultimately change the level of gene expression. Finally, ROS might change gene expression by altering the activities of transcription factors (Apel and Hirt 2004). Increased expression of APX, GST and TXN probably resulted in an increase of the synthesis of the antioxidant enzymes, which protected the shoots and roots from the negative effects of salt and oxidative damage. Our result suggest, therefore, that up-regulation of these genes is important for the observed increased salt tolerance of seedling from primed P. angulata seeds. It might seem conflicting that up-regulation of these genes is measured in shoots and roots, while increased biomass as a result of the priming treatment is only observed for shoots. We believe that the reason for this lies in the fact that also the roots need to be able to deal with the oxidative stress that is caused by the salt solutions in order to keep functioning optimally, and in that way be able to support better growth of the shoot.

Priming is an important technique that provides an increase in germination percentage and rate of P. angulata seeds, especially under salt stress. Furthermore, seedlings grown from primed seeds have a slightly higher biomass when grown under salt stress. We postulate that this may partly be the result of up-regulation of genes related to ion transport and genes coding for anti-oxidant enzymes. Although, further research is needed, these results will help elucidate the molecular processes related to the link between priming and salt tolerance in P. angulata.

ACKNOWLEDGMENTS

This work was supported by a PhD fellowship from the Fundação de Amparo à Pesquisa do Estado da Bahia (FAPESB, Brazil) to the first author, and by grants from the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Ministério da Educação), the Conselho Nacional de Desenvolvimento Científico e Tecnológico, and the Rede Nordeste de Biotecnologia (CNPq/RENORBIO, Ministério da Ciência e Tecnologia, nº 554839/2006-7).

REFERENCES

• Akram M, Ashraf MY, Ahmad R, Waraich EA, Iqbal J and Mohsan M. 2010. Screening for salt tolerance in maize (Zea mays L.) hybrids at an early seedling stage. Pak J Bot 42: 141-154.
• Álvarez S, Gómez-Bellot MJ, Castillo M, Banón S and SánchezBlanco MJ. 2012. Osmotic and saline effect on growth, water relations, and ion uptake and translocation in Phlomis purpurea plants. Environ Exp Bot 78: 138-145.
• Amtmann A, Fischer M, Marsh EL, Stefanovic A, Sanders D and Schachtman DP. 2001. The wheat cDNA LCT1 generates hypersensitivity to sodium in a salt-sensitive yeast strain. Plant Physiol 126: 1061-1071.
• Apel K and Hirt H. 2004. Reactive oxygen species: Metabolism, oxidative stress and signal transduction. Annu Rev Plant Biol 55: 373-399.
• Ashraf M, Athar HR, Harris PJC and Kwon TR. 2008. Some prospective strategies for improving crop salt tolerance. Adv Agron 97: 45-110.
• Bastos GN, Silveira AJ, Salgado CG, Picanço-Diniz DL and DoNascimento JL. 2008. Physalis angulata extract exerts anti-inflammatory effects in rats by inhibiting different pathways. J Ethnopharmacol 118: 246-251.
• Belaqziz R, Romane A and Abbad A. 2009. Salt stress effects on germination, growth and essential oil content of an endemic thyme species in Morocco (Thymus maroccanus Ball.). J Appl Sci Res 5: 858-863.
• Bertorello AM and Zhu JK. 2009. SIK1/SOS2 networks: decoding sodium signals via calcium-responsive protein kinase pathways. Eur J Appl Physiol 458: 613-619.
• Besse I and Buchanan BB. 1997. Thioredoxin-linked plant and animal processes: the new generation. Bot Bull Acad Sin 38: 1-11.
• Damu AG, Kuo PC, Su CR, Kuo TH, Chen TH, Bastow KF, Lee KH and Wu TS. 2007. Isolation, structures, and structure cytotoxic activity relationships of withanolides and physalins from Physalis angulata J Nat Prod 70: 1146-1152.
• Davenport RJ and Tester M. 2000. A weakly voltage dependent, nonselective cation channel mediates toxic sodium influx in wheat. Plant Physiol122: 823-834.
• DeNys E, Raes D, LeGal P, Cordeiro G, Speelman S and Vandersypen K. 2005. Predicting Soil Salinity under Various Strategies in Irrigation Systems. J Irrig Drain E Asce 131: 351-357.
• Dekkers BJW, Willems L, Bassel GW, VanBolderen-Veldkamp RP, Ligterink W, Hilhorst HWM and Bentsink L. 2012. Identification of Reference Genes for RT-qPCR Expression Analysis in Arabidopsis and Tomato Seeds. Plant Cell Physiol 53: 28-37.
• Dietz KJ, Jacob S, Oelze ML, Laxa M, Tognetti V, De Miranda SM, Baier M and Finkemeier I. 2006. The function of peroxiredoxins in plant organelle redox metabolism. J Exp Bot 57: 1697-1709.
• Dos Santos CV and Rey P. 2006. Plant thioredoxins are key actors in the oxidative stress response. Trends Plant Sci 11: 329-334.
• Ferreira DF. 2011. Sisvar: a computer statistical analysis system. Cienc Agrotecnol 35: 1039-1042.
• Flors V, Paradís M, García-Andrade J, Cerezo M, Bosch GC and Pilar GAP. 2007. A tolerant behavior in salt-sensitive tomato plants can be mimicked by chemical stimuli. Plant Signaling Behav 2: 50-57.
• Foolad MR. 2004. Recent advances in genetics of salt tolerance in tomato. Plant Cell, Tissue Organ Cult 76: 101-119.
• García-Legaz MF, López-Gómez E, Mataix Beneyto J, Torrecillas A and Sánchez-Blanco MJ. 2005. Effects of salinity and rootstock on growth, water rela­tions, nutrition and gas exchange of loquat. J Hortic Sci Biotechnol 80: 199-203.
• Giegerich R, Meyer F and Schleiermacher C. 1996. GeneFisher-software support for the detection of postulated genes. Proc Int Conf Intell Syst Mol Biol 4: 68-77.
• Guimarães ET, Lima MS, Santos LA, Ribeiro IM, Tomassini TB, Dos Santos RR, Dos Santos WL and Soares MB. 2009. Activity of physalins purified from Physalis angulata in vitro and in vivo models of cutaneous leishmaniasis. J Antimicrob Chemother 64: 84-87.
• Hellemans J, Mortier G, De Paepe A, Speleman F and Vandesompele J. 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 8: R19.
• Heydecker W, Higgins J and Gulliver RL. 1973. Ac­celerated germination by osmotic seed treatment. Nature 246: 42-44.
• Iqbal M and Ashraf M. 2007. Seed treatment with auxins modulates growth and ion partitioning in salt-stressed wheat plants. J Integr Plant Biol 49: 1003-1015.
• ISTA - International Rules for Seed Testing Associa­tion. 2007. Bassersdorf, Switzerland.
• Joosen RV, Kodde J, Willems LA, Ligterink W, Van Der Plas IH and Hilhorst HWM. 2010. GERMINATOR: a software package for high-throughput scoring and curve fitting of Arabidopsis seed germination. Plant J 62: 148-159.
• Katiyar-Agarwal S, Zhu J, Kim K, Agarwal M, Fu X, Huang A and Zhu JK. 2006. The plasma membrane Na⁺/H⁺ antiporter SOS1 interacts with RCD1 and functions in oxidative stress tolerance in Arabidopsis Proc Natl Acad Sci USA 103: 18816-18821.
• Khajeh-Hosseini M, Powell AA and Bingham IJ. 2003. The interaction between salinity stress and seed vigour during germination of soybean seeds. Seed Sci Technol 31: 715-725.
• Ligterink W, Kodde J, Lammers M, Dassen H, Van Der Geest AHM, De Maagd RA and Hilhorst HWM. 2007. Stress-inducible gene expression and its impact on seed and plant performance: a microarray approach. In: Adkins SW et al. (Eds), Seeds: Biology, Development and Ecology. Cabi, Wallingford, United Kingdom, p. 139-148.
• Liu J, Ishitani M, Halfter U, Kim CS and Zhu JK. 2000. The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc Natl Acad Sci USA97: 3730-3734.
• Livak KJ and Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 ^-ΔΔCt method. Methods 25: 402-408.
• Magalhães HIF, Veras ML, Pessoa ODL, Silveira ER, Moraes MO, Pessoa C and Costa-Lotufo LV. 2006. Preliminary investigation of structure-activity relationship of cytotoxic physalin. Lett Drug Des Discovery 3: 625-632.
• McDonald MB. 2000. Seed priming. In: Black M and Bewley JD (Eds), Seed Technology and Its Biological Basis. Blackwell, Sheffield, UK, p. 287-325.
• McFarland VA, Inouye LS, Lutz CH, Jarvis AS, Clarke JU and McCant DD. 1999. Biomarkers of oxidative stress and genotoxicity in livers of field-collected brown bullhead, Ameiurus nebulosus Arch Environ Contam Toxicol 37: 236-241.
• Mian AA, Senadheera P and Maathuis FJM. 2011. Im­proving crop salt tolerance: anion and cation transporters as genetic engineering targets. Plant Stress 5: 64-72.
• Miranda D, Fischer G and Ulrichs C. 2010. Growth of cape gooseberry (Physalis peruviana L.) plants affected by salinity. J Appl Bot Food Qual 83: 175-181.
• Munns R. 2002. Comparative physiology of salt and water stress. Plant Cell Environ 25: 239-250.
• Munns R and Tester M. 2008. Mechanisms of salinity tolerance. Annu Rev Plant Biol 59: 651-681.
• Nakaune M, Hanadac A, Yin YG, Matsukura C, Yamaguchi S and Ezura H. 2012. Molecular and physiological dissection of enhanced seed germination using short-term low-concentration salt seed priming in tomato. Plant Physiol Biochem 52: 28-37.
• Olías R, Eljakaoui Z, Li J, Morales PA, Marín-Manzano MC, Pardo JM and Belver A. 2009. The plasma membrane Na⁺/H⁺ antiporter SOS1 is essential for salt tolerance in tomato and affects the partitioning of Na⁺ between plant organs. Plant Cell Environ32: 904-916.
• Pardo JM and Quintero FJ. 2002. Plants and sodium ions: keeping company with the enemy. Genome Biol3: 1017.1-1017.4.
• Peng Z, Wang MC, Li F, Lv HJ, Li CL and Xia GM. 2009. A proteomic study of the response to salinity and drought stress in an introgression strain of bread wheat. Mol Cell Proteomics 8: 2676-2686.
• Santa-María GE, Rubio F, Dubcovsky J and Rodríguez-Navarro A. 1997. The HAK1 gene of barley is a member of a large gene family and encodes a high-affinity potassium transporter. Plant Cell 9: 2281-2289.
• Shi H, Quintero FJ, Pardo JM and Zhu JK. 2002. The putative plasma membrane Na⁺/H⁺ antiporter SOS1 controls long-distance Na⁺ transport in plants. Plant Cell14: 465-477.
• Sivritepe N, Sivritepe HO and Eris A. 2003. The effect of NaCl priming on salt tolerance in melon seedling grown under saline conditions. Sci Hort 97: 229-237.
• Soares MBP, Brustolim D, Santos LA, Bellintani MC, Paiva FP, Ribeiro IM, Tomassini TCB and Santos RR. 2006. Physalins B, F e G, seco-steroids purified from Physalis angulata L., inhybity lymphocyte function and allogeneic transplant rejection Int Immunopharmacol 6: 408-414.
• Soeda Y, Konings MC, Vorst O, VanHouwelingen AM, Stoopen GM and Maliepaard CA. 2005. Gene expression programs during Brassica oleracea seed maturation, osmopriming and germination are indicators of progression of the germination process and the stress tolerance level. Plant Physiol137: 354-368.
• Sosa L, Llanes A, Reinoso H, Reginato M and Luna V. 2005. Osmotic and specific ion effect on the germination of Prospis strombulifera Ann Bot 96: 261-267.
• Souza MOS, Souza CLM and Pelacani CR. 2011. Germination of osmoprimed and non-osmoprimed seeds and initial growth of Physalis angulata (Solanaceae) in saline environments. Acta Bot Bras 25: 105-112.
• Su H, Golldack D, Zhao C and Bohnert HJ. 2002. The expression of HAK-type K⁺ transporters is regulated in response to salinity stress in common ice plant. Plant Physiol129: 1482-1493.
• Tian N, Wang J and Xu ZQ. 2011. Overexpression of Na⁺/H⁺ antiporter gene AtNHX1 from Arabidopsis thaliana improves the salt tolerance of kiwifruit (Actinidia deliciosa). S Afr J Bot 77: 160-169.
• Vandesompele J, DePreter K, Pattyn F, Poppe B, VanRoy N, DePaepe A and Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol3: RESEARCH0034.
• Varier A, Vari AK and Dadlani M. 2010. The subcellular basis of seed priming. Curr Sci 99: 450-456.
• Vieira AT, Pinho V, Lepsch LB, Scavone C, Ribeiro IM, Tomassini T, Santos RR, Soares MBP, Teixeira MM and Souza DG. 2005. Mechanisms of the anti-inflammatory effects of the natural secosteroids physalins in model of intestinal ischemia and reperfusion injury. Br J Pharmacol 146: 244-251.
• Villela FA and Beckert OP. 2001. Osmotic potentials of aqueous solutions of polyethylene glycol 8000. Rev Bras Sementes 23: 267-275.
• Wang W, Vinocur B and Altman A. 2003. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218: 1-14.
• Wedderburn J, McFadzen I, Scager RC, Bessley A, Heath C, Hornsby M and Lowe D. 2000. Biomarkers: the application of a suite of techniques to determine environmental quality. Mar Environ Res 50: 431-441.
• Wu SJ, Ding L and Zhu JK. 1996. SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell8: 617-627.
• Yildirim E, Karlidag H and Dursun A. 2011. Salt tolerance of physalis during germination and seedling growth. Pak J Bot43: 2673-2676.
• Yoon BH, Lang HJ and Cobb BG. 1997. Priming with salt solution improves germination of Pansy seed at high temperatures. HortScience 32: 248-250.
• Yu Y, Sun L, Ma L, Li J, Hu L and Liu J. 2010. Investigation of the immunosuppressive activity of Physalin H on T lymphocytes. Int Immunopharmacol10: 290-297.

Publication Dates

• Publication in this collection
  29 Apr 2016
• Date of issue
  2016

History

• Received
  02 Jan 2015
• Accepted
  16 Mar 2015