Open-access Single step polymerase chain reaction (PCR) for the diagnosis of the Leishmania (Viannia) subgenus

Reação de polimerização em cadeia (PCR) em etapa única para diagnóstico de Leishmania do subgênero (Viannia)

Abstract

In Brazil, the main etiologic agent of Leishmaniasis that frequently presents with mucosal involvement belongs to the Viannia subgenus. The therapeutic conduct in this disease depends on the parasitological diagnosis, and classical methods are restricted in identifying the agent. In this paper we describe a polymerase chain reaction (PCR), which uses primers designed from mini-exons repetitive sequences. The PCR amplifies a 177bp fragment that can distinguish (Viannia) from (Leishmania) subgenus. This test could be a useful diagnostic tool.

Leishmaniasis (Viannia); PCR; Identification


Resumo

No Brasil, o principal agente etiológico da leishmaniose, apresentando freqüentemente comprometimento das mucosas, pertence ao subgênero (Viannia). A conduta terapêutica no tratamento da leishmaniose depende de seu diagnóstico parasitológico e os métodos clássicos restringem sua identificação. Neste trabalho, descrevemos uma reação de PCR, utilizando primers desenhados a partir de seqüências repetitivas de mini-exons, que amplificam um fragmento de 177pb e que são capazes de distinguir o subgênero (Viannia) do subgênero (Leishmania), tornando-se uma ferramenta útil no diagnóstico desta doença.


BRIEF COMMUNICATION

Single step polymerase chain reaction (PCR) for the diagnosis of the Leishmania (Viannia) subgenus

Reação de polimerização em cadeia (PCR) em etapa única para diagnóstico de Leishmania do subgênero (Viannia)

Byanca Regina PaivaI, II; Luciana Neves PassosIII; Aloisio FalquetoIII; Rosely dos S. MalafronteI; Heitor Franco de Andrade Jr.I, II

IInstituto de Medicina Tropical de São Paulo, Universidade de São Paulo, São Paulo, SP, Brasil

II Instituto de Ciências Biomédicas, Depto. de Parasitologia, Universidade de São Paulo, São Paulo, SP, Brasil

III Ambulatório de Doenças Infecciosas e Parasitárias do Hospital Universitário Cassiano Antônio de Moraes, Vitoria, ES, Brasil

Correspondence

SUMMARY

In Brazil, the main etiologic agent of Leishmaniasis that frequently presents with mucosal involvement belongs to the Viannia subgenus. The therapeutic conduct in this disease depends on the parasitological diagnosis, and classical methods are restricted in identifying the agent. In this paper we describe a polymerase chain reaction (PCR), which uses primers designed from mini-exons repetitive sequences. The PCR amplifies a 177bp fragment that can distinguish (Viannia) from (Leishmania) subgenus. This test could be a useful diagnostic tool.

Keywords: Leishmaniasis (Viannia); PCR; Identification.

RESUMO

No Brasil, o principal agente etiológico da leishmaniose, apresentando freqüentemente comprometimento das mucosas, pertence ao subgênero (Viannia). A conduta terapêutica no tratamento da leishmaniose depende de seu diagnóstico parasitológico e os métodos clássicos restringem sua identificação. Neste trabalho, descrevemos uma reação de PCR, utilizando primers desenhados a partir de seqüências repetitivas de mini-exons, que amplificam um fragmento de 177pb e que são capazes de distinguir o subgênero (Viannia) do subgênero (Leishmania), tornando-se uma ferramenta útil no diagnóstico desta doença.

INTRODUCTION

Leishmaniasis is the most diverse and complex of all vector borne diseases in terms of both its ecology and epidemiology. Despite the fact that only 30 countries have notified the disease, it is endemic in 88 countries, where a total of 12 million people are infected (WHO, 1998). Ninety percent of all cases of cutaneous leishmaniasis (CL) occur in Iran, Saudi Arabia, Syria, Afghanistan (Old World), Peru and Brazil (South America). In the last 20 years, CL has been increasing in Latin America, particularly in Brazil (DEANE & GRIMALDI Jr., 1985).

In Brazil, six species of Leishmania belonging to (Leishmania) and (Viannia) subgenera are responsible for CL clinical forms in human beings. Viannia subgenus comprises the following species: Leishmania (V.) braziliensis, Leishmania (V.) guyanensis, Leishmania (V.) naiffi, Leishmania (V.) shawi and Leishmania (V.) lainsoni. All these species are present in Brazil, most of them in the Amazon region (GONTIJO & CARVALHO, 2003).

Determining the infecting species is an important step in analyzing epidemiological conditions of transmission and in determining prognosis and adequate chemotherapy. Classical methods, such as microscopic analysis and isolation of the parasites in culture, are laborious and inaccurate as many species are often morphologically indistinguishable (MAGILL, 2000).

Molecular approaches have recently allowed diagnosis based on PCRs. These are usually performed with repeated gene sequences such as mini-exon, kDNA or ribosomal genes (ARANSAY et al., 2000; MICHALSKY et al., 2002; MIRANDA et al., 2002). The nuclear mini-exon genes consist of 200 copies in tandem separated in transcribed and non-transcribed genes. The transcribed region consists of a highly conserved exon with 39 nucleotides and a moderately conserved intron among species of the same genera or subgenera. The non-transcribed region consists of a variable intergenic region among Leishmania species that is absent in vertebrate hosts and vectors (FERNANDES et al., 1994). We designed a new set of primers based on nuclear mini-exon genes and sought amplification based on subgenus Viannia in order to distinguish these subgenera from others and to improve the diagnosis of Leishmaniasis.

MATERIAL AND METHODS

Parasites and positive tissue samples: Strains of (Viannia) subgenus: Leishmania (Viannia) braziliensis MHOM/BR/1975/M2903 and Leishmania (Viannia) guyanensis MHOM/BR/1975/M4147. Strains of Leishmania subgenus: Leishmania (Leishmania) amazonensis IFLA/BR/67/PH8 and Leishmania (Leishmania) chagasi MHOM/BR/1974/PP75(M2682). All were kept in liquid nitrogen or cultivated in supplemented M199 medium, and positive Leishmania human tissue (LW) obtained from the laboratory of Prof. Lucile Floeter Winter, ICB, University of São Paulo, were used.

Reliability of the clinical samples: In order to confirm the sensitivity and specificity of mini-exon primers, a blind test was carried out with 92 samples from Espírito Santo. Seventy-one samples were confirmed as cutaneous Leishmaniasis in clinical, parasitological and epidemiological diagnoses and were stored in formol (LF) or embedded in paraffin (LP). 34 samples were stored in formol and 58 were embedded in paraffin. Of those stored in formol, 21 were related to other dermatological diseases.

DNA extraction: SAMBROOK et al. (1989) phenol/chloroform method or QUIamp (QIAGEN Co.) Kit were used for DNA extraction.

Primer design and PCR assay: Repetitive mini-exon sequences described by DEGRAVE, W. (accession number X69442) were used to design the specific primers for L. (V.) braziliensis. Consensus sequences for each primer were constructed manually and confirmed by DNASTAR-Laser Gene program.

The following primers which amplify a 177bp product were used: Forward (LV1) 5' cgtcttccggcaacattt 3' and Reverse (LV2) 5' cgttagttggaagcccaagg 3'. A 25 ml reaction mixture containing DNA, 1 mM of each primer of 0.2 mM of dNTPs, 2.5% formamide, 1x Taq buffer (Biotools B&M Labs., S.A.) and 0.5 units of Taq DNA polymerase was placed in a thermal cycler (Eppendorf Mastercycler gradient serial No. 5331) at 95 ºC for five minutes for initial denaturation, followed by 35 cycles at 95 ºC for one minute, 55 ºC for 30 seconds, 73 ºC for one minute and then 72 ºC for six minutes for final extension. Products (5 ml each) were electrophoresed on 6% polyacrilamide gel and 1.5% of agarose gel.

Cloning and sequencing - PCR products: PCR products were ligated into pGEM T-Easy vector (Promega), transformed into CaCl2 competent E. coli DH5-a bacteria and plated on LB-ampicillin plates. White colonies were grown overnight on 3 ml LB-amp and plasmids were prepared for sequencing following the procedure for the GFX Micro Plasmid Prep Kit (Amersham/Pharmacia). A minimum of two clones were labeled by Cy5 Autoread Sequencing Kit and sequenced by ALFexpress DNA Sequencer (Pharmacia). Sequences were submitted to Genebank and the results were analyzed.

Sensitivity and specificity assays: The estimated DNA concentration was obtained by comparison of the band from genomic purified Leishmania DNA loaded in a 2% agarose gel with the Low DNA Mass Ladder (Invitrogen), in accordance with the manufacturer's instructions. In order to determine the PCR sensitivity, the reaction was carried out with several DNA concentrations diluted from 18pg to 0.15pg.

The specificity test was analyzed using purified human DNA (from peripheral blood mononuclear cells) and genomic DNAs from Lu. longipalpis and Plasmodium falciparum. DNAs from Kinetoplastida genera, T.cruzi (blood forms) and Crithidia spp (cultured organisms) were also tested.

RESULTS AND DISCUSSION

The correct identification of Leishmania species is crucial, as this will affect the type of clinical survey required. Control of Leishmaniasis requires knowledge of the ecology and the epidemiology of the disease.

The mini-exon genes in Kinetoplastid protozoa are present in 100-200 tandemly repeated copies in the nuclear genome (FERNANDES et al., 1994). This characteristic has been shown to be a useful tool for identifying the subgenus or Leishmania species. Based on these sequences, which were deposited in Genebank (number X69442), a pair of primers (LV1 and LV2) to identify the (Viannia) complex was designed.

In order to standardize the annealing temperature, a gradient of 12 temperatures varying from 45 ºC to 65 ºC was used. Clear fragments were visualized with annealing temperatures of 55 ºC and 58 ºC. We chose 55 ºC as the annealing temperature in our PCR reaction.

The species specific primer was tested, using DNA extracted from the M2903 and M4147 strains of L. (V.) braziliensis and L. (V.) guyanensis respectively and human positive Viannia samples embedded in paraffin and formol (LW, LP and LF) as a positive control. As shown in Figures 1, 2, and 3 a 177bp fragment was amplified. These fragments were cloned, sequenced and (Viannia) subgenus was confirmed by Genebank analysis. The specificity assay was carried out and LV1 and LV2 primers did not amplify DNA from L. (L.) amazonesis and L. (L.) chagasi or other microorganisms such as P. falciparum, T. cruzi, Crithidia sp, human DNA and Phlebotomus sp. DNA (Lu. longipalpis) (Fig. 3). In the blind test using LV1 and LV2 primers, 62.1% (36/58) and 46.1% (6/13) of LP and LF respectively were PCR positive. Of the negative samples, all PCRs but one were negative.



PCR reaction detected as little as 0.15pg of Leishmania DNA, but this detection varied according to the DNA sample. Our reaction was able to detect 1.5 parasites, as MYLER& STUART (2000) reported that one Leishmania contains 100fg of DNA.

Several authors reported molecular approaches for identifying the subgenus and species of Leishmania (CASTILHO et al., 2003; RODRIGUES et al., 2002; UEZAT et al., 2001; FERNANDES et al., 1999) but some of these methods are either laborious or the DNA sequences used as target are usually present as single or low copy. Based on these reports, a comparison was undertaken between LV1 and LV2 mini-exon PCR and PCR-RFLP (VOLPINI et al., 2004). Leishmaniasis LP samples were tested for PCR-RFLP and 44% (25/58) were found to be positive for (Viannia) subgenus (PAIVA et al., 2003). These results are similar to those from LV1 and LV2 mini-exon primers. PCR-RFLP, however, needs a two-step PCR reaction to identify the Leishmania subgenus whereas the LV1 and LV2 mini-exon primers can identify (Viannia) subgenus parasites in only one step.

Based on these results, we believe that LV1 and LV2 primers could be useful in identifying (Viannia) complex. Studies using laboratory-infected sandflies are being carried out. Once the laboratory reaction has been standardized our next goal is to use these primers to detect infected sandflies in the field.

ACKNOWLEDGEMENTS

We wish to thank Prof. Lucile Floeter Winter (Instituto de Ciências Biomédicas/USP) for providing the culture and Leishmania tissue samples. CNPq, CAPES and LIM 49 supported this work.

17. WHO/OMS (http://www.who.int/emc/diseases/leish/leidis.html) 1998.

Received: 13 May 2004

Accepted: 18 October 2004

References

  • 1. ARANSAY, A.M.; SCOULICA, E. & TSELENTIS, Y. - Detection and identification of Leishmania DNA within naturally infected sand flies by seminested PCR on minicircle kinetoplastic DNA. Appl. environ. Microbiol., 66: 1933-1938, 2000.
  • 2. CASTILHO, T.M.; SHAW, J.J. & FLOETER-WINTER, L.M. - New PCR assay using glucose-6-phosphate dehydrogenase for identification of Leishmania species. J. clin. Microbiol., 41: 540-546, 2003.
  • 3. DEANE, L. & GRIMALDI Jr., G. - Leishmaniasis in Brazil. In: CHANG, K.-P., ed. Leishmaniasis. Berlin, Elsevier, 1985. p. 247-280.
  • 4. DEGRAVE, W.; FERNANDES, O.; CAMPBELL, D.; BOZZA, M. & LOPES, V. - Use of molecular probes and PCR for detection and typing of Leishmania: a mini-review. Mem. Inst. Oswaldo Cruz, 89: 463-469, 1994.
  • 5. FERNANDES, O.; MURTHY, V.K.; KURATH, U.; DEGRAVE, W.M. & CAMPBELL, D.A. - Mini-exon gene variation in human pathogenic Leishmania species. Molec. Biochem. Parasit., 66: 261-271, 1994.
  • 6. GONTIJO, B. & CARVALHO, M.L.R. - Leishmaniose tegumentar americana. Rev. Soc. bras. Med. trop., 36: 71-80, 2003.
  • 7. MARFURT, J.; NIEDERWIESER, I.; MAKIA, N.D.; BECK, H.-P. & FELGER, I. - Diagnostic genotyping of Old and New World Leishmania species by PCR-RFLP. Diagn. Microbiol. infect. Dis., 46: 115-124, 2003.
  • 8. MAGILL, A.J. - Leishmaniasis. In: STRICKLAND, G.T., ed. Hunter's tropical Medicine and emerging infectious diseases. 8. ed. Philadelphia, W.B. Sauders, 2000. p. 665-687.
  • 9. MICHALSKY, E.M.; FORTES-DIAS, C.L.; PIMENTA, P.F.P.; SECUNDINO, N.F.C. & DIAS, E.S. - Assessment of PCR in the detection of Leishmania spp in experimentally infected individual phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae). Rev. Inst. Med. trop. S. Paulo, 44: 255-259, 2002.
  • 10. MIRANDA, J.C.; REIS, E.; SCHRIEFER, A. et al - Frequency of infection of Lutzomyia phlebotomines with Leishmania braziliensis in a Brazilian endemic area as assessed by pinpoint capture and polymerase chain reaction. Mem. Inst. Oswaldo Cruz, 97: 185-188, 2002.
  • 11. MYLER, P.J. & STUART, K.D. - Recent developments from the Leishmania genome project. Curr. Opin. Microbiol., 3: 412-416, 2000.
  • 12. PAIVA, B.R.; PASSOS, L.N.; FALQUETO, A. et al - Leishmania species-specific PCR in paraffin embedded skin biopsies from cutaneous Leishmaniasis from the Espírito Santo state, as compared to other molecular biology approaches. Rev. Inst. Med. trop. S. Paulo, 45 (suppl. 13): 171, 2003.
  • 13. RODRIGUES, G.H.E.; BRITO, F.E.M.; MENDONÇA, G.M. - Evaluation of PCR for diagnosis of American cutaneous Leishmaniasis in an area of endemicity in northeastern Brazil. J. clin. Microbiol., 40: 3572-3576, 2002.
  • 14. SAMBROOK, J.; FRITSCH, W.F. & MANIATS, T. - Molecular cloning: a laboratory manual. New York, Cold Spring Harbor Laboratory, 1989.
  • 15. UEZAT, H.; TAKEI, K.; MARUNP, M. et al - Detection of species of the subgenus Leishmania parasites using polymerase chain reaction and southern blotting. J. Derm., 28: 475-480, 2001.
  • 16. VOLPINI, A.C.; PASSOS, V.M.; OLIVEIRA, G.C. & ROMANHA, A.J. - PCR-RFLP to identify Leishmania (Viannia) braziliensis and L. (Leishmania) amazonensis causing American cutaneous Leishmaniasis. Acta trop. (Basel), 90: 31-37, 2004.
  • Correspondence to
    Byanca Regina Paiva
    Instituto de Medicina Tropical de São Paulo
    Av. Dr. Enéas de Carvalho Aguiar 470
    05403-000 São Paulo, SP, Brazil
    Phone: +55.11.30667017
  • Publication Dates

    • Publication in this collection
      10 Jan 2005
    • Date of issue
      Dec 2004

    History

    • Received
      13 May 2004
    • Accepted
      18 Oct 2004
    location_on
    Instituto de Medicina Tropical de São Paulo Av. Dr. Enéas de Carvalho Aguiar, 470, 05403-000 - São Paulo - SP - Brazil, Tel. +55 11 3061-7005 - São Paulo - SP - Brazil
    E-mail: revimtsp@usp.br
    rss_feed Acompanhe os números deste periódico no seu leitor de RSS
    Ir para o topo Reportar erro