Open-access Virulence parameters in the characterization of strains of Entamoeba histolytica

Abstract

Differences in virulence of strains of Entamoeba histolytica have long been detected by various experimental assays, both in vivo and in vitro. Discrepancies in the strains characterization have been arisen when different biological assays are compared. In order to evaluate different parameters of virulence in the strains characterization, five strains of E. histolytica, kept under axenic culture, were characterized in respect to their, capability to induce hamster liver abscess, erythrophagocytosis rate and cytopathic effect upon VERO cells. It was found significant correlation between in vitro biological assays, but not between in vivo and in vitro assays. Good correlation was found between cytopathic effect and the mean number of uptaken erythrocytes, but not with percentage of phagocytic amoebae, showing that great variability can be observed in the same assay, according to the variable chosen. It was not possible to correlate isoenzyme and restriction fragment pattern with virulence indexes since all studied strains presented pathogenic patterns. The discordant results observed in different virulence assays suggests that virulence itself may not the directly assessed. What is in fact assessed are different biological characteristics or functions of the parasite more than virulence itself. These characteristics or functions may be related or not with pathogenic mechanisms occurring in the development of invasive amoebic disease

Entamoeba hystolytica; Virulence assays; Izoenzyme patterns; Restriction fragments analysis


Resumo

Parâmetros de virulência na caracterização de Cepas de Entamoeba histolytica. A caracterização quanto a virulência das diferentes cepas de E. histolytica foi avaliada através de ensaios in vivo e in vitro. Discrepâncias nesta caracterização têm surgido quando se compara os diferentes ensaios. Avaliamos alguns parâmetros de virulência na caracterização de 5 cepas axênicas de E. histolytica. Estas cepas foram caracterizadas com relação à sua capacidade para induzir abscesso em fígado de hamster, eritrofagocitose e efeito citopático sobre células VERO. Encontramos correlação significante entre os ensaios biológicos in vitro, mas não entre estes com os ensaios in vivo. Boa correlação foi achada entre o efeito citopático e o número médio de eritrócitos ingeridos, mas não com a percentagem de amebas que fagocitaram eritrócitos, mostrando que grande variabilidade pode ser observada no mesmo ensaio, dependendo da variável escolhida. Não foi possível correlacionar isoenzima e padrão de fragmento de restrição com o índice de virulência desde que todas as cepas estudadas apresentaram padrão patogênico. Os resultados discordantes observados nos diferentes ensaios de virulência sugerem que a mesma não deve ser avaliada diretamente. O que de fato está sendo avaliado são as diferentes características biológicas ou funções do parasita, mais do que a própria virulência. Estas características ou funções podem estar relacionadas ou não com mecanismos patogênicos que ocorrem no desenvolvimeto de amebíase invasiva


Virulence parameters in the characterization of strains of

Entamoeba histolytica

Maria A. GOMES, Maria N. MELO, Gil P.M. PENA & Edward F. SILVA

Summary

Differences in virulence of strains of Entamoeba histolytica have long been detected by various experimental assays, both in vivo and in vitro. Discrepancies in the strains characterization have been arisen when different biological assays are compared. In order to evaluate different parameters of virulence in the strains characterization, five strains of E. histolytica, kept under axenic culture, were characterized in respect to their, capability to induce hamster liver abscess, erythrophagocytosis rate and cytopathic effect upon VERO cells. It was found significant correlation between in vitro biological assays, but not between in vivo and in vitro assays. Good correlation was found between cytopathic effect and the mean number of uptaken erythrocytes, but not with percentage of phagocytic amoebae, showing that great variability can be observed in the same assay, according to the variable chosen. It was not possible to correlate isoenzyme and restriction fragment pattern with virulence indexes since all studied strains presented pathogenic patterns. The discordant results observed in different virulence assays suggests that virulence itself may not the directly assessed. What is in fact assessed are different biological characteristics or functions of the parasite more than virulence itself. These characteristics or functions may be related or not with pathogenic mechanisms occurring in the development of invasive amoebic disease.

Keywords: Entamoeba hystolytica; Virulence assays; Izoenzyme patterns; Restriction fragments analysis.

Introduction

Strains of E. histolytica obtained from different patients have been long known to present great variability in their pathogenic behavior. Virulence, conceived as degree of pathogenicity, must take into account the circumstances under which it is determined8. To the present, several parameters have been employed in the assessment of virulence of E. histolytica strains. Among the most employed ones are capability to produce lesions in experimental animals9, capability to destroy cultured mammal cell monolayers2, erythrophagocytosis22, isoenzyme patterns25, restriction fragment analysis of genes7, 28, 30 and proteinase and collagenase activities15, 33.

The comparison of these parameters for each strain has arisen puzzling results. Tsutsumi et al.33 did not found correlation between erythrophagocytosis rate with collagenolytic activity or production of lesions in hamster liver. MONFORT et al.19 was also not able to demonstrate correlation between erythrophagocytosis (assessed as percent of phagocytic amoebae) and virulence to hamster liver. The correlation between zymodemes and virulence in vivo was evaluated by GIBODA et al.12 who found that a strain with pathogenic patterns was not able to produce lesions in hamster liver. Taking cytopathic effect as parameter, some strains with non pathogenic zymodeme may behave more virulent than strains with pathogenic zymodeme; and the reverse also seems to occur3.

In order to evaluate the behavior of axenic strains of E. histolytica in different virulence assays, five strains were characterized in respect to their ability to produce lesions in hamster liver, cytopathic effect upon VERO cells, erythrophagocytosis rate, isoenzyme pattern and restriction fragments analysis of genes. Although good correlation was observed between in vitro assays, these did not correlate with in vivo assay.

Material and methods

Strains of Entamoeba histolytica

Strains of E. histolytica employed in this study and some of their relevant characteristics are summarized in Table 1. All strains were kept under axenic cultivation in TYI-S-33 medium 9 and they are used in exponential growth phase.

Table 1

Strains of Entamoeba histolytica and its relevant characteristics

Strain Clinical
evaluation Serological
results* Virulence† Pattern of Isoenzyme‡
and RFLP § HM-1: IMSS amoebic dysentery Pos. attenuated Pathogenic ICB-CSP amoebic dysentery Pos. attenuated Pathogenic ICB-462 asymptomatic Neg. low virulence Pathogenic ICB-32 asymptomatic Neg avirulent Pathogenic ICB-RPS asymptomatic Neg avirulent Pathogenic

* Sera were tested with Elisa except for HM-1 tested with IFAT

† Evaluated by inoculation into hamster liver

‡ Pathogenic isoenzyme pattern was characterized by abscence of an alpha band and presence of a beta band in PGM and two fast bands for HK.

§ The restriction fragment lenght polymorphism (RFLP) analysis, considered as pathogenic profile the pattern obtained by digestion of the 482 bp gene by the enzymes Taq I and Xmn I.

In vivo virulence

The ability of trophozoites to induce liver abscess formation in the golden hamster was taken as a parameter for in vivo virulence. Groups of ten golden hamsters, four weeks old, mean weight 70g were used for each strain. Under Pentobarbital anesthesia, laparatomy was performed, and 1 x 106 amoebae suspended in 0.1 mL medium was injected directly into the left lobe of the liver. Six days later the animals were sacrificed and examined for abscessses and for the presence of trophozoites.

Cytopathogenicity

The destruction of cell culture monolayers was taken as a semiquantitative assay for the virulence of the trophozoites in vitro 2. VERO cells growing in Dulbecco modified Eagle’s medium were assayed. Briefly, the cells attached in microtiter plates were exposed to the amoebae. The cells remaining in the wells were stained with methylene blue. The color intensity developed in that wells which were not added trophozoites was used as control (zero per cent of detachment of cells by amoebae). The color intensity was measured at 660 nm in a Shimadzu UV 160A spectrophotometer.

Erythrophagocytosis

The phagocytic capacity was determined as another marker of virulence. The test for erythrophagocytosis was performed according to the method described ty TRISSL et al. 31. Briefly, log-phase trophozoites were adjusted to a concentration of 1 x 106/mL in phosphate buffered saline (PBS). 0.4 mL of this suspension was left to interact for 10, 20 and 30 min with the same volume of a suspension of 1 x 108/mL of heparinazed human erythrocytes, type A, corresponding to a final 1:100 amoeba: erythrocyte ratio. Results were assessed as percent of phagocytic amoebae, as well as the mean number of phagocytized erythrocytes per amoebae.

Isoenzyme Analysis

The zymodeme pattern was analyzed by starch gel electrophoresis for the enzymes: EC1.1.1.40, malic (ME), EC2.7.5.1, phosphoglucomutase (PGM), EC5.3.1.9, glucose phosphate isomerase (GPI) and EC2.7.1.1, hexokinase (HK) which have been employed as markers for invasive and non-invasive strains 26. We analyzed the enzymatic pattern using 20 µL of the extracts which had been stored in liquid nitrogen (-196º C) in bead shape. The gel staining was carried out as previously described 25.

Restriction Fragment Lenght Polymorphisms (RFLP)

The DNA polymorphism of the strains were determined by specific amplification of a 482 bp gene described as useful for differentiate pathogenic and nonpathogenic strains of E. histolytica allowed by their digestion with restriction endonucleases30. Each 20 µL of the reaction mixture contained 0.7 units of Taq polymerase (Cenbiot, Rio Grande do Sul, Brazil), 200µM dNTPs, 10 mM Tris/HCl (pH 9.0), 75mM KCl, 3.3 mM MgCl2, 7 pmol of each primer P1S-17 (5’-GCAACTAGTGTTAGTTA) and P1AS-20 (3’GTTAAAACATATCTTGGAGG) and 10 ng of purified E. histolytica DNA. This mixture was subjected to 30 cycles of specific PCR as described by TANNICH & BURCHARD30. After specific PCR 10 uL of reaction product was digested with restriction endonucleases Acc I, Taq I and Xmn I, under conditions recommended by manufactures (Gibco/BRL). The RFLP was analyzed on 1% agarose gels stained by ethidium bromide.

Statistical Analysis

The concordance between parameters of virulence were statistically evaluated by means of correlation coefficient. A p value of 0.05 was regarded as significant 1.

Results

The results of erythrophagocytosis, cytopathic effect upon VERO cells, abscess formation in hamster liver are stated in Table 2. The profile obtained after restriction endonuclease digestion of the 482 bp gene with AccI, Taq I and Xmn I are shown in the figure 1. All strains showed pathogenic profile. The values for the correlation coefficient (r) for the different parameters are shown in Table 3. Good correltion was found between in vitro assays. The mean number of uptaken erythrocytes by amoebae significantly correlated with cytopathic effect upon vero cells.

Table 2

Virulence characterization of axenic strains of Entamoeba histolytica, by means of erythrophagocytosis, cytopathic effect and abscess formation in hamster liver.

Strain

Erythrophagocytosis *

Cytopathic

effect†

Abscess

formation‡

Percentage of
phagocytic amoebae mean number of
uptaken erythrocytes 10 20 30 10 20 30 HM1:IMSS 89.8 100 99.1 8.1 14.4 13.4 39.2 0 ICB-CSP 88.4 95.3 98.9 4.9 12.7 15.8 41.0 0 ICB-462 79.1 85.6 85.7 4.6 11.7 12.0 29.0 25 ICB-RPS 46.4 83.0 94.5 1.2 5.7 8..5 7.0 0 ICB-32 50.4 48.2 46.4 0.9 2.3 2.2 4.0 0

* Amoebae and erythrocytes, at a 1:100 ratio, were left to interact for 10, 20 or 30 minutes.

† Percentage of destruction of VERO cells by trophozoites at a ameba: cell ratio of 1:1. Incubation carried out for 1 hour.

‡ Percentage of hamster with abscess observed six days after intrahepatic inoculation. Ten hamsters were inoculated for each strain.


Fig. 1. Electrophoretic separation 2% agarose gel containing ethidium bromide of a 482 bp gene amplified by PCR and digested with restriction enzymes. M = DNA size marker (jx174). Lanes 1-5 is showed the strains of E. histolytica: HM1, CSP, 462, RPS and 32 respectively after incubation with restriction enzymes. lanes 6 and 7 are the activity control for Acc I enzyme. Blue script digested (7) and not diggested (6) with this endonucleases.

Parameter 1 Parameter 2 r* P value cytopathic effect 10 min. % phagocytic amebae 0.98 <0.01 20 min. % phagocytic amebae 0.83 NS 30 min. % phagocytic amebae 0.68 NS 10 min. mean number uptaken erythrocytes 0.91 <0.02 20 min. mean number uptaken erythrocytes 0.96 <0.01 30 min. mean number uptaken erythrocytes 0.92 <0.02 Abscesses in hamster liver 0.16 NS Abscesses in hamster liver 10 min. % phagocytic amebae 0.25 NS 20 min. % phagocytic amebae 0.09 NS 30 min. % phagocytic amebae 0.01 NS 10 min. mean number uptaken erythrocytes 0.12 NS 20 min. mean number uptaken erythrocytes 0.26 NS 30 min. mean number uptaken erythrocytes 0.17 NS
TABLE 3

Correlation coefficient taken as an index concordance between different parameters.

* Correlation coefficient

NS, not significant.

No significant correlation was found between percentage of phagocytic amoebae and cytopathic effect, particularly if amoebae and erythrocytes are left to interact for more than 10 minutes. There was very poor correlation between in vitro and in vivo assays. Abscess production in hamster liver did not correlate with mean number of uptaken erythrocytes, percentage of phagocytic amoebae and cytopathic effect upon VERO cells. Isoenzyme and restriction fragments analysis showed all strains in the study to belong to pathogenic pattern (Table 1).

Discussion

The searching for reliable parameters in distinguishing virulent strains of E. histolytica, from non-virulent ones 18, 24, 31 is time-consuming and depends on of several intrinsic amebic properties and/or of host factors. Recently, differences at molecular level have been regarded as good parameters, leading to the acceptance of the dualist theory proposed in 1925 by Brumpt 10. The problem for phenotypic characterization of virulence of E. histolytica "sensu stricto" still deserves investigation since it has been proposed that extreme virulence variability may occur in this parasite 8. The use of biological parameters, both in vivo and in vitro, however, has frequently presented conflicting results 19, 33.

Our results clearly show that poor correlation was found between in vivo and in vitro assays, possibly reflecting that different pathogenetic mechanisms or functions of the parasite are in fact measured. It is understandable the cytopathic effect as a mechanism involved in pathogenicity for animal models with both parenchymal and/or inflammatory cells32 as target cells. The absence of correlation between cytopathic effect and hamster liver abscess formation may be due to the fact these parameters are related to other parasite functions, which cannot be assessed by the cytopathic effect assay, such as its ability to survive to the immune response including complement lysis11, 24 or to interact or degrade the extracellular matrix17, 27, 29. This suggests that these parasite functions may be independently expressed.

MONFORT et al.19 and MONFORT & PEREZ-TAMAIO20 recently discussed the role of erythrophagocytosis assay in evaluating virulence of E. histolytica strains and were not able to find correlation between erythrophagocytosis, assessed as percent of phagocytic amoebae and virulence to hamster liver, leading the authors to argue its validity in evaluating E. histolytica virulence. We demonstrated that when percent of phagocytic amoebae is taken as the variable response, when amoebae and erythrocytes are left to interact for more than 10 minutes, poor correlation is found between erythrophagocytosis and cytopathic effect. Much better correlation is obtained when the mean number of uptaken erythrocytes is taken as variable response for erythrophagocytosis assay. It is not clearly understood how phagocytic function can be related to pathogenic mechanisms involved in vivo virulence20. It is apparent from our study that phagocytic function itself (assessed by percentage of phagocytic amoebae) is poorly correlated to virulence and differences between strains diminish as time of interaction increases. On the other hand, when mean number of uptaken erythrocytes is taken as the variable response, a good correlation is found with cytopathic effect. This response may estimate the velocity of phagocytosis, reflecting this way, probably indirectly, membrane functions of E. histolytica, such as plasticity and remodelling velocity which may be directly related to pathogenic mechanisms, such as, for example, capping and endocytosis of adhered molecules4. Also, a more rapid uptake of erythrocytes by amoebae explains the strong correlation between percent of phagocytic amoebae as ten minutes and cytophatic effect. Our results therefore recommend that the mean number of phagocytized erythrocytes should be taken as the variable response in erythrophagocytosis assay. TSUTSUMI et al.33 considered that phagocytic ability may be taken only as a qualitative marker of pathogenicity of axenic strains of E. histolytica whereas a quantitative estimate of degree of virulence is taken by the production of liver abscesses in hamsters. If one takes this assertive as truth, strains RPS and 32 should be regarded as "non-pathogenic". In fact, these strains were obtained from asymptomatic carriers with negative serology and were never able to induce abscesses in hamster liver. A major disagreement would then arise when one compares isoenzyme and restriction fragments analysis with phagocytic ability. Our study demonstrates that, at least under axenic conditions, extreme differences in virulence indexes can be observed among strains presenting pathogenic patterns in isoenzyme and restriction fragments analysis. To the present, however, there is limited experience of isoenzyme analysis in axenic E. histolytica strains and, to our knowledge, no strain under this condition has ever presented a non pathogenic zymodeme pattern. The analysis of pathogenicity by RFLP shows a pathogenic pattern for all strains, suggesting that this parameter is not good to detect differences in the virulence of E. histolytica even though it may clearly distinguish pathogenic strains (E. histolytica) from nonpathogenic ones (E. dispar) 7, 28, 30.

The discordance in the results observed in the different virulence assays showed that the analysis of virulence estimates of E. histolytica, in biological assays, should take into account probable pathogenic mechanisms or parasite functions assessed. Pathogenic mechanism in amebiasis has been described as a chain of events occurring in the development of invasive disease, which involves different functions such as interaction with intestinal mucus6, secretion of enzymes and/or toxins16, adherence to intestinal epithelial cells21, 23, cytopathic effect upon epithelial2 and/or host inflammatory cells13, interaction with or degradation of extracellular matrix components14, 27, 29, resistance to immune defense mechanisms4, 5, 11, 24. The virulence assays, including animal inoculation, erythrophagocytosis, cytotoxic and cytopathic effect, proteinase and collagenase activities, resistance to complement lysis, and others should be taken as direct or indirect estimates of these functions, which can be independently expressed, leading to the puzzling results observed when comparisons are done between different parameters.

Resumo

Parâmetros de virulência na caracterização de Cepas de Entamoeba histolytica.

A caracterização quanto a virulência das diferentes cepas de E. histolytica foi avaliada através de ensaios in vivo e in vitro. Discrepâncias nesta caracterização têm surgido quando se compara os diferentes ensaios. Avaliamos alguns parâmetros de virulência na caracterização de 5 cepas axênicas de E. histolytica. Estas cepas foram caracterizadas com relação à sua capacidade para induzir abscesso em fígado de hamster, eritrofagocitose e efeito citopático sobre células VERO. Encontramos correlação significante entre os ensaios biológicos in vitro, mas não entre estes com os ensaios in vivo. Boa correlação foi achada entre o efeito citopático e o número médio de eritrócitos ingeridos, mas não com a percentagem de amebas que fagocitaram eritrócitos, mostrando que grande variabilidade pode ser observada no mesmo ensaio, dependendo da variável escolhida. Não foi possível correlacionar isoenzima e padrão de fragmento de restrição com o índice de virulência desde que todas as cepas estudadas apresentaram padrão patogênico. Os resultados discordantes observados nos diferentes ensaios de virulência sugerem que a mesma não deve ser avaliada diretamente. O que de fato está sendo avaliado são as diferentes características biológicas ou funções do parasita, mais do que a própria virulência. Estas características ou funções podem estar relacionadas ou não com mecanismos patogênicos que ocorrem no desenvolvimeto de amebíase invasiva.

Acknowledgements

This work was supported by FAPEMIG, FINEP and CNPq.

References

1. ARMITAGE, P. - Statistical methods in medical research. Oxford, Blackwell Scientific Publications, 1971.

2. BRACHA, R. & MIRELMAN, D. - Virulence of Entamoeba histolytica trophozoites. Effects of bacteria, microaerobic conditions and metronidazole. J. exp. Med., 160: 353-368, 1984.

3. BURCHARD, G.D.; HUFERT, F.T. & MIRELMAN, D. - Characterization of 20 Entamoeba histolytica strains isolated from patients with HIV infection. Infection, 19: 164-169, 1991.

4. CALDERON, J.; MUNOZ, M.A.L. & ACOSTA, H.M. - Surface redistribution and release of antibody induced caps in Entamoeba. J. exp. Med., 151: 184-193, 1980.

5. CALDERON, J. & TOVAR-GALLEGOS, R. - Loss of susceptibility to antibody and complement mediated lysis in E. histolytica. Arch. Invest. méd. (Méx), 11: 241-244, 1980.

6. CHADEE, K.; NDARATHI, C. & KELLER, K. - Binding of proteolytically-degraded human colonic mucin glycoproteins to the Gal Galnac adherence lectin of Entamoeba histolytica. Gut, 31: 890-893, 1990.

7. CLARK, C.G. & DIAMOND, L.S. - Ribosomal RNA genes of pathogenic and nonpathogenic Entamoeba histolytica are distinct. Molec. Biochem. Parasit., 49: 297-302, 1991.

8. CLARK, C.G. & DIAMOND, L.S. - Pathogenicity, virulence and Entamoeba histolytica. Parasit. today, 10: 46-47, 1994.

9. DIAMOND, L.S.; PHILLIPS, B.P. & BARTGIS, I.L. - Virulence of axenically cultivated Entamoeba histolytica. Arch. Invest. med. (Méx), 4: 99-104, 1973.

10. DIAMOND, L.S. & CLARK, C.G. - A redescription of Entamoeba histolytica Schaudinn, 1903 (Emmended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J. Euk. Microb., 40: 340-344, 1993.

11. FLORES - ROMO, L.; TSUTSUMI, V.; ESTRADA-GARCIA, T. et al. - CD 59 (protectin) molecule, resistance to complement, and virulence of Entamoeba histolytica. Trans. roy. Soc. trop. Med. Hyg., 88: 116-117, 1994.

12. GIBODA, M.; DITRICH, O.; VRCHOTOVA, N. et al. - Entamoeba histolytica - the virulence of imported strains. Folia parasit., 37: 9-19, 1990.

13. GUERRANT, R.L.; BRUSH, J.; RAVDIN, J. et al. - Interaction between Entamoeba histolytica and human polymorphonuclear neutrophils. J. infect. Dis., 143:, 83-93, 1981.

14. GUERRERO, M.; LARRIVA-SAHD, J.; ELENA-RAMIREZ, M. et al. - Collagen fibers in liver experimental amoebic lesion. An ultrastructural study. Arch. Invest. méd. (Méx.), 13: 223-231, 1982.

15. KEENE, W.E.; HILDALGO, M.E.; OROZCO, E. et al. - Entamoeba histolytica: correlation of the cytopathic effect of virulent trophozoites with secretion of a cysteine proteinase. Exp. Parasit., 71: 199-206, 1990.

16. LUSHBAUGH, W.B.; HOFBAUER, A.F.; KAIRALLA, A.B. et al.- Proteinase activities of Entamoeba histolytica cytotoxin. Gastroenterology, 87: 17-27, 1984.

17. MAGOS, M.A.; DE LA TORRE, M. & MUNOZ, M.L. - Collagenase activity in clinical isolates of Entamoeba histolytica maintained in xenic cultures. Arch. med. Res., 23: 115-118, 1992.

18. MARTINEZ-PALOMO, A.; GONZALEZ-RORLEZ, A. & DE LA TORRE, M. - Selective agglutination of various strains of Entamoeba histolytica induced by concanavalin. Arch. Invest. méd. (Méx), 39-48, 1973.

19. MONFORT, I.; OLIVOS, A. & PEREZ-TAMAYO, R. - Phagocytosis and proteinase activity are not related to pathogenicity of Entamoeba histolytica. Parasit. Res., 79: 160-162, 1993.

20. MONFORT, I. & PEREZ-TAMAYO, R. - Is phagocytosis related to virulence in Entamoeba histolytica Schaudinn, 1903. Parasit. today, 10: 271-273, 1994.

21. MORA-GALINDO, J.; MARTINEZ-PALOMO, A. & GONZALEZ-ROBLES, A. - Interacción entre Entamoeba histolytica y epitelio cecal del cobayo. Estudio cuantitativo. Arch. Invest. méd (Méx.) 13: 233-243, 1982.

22. OROZCO, E.; GUARNEROS, G.; MARTINEZ-PALOMO, A. et al. - Entamoeba histolytica. Phagocytosis as a virulence factor. J. exp. Med., 158: 1511-1521, 1983.

23. RAVDIN, J.I.; JOHN, J.E.; JOHNSTON, L.I. et al. - Adherence of Entamoeba histolytica trophozoites to rat and human colonic mucosa. Infect. Immun., 28: 292-297, 1985.

24. REED, S.L.; SARGEAUNT, P.G. & BRANDE, A.I. - Resistance to lysis by human serum of pathogenic Entamoeba histolytica. Trans. roy. Soc. trop. Med. Hyg., 77: 248-253, 1983.

25. SARGEAUNT, P.G.; WILLIAMS, J.E. & GREENE, J.D. - The differentiation of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis. Trans. roy. Soc. trop. Med. Hyg., 72: 519-521, 1978.

26. SARGEAUNT, P.G.; JACKSON, T.H.F.G.; WIFFEN, S. et al. - The reliability of Entamoeba histolytica zymodemes in clinical laboratory diagnosis. Arch. Invest. méd. (Méx.), 18: 69-75, 1987.

27. SCHULTE, W. & SCHOLZE, H. - Action of the major protease from Entamoeba histolytica on proteins of the extracellular matrix. J. Protozool., 36: 538-543, 1989.

28. TACHIBANA, H.; KOBAYASHI, S.; PAZ, K.C. et al. - Analysis of pathogenicity by restriction endonucleases digestion of amplified genomic DNA of Entamoeba histolytica isolated in Pernambuco-Brazil. Parasit. Res., 78: 433-436, 1992.

29. TALAMAS-ROHANA, P.; HERNANDEZ, V.I. & ROSALES-ENCINA, J.L. - A beta-I integrin-like molecule in Entamoeba histolytica. Trans. roy. Soc. trop. med. Hyg., 88: 596-599, 1994.

30. TANNICHI, E. & BURCHARD, G.D. - Differentiation of pathogenic and nonpathogenic Entamoeba histolytica by restriction fragments analysis of a single gene amplified in vitro. J. clin. Microbiol., 29: 250-255, 1991.

31. TRISSL, D.; MARTINEZ-PALOMO, A.; DE LA TORRE, M. et al. - Surface properties of Entamoeba: increased rates of human erythrocyte phagocytosis in pathogenic strains. J. exp. Med., 148: 1137-1145, 1978.

32. TSUTSUMI, V.; MENA-LOPEZ, R.; ANAYA-VELASQUEZ, F. et al. - Cellular bases of experimental amebic liver abscess formation. Amer. J. Path., 117: 81-91, 1984.

33. TSUTSUMI, V.; RAMIREZ-ROZALEZ, A.; LANZ-MENDONZA, H. et al. - Entamoeba histolytica: erythrophagocytosis, collagenosis and liver abscess production as virulence markers. Trans. roy. Soc. trop. Med. Hyg., 86: 170-172, 1992.

Recebido para publicação em 08/11/1996

Aceito para publicação em 03/03/1997

References

  • 1. ARMITAGE, P. - Statistical methods in medical research Oxford, Blackwell Scientific Publications, 1971.
  • 2. BRACHA, R. & MIRELMAN, D. - Virulence of Entamoeba histolytica trophozoites. Effects of bacteria, microaerobic conditions and metronidazole. J. exp. Med., 160: 353-368, 1984.
  • 3. BURCHARD, G.D.; HUFERT, F.T. & MIRELMAN, D. - Characterization of 20 Entamoeba histolytica strains isolated from patients with HIV infection. Infection, 19: 164-169, 1991.
  • 4. CALDERON, J.; MUNOZ, M.A.L. & ACOSTA, H.M. - Surface redistribution and release of antibody induced caps in Entamoeba. J. exp. Med., 151: 184-193, 1980.
  • 5. CALDERON, J. & TOVAR-GALLEGOS, R. - Loss of susceptibility to antibody and complement mediated lysis in E. histolytica Arch. Invest. méd. (Méx), 11: 241-244, 1980.
  • 6. CHADEE, K.; NDARATHI, C. & KELLER, K. - Binding of proteolytically-degraded human colonic mucin glycoproteins to the Gal Galnac adherence lectin of Entamoeba histolytica Gut, 31: 890-893, 1990.
  • 7. CLARK, C.G. & DIAMOND, L.S. - Ribosomal RNA genes of pathogenic and nonpathogenic Entamoeba histolytica are distinct. Molec. Biochem. Parasit., 49: 297-302, 1991.
  • 8. CLARK, C.G. & DIAMOND, L.S. - Pathogenicity, virulence and Entamoeba histolytica Parasit. today, 10: 46-47, 1994.
  • 9. DIAMOND, L.S.; PHILLIPS, B.P. & BARTGIS, I.L. - Virulence of axenically cultivated Entamoeba histolytica Arch. Invest. med. (Méx), 4: 99-104, 1973.
  • 10. DIAMOND, L.S. & CLARK, C.G. - A redescription of Entamoeba histolytica Schaudinn, 1903 (Emmended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J. Euk. Microb., 40: 340-344, 1993.
  • 11. FLORES - ROMO, L.; TSUTSUMI, V.; ESTRADA-GARCIA, T. et al. - CD 59 (protectin) molecule, resistance to complement, and virulence of Entamoeba histolytica Trans. roy. Soc. trop. Med. Hyg., 88: 116-117, 1994.
  • 12. GIBODA, M.; DITRICH, O.; VRCHOTOVA, N. et al. - Entamoeba histolytica - the virulence of imported strains. Folia parasit., 37: 9-19, 1990.
  • 13. GUERRANT, R.L.; BRUSH, J.; RAVDIN, J. et al. - Interaction between Entamoeba histolytica and human polymorphonuclear neutrophils. J. infect. Dis., 143:, 83-93, 1981.
  • 14. GUERRERO, M.; LARRIVA-SAHD, J.; ELENA-RAMIREZ, M. et al. - Collagen fibers in liver experimental amoebic lesion. An ultrastructural study. Arch. Invest. méd. (Méx.), 13: 223-231, 1982.
  • 15. KEENE, W.E.; HILDALGO, M.E.; OROZCO, E. et al. - Entamoeba histolytica: correlation of the cytopathic effect of virulent trophozoites with secretion of a cysteine proteinase. Exp. Parasit., 71: 199-206, 1990.
  • 16. LUSHBAUGH, W.B.; HOFBAUER, A.F.; KAIRALLA, A.B. et al.- Proteinase activities of Entamoeba histolytica cytotoxin. Gastroenterology, 87: 17-27, 1984.
  • 17. MAGOS, M.A.; DE LA TORRE, M. & MUNOZ, M.L. - Collagenase activity in clinical isolates of Entamoeba histolytica maintained in xenic cultures. Arch. med. Res., 23: 115-118, 1992.
  • 18. MARTINEZ-PALOMO, A.; GONZALEZ-RORLEZ, A. & DE LA TORRE, M. - Selective agglutination of various strains of Entamoeba histolytica induced by concanavalin. Arch. Invest. méd. (Méx), 39-48, 1973.
  • 19. MONFORT, I.; OLIVOS, A. & PEREZ-TAMAYO, R. - Phagocytosis and proteinase activity are not related to pathogenicity of Entamoeba histolytica Parasit. Res., 79: 160-162, 1993.
  • 20. MONFORT, I. & PEREZ-TAMAYO, R. - Is phagocytosis related to virulence in Entamoeba histolytica Schaudinn, 1903. Parasit. today, 10: 271-273, 1994.
  • 21. MORA-GALINDO, J.; MARTINEZ-PALOMO, A. & GONZALEZ-ROBLES, A. - Interacción entre Entamoeba histolytica y epitelio cecal del cobayo. Estudio cuantitativo. Arch. Invest. méd (Méx.) 13: 233-243, 1982.
  • 22. OROZCO, E.; GUARNEROS, G.; MARTINEZ-PALOMO, A. et al. - Entamoeba histolytica Phagocytosis as a virulence factor. J. exp. Med., 158: 1511-1521, 1983.
  • 23. RAVDIN, J.I.; JOHN, J.E.; JOHNSTON, L.I. et al. - Adherence of Entamoeba histolytica trophozoites to rat and human colonic mucosa. Infect. Immun., 28: 292-297, 1985.
  • 25. SARGEAUNT, P.G.; WILLIAMS, J.E. & GREENE, J.D. - The differentiation of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis. Trans. roy. Soc. trop. Med. Hyg., 72: 519-521, 1978.
  • 26. SARGEAUNT, P.G.; JACKSON, T.H.F.G.; WIFFEN, S. et al. - The reliability of Entamoeba histolytica zymodemes in clinical laboratory diagnosis. Arch. Invest. méd. (Méx.), 18: 69-75, 1987.
  • 27. SCHULTE, W. & SCHOLZE, H. - Action of the major protease from Entamoeba histolytica on proteins of the extracellular matrix. J. Protozool., 36: 538-543, 1989.
  • 28. TACHIBANA, H.; KOBAYASHI, S.; PAZ, K.C. et al. - Analysis of pathogenicity by restriction endonucleases digestion of amplified genomic DNA of Entamoeba histolytica isolated in Pernambuco-Brazil. Parasit. Res., 78: 433-436, 1992.
  • 29. TALAMAS-ROHANA, P.; HERNANDEZ, V.I. & ROSALES-ENCINA, J.L. - A beta-I integrin-like molecule in Entamoeba histolytica Trans. roy. Soc. trop. med. Hyg., 88: 596-599, 1994.
  • 30. TANNICHI, E. & BURCHARD, G.D. - Differentiation of pathogenic and nonpathogenic Entamoeba histolytica by restriction fragments analysis of a single gene amplified in vitro. J. clin. Microbiol., 29: 250-255, 1991.
  • 31. TRISSL, D.; MARTINEZ-PALOMO, A.; DE LA TORRE, M. et al. - Surface properties of Entamoeba: increased rates of human erythrocyte phagocytosis in pathogenic strains. J. exp. Med., 148: 1137-1145, 1978.
  • 32. TSUTSUMI, V.; MENA-LOPEZ, R.; ANAYA-VELASQUEZ, F. et al. - Cellular bases of experimental amebic liver abscess formation. Amer. J. Path., 117: 81-91, 1984.
  • 33. TSUTSUMI, V.; RAMIREZ-ROZALEZ, A.; LANZ-MENDONZA, H. et al. - Entamoeba histolytica: erythrophagocytosis, collagenosis and liver abscess production as virulence markers. Trans. roy. Soc. trop. Med. Hyg., 86: 170-172, 1992.

Publication Dates

  • Publication in this collection
    16 June 1999
  • Date of issue
    Mar 1997

History

  • Received
    08 Nov 1996
  • Accepted
    03 Mar 1997
location_on
Instituto de Medicina Tropical de São Paulo Av. Dr. Enéas de Carvalho Aguiar, 470, 05403-000 - São Paulo - SP - Brazil, Tel. +55 11 3061-7005 - São Paulo - SP - Brazil
E-mail: revimtsp@usp.br
rss_feed Acompanhe os números deste periódico no seu leitor de RSS
Ir para o topo Reportar erro