SciELO - Scientific Electronic Library Online

 
vol.36 issue1Development of Oidium neolycopersici on Lycopersicon genotypesEffect of the air speed in sleeve boom on pesticide spray deposition, severity and soybean crop yield author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Summa Phytopathologica

Print version ISSN 0100-5405

Summa phytopathol. vol.36 no.1 Botucatu Jan./Mar. 2010

http://dx.doi.org/10.1590/S0100-54052010000100007 

ARTIGOS ARTICLES

 

Variabilidade genética entre isolados de Colletotrichum gossypii do algodoeiro

 

Genetic variability among the isolates of Colletotrichum gossypii of cotton

 

 

Yeshwant R. MehtaI; Angela MehtaII, 1

IIAPAR, C.P. 481, Londrina, PR
IIEMBRAPA-CENARGEN, PqEB Av. W/5 Norte Final, Brasília, DF, CEP 70770-900

 

 


RESUMO

O algodoeiro é atacado por Colletotrichum gossypii (CG) e C. gossypii var. cephalosporioides (CGC). Ambos os patógenos são transmitidos pela semente e sua distinção morfológica é extremamente difícil e inconsistente. Tentativas foram feitas no presente trabalho para verificar a variabilidade genética entre CG e CGC através de RAPD-PCR, ERIC- e REP-PCR e PCR-RFLP da região ITS rDNA. Foram utilizados 53 isolados coletados de sementes e folhas de plantas de diferentes cultivares nos estados do Paraná, São Paulo, Mato Grosso, Minas Gerais, e Paraiba, entre 1999 e 2003. Baseado em testes de patogenicidade, vinte e um isolados foram classificados como CG e 32 como CGC. Os resultados obtidos por RAPD-PCR, utilizando-se oito primers, revelaram dois grupos distintos sendo que o primeiro foi formado por 94% dos isolados de sementes e o segundo por 95% dos isolados de folhas. Na análise de ERIC- e REP-PCR, resultados semelhantes a RAPD foram obtidos, sendo que o primeiro grupo foi formado por 93% dos isolados provenientes das sementes e o segundo por 78% dos isolados provenientes das folhas. Quando o produto de amplificação da região ITS rDNA foi digerido com oito enzimas de restrição, um perfil de bandas semelhante para todos os isolados foi obtido. Resultados de RAPD, ERIC- e REP-PCR demonstraram que existem diferenças genéticas entre os isolados provenientes das sementes e aqueles provenientes de parte aérea, e esses dois grupos foram claramente distintos. Estudos futuros devem ser realizados utilizando outras técnicas moleculares para a obtenção de marcadores capazes de distinguir entre isolados de CG e CGC.

Palavras-chave adicionais: Gossypium hirsutum, ramulose, variabilidade genética, análise molecular


ABSTRACT

Cotton is attacked by Colletotrichum gossypii (CG) and C. gossypii var. cephalosporioides (CGC). Both the pathogens are transmitted by seed and their morphological distinction is extremely difficult and inconsistent. In the present study, attempts were made to verify the genetic variability among 53 isolates of CG and CGC using RAPD-PCR, ERIC- and REP-PCR, as well as PCR-RFLP of the ITS rDNA region. Based on pathogenicity tests, 21 isolates were classified as CG and 32 as CGC. RAPD analysis was performed using eight primers and the results revealed two major groups. The first group contained 94% of the isolates originated from seeds and the second contained 95% of the isolates originated from leaves. Similar results were obtained by ERIC- and REP-PCR, where the first group contained 93% of the isolates originated from seeds and the second contained 78% of the isolates originated from leaves. When the amplified product of the ITS rDNA region was digested with eight restriction enzymes, similar banding patterns were observed for all isolates. Results of RAPD, ERIC- and REP-PCR demonstrated the existence of genetic variability among the seed and leaf isolates and these two groups could be clearly distinguished. Further studies need to be performed using other molecular techniques in order to obtain markers that can distinguish CG and CGC isolates in infected seeds.

Keywords: Gossypium hirsutum, ramulosis, genetic variability, molecular analysis


 

 

O algodoeiro é uma cultura de grande expressão econômica para o Brasil. Entretanto, esta cultura é afetada por várias pragas e patógenos, incluindo os fungos Colletotrichum gossypii (CG) e C. gossypii var. cephalosporioides (CGC). O primeiro causa a antracnose e ataca o sistema radicular das plântulas e as maçãs, porém normalmente não causa danos econômicos para a cultura. CGC é responsável pela ramulose e ataca toda a parte aérea da planta, provocando severos danos no rendimento do algodão. Ambos os patógenos são transmitidos pela semente e são morfologicamente semelhantes e portanto sua distinção é extremamente difícil (9). A precisão na identificação entre CG e CGC é necessária para que apenas os lotes de sementes livres de CGC sejam liberados para o plantio. Num trabalho preliminar, Mehta et al (9), utilizando os critérios morfológicos sugeridos por Pizzinatto & Tanaka (12) e Tanaka et al (16), e também utilizando a técnica molecular de ERIC- e REP-PCR, não distinguiram os isolados de CG e CGC. Posteriormente, Silva-Mann et al (14, 15), estudaram a variabilidade genética entre três isolados de CG e oito isolados de CGC utilizando a técnica de RAPD e AFLP e indicaram a potencialidade desses métodos para a distinção entre esses patógenos. Entretanto, devido à existência de variação entre os isolados de CG e CGC, a utilização de um número maior de isolados se faz necessária.

Técnicas moleculares têm sido amplamente utilizadas para a determinação de variabilidade genética e distinção de isolados de fungos (2, 3). A técnica de RAPD tem sido muito empregada para estudos de diversidade uma vez que estes marcadores detectam uma maior variabilidade genética. RAPD foi utilizado para a análise de espécies de fungos como Fusarium oxysporum f. sp. ciceris e raças e patótipos puderam ser distinguidos (5, 6). Recentemente, os primers ERIC ("Enterobacterial Repetitive Intergenic Consensus") e REP ("Repetitive Extragenic Palindromic"), inicialmente desenvolvidos para a análise de diversidade genética em bactérias (17), foram utilizados para a distinção de isolados de Drechslera avenae e Stemphylium solani (10). Foi demonstrado que estes primers não anelam em regiões repetitivas no genoma desses fungos, entretanto, a técnica de ERIC- e REP-PCR, comumente chamada de rep-PCR, representa uma alternativa ao RAPD para acessar a diversidade genética em fungos (10).

Neste trabalho, tentativas foram feitas para verificar a variabilidade genética entre CG e CGC através de três técnicas moleculares (RAPD, rep-PCR e PCR-RFLP da região ITS rDNA) utilizando 53 isolados coletados de sementes e folhas entre 1999 e 2003, de diferentes estados produtores de algodão no Brasil.

 

MATERIAL E MÉTODOS

Coleção dos isolados: Cinqüenta e três isolados monospóricos foram obtidos de folhas e sementes nos estados do Paraná, São Paulo, Mato Grosso, Goiás e Paraíba, abrangendo 12 cultivares do algodoeiro. Um isolado previamente identificado como CG (No. 32) fornecido por M.A. Pizzinatto, IAC, Campinas e outro como CGC (No. 7) da coleção do IAPAR, também foram incluídos nos testes de patogenicidade como testemunhas para comparação (Tabela 1). O teste de patogenicidade de todos os isolados foi realizado em casa de vegetação na cultivar suscetível IAPAR 71, na fase de plântula com idade de 20 dias (9). A concentração de conídios foi ajustada para 106 conídios. L-1 e logo após a inoculação, as plantas foram incubadas em câmara de crescimento a 21°C por 24 h, sob umidade relativa de ar de quase 100%. Após este período, as plantas foram transferidas para casa de vegetação. A presença de sintomas típicos da ramulose nas folhas foi avaliada 8 dias após a inoculação e a severidade da doença foi avaliada como porcentagem da área foliar infectada (AFI), utilizando uma escala visual de severidade entre 0 e 99% da AFI. O teste de patogenicidade foi repetido uma vez, principalmente com os isolados que não produziram nenhum sintoma da doença na primeira inoculação. A distinção entre CGC e CG foi baseada na sua patogenicidade ou não em algodoeiro, respectivamente.

 

 

Extração de DNA: Um total de 53 isolados monospóricos foram cultivados no escuro em meio líquido "batata dextrose" em um agitador por 4 dias a 21º C. O micélio foi filtrado através de papel de filtro Whatman No. 1, lavado duas vezes com tampão TE (10 mM Tris-HCl; 1 mM EDTA, pH 8.0) e o DNA total foi extraído de acordo com Doyle & Doyle (1). O DNA foi quantificado através de DyNa Quant 200 Fluorometer (Pharmacia) e a qualidade foi confirmada através de eletroforese em gel de agarose 1%. Amostras de DNA foram diluídas em tampão TE (Tris-HCl 10 mM, EDTA 1 mM) para uma concentração de 20 ng.mL-1 e estocadas a -20º C. O RNA foi eliminado utilizando-se RNAase (1,0 mg.mL-1).

RAPD: A amplificação de DNA foi realizada em um Termociclador (MJ Research, Inc. Watertown, MA, EUA), conforme descrito anteriormente (7, 8). Um total de 65 primers decâmeros fornecidos pela Operon Technologies Inc. (Alameda, CA, USA) foram testados com 6 isolados (3 de CGC e 3 de CG) selecionados ao acaso. Sete primers foram selecionados baseado na amplificação de um maior número de bandas, sejam monomórficas ou polimórficas. Posteriormente, estes primers selecionados foram utilizados para os ensaios de RAPD com todos os 53 isolados. Os primers selecionados foram: OPH-3 (AGACGTCCAC), OPH-5 (AGTCGTCCCC), OPH-8 (GAAACACCCC), OPI-13 (CTGGGGCTGA), OPI-18 (TGCCCAGCCT), OPJ-10 (AAGCCCGAGG), OPK-7 (AGCGAGCAAG). Os produtos de amplificação foram submetidos a eletroforese em gel de agarose e visualizados em luz UV após coloração com brometo de etídio. Os dados foram analisados considerando a presença e ausência das bandas. A matriz de distância foi construída através do programa UPGMA ("unweighted pair group method with arithmetic mean"), utilizando o coeficiente de Jaccard, com o programa NTSYS-pc, versão 1.8 (13).

ERIC- and REP-PCR: Os primers REP1/REP2 e ERIC1/ERIC2 foram adquiridos da Life Technologies, e foram utilizados para amplificar o DNA dos isolados. As sequências dos primers são: ERIC1R-5'ATGTAAGCTCCTGGGGTTCAC3'; ERIC2-5' AAGTAAGTGACTGGGGTGAGCG3'; REP1R-15'IIICGICGICATCIGGC3';REP2-I-5' ICGICTTATCIGGCCTAC3' (10, 11). As reações de PCR foram realizadas em um volume final de 25 ml contendo 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 200 mM de dNTP, 1.3 ml de BSA (1%), 50 picomoles de cada primer, 100 ng de DNA genômico, e 1 U de Taq polymerase (Pharmacia). A amplificação foi realizada em um Termociclador (MJ Research, Inc. Watertown, MA, EUA), conforme descrito anteriormente (11). Os produtos amplificados foram submetidos à eletroforese em gel de agarose 2% com tampão TBE, e corados com brometo de etídio. Os dados de ERIC/REP-PCR foram agrupados e analisados conforme descrito anteriormente para RAPD.

PCR-RFLP da região ITS rDNA: Todos os 53 isolados foram também analisados através de PCR-RFLP da região espaçadora ITS rDNA, de acordo com Mehta (7). Os produtos de amplificação foram digeridos utilizando-se oito enzimas de restrição selecionadas ao acaso (Alu I, Bam H1, Bgl II, Dra I, Eco R1, Hae III, Hind III, e Pst I). A digestão foi realizada em um volume total de 20 ml contendo 1.5 ml de enzima de restrição, conforme as instruções do fabricante. Os produtos da digestão foram separados através de eletroforese em gel de agarose (2%). Todas as amplificações e digestões foram repetidas uma vez para confirmar os resultados.

 

RESULTADOS E DISCUSSÃO

Neste estudo, isolados de CG e CGC foram analisados utilizando diferentes técnicas moleculares, visando a distinção entre esses isolados. Inicialmente, foi realizado um teste de patogenicidade nos 53 isolados coletados para a classificação em CG e CGC, uma vez que a distinção morfológica é extremamente difícil e inconsistente. Foram identificados 21 isolados como CG e 32 como CGC, considerando a presença ou ausência dos sintomas da doença nas folhas. Os isolados de CGC produziram sintomas típicos de ramulose nas folhas, enquanto que, os isolados de CG não produziram nenhum sintoma ou, ocasionalmente, produziram algumas manchas circulares nas folhas novas com halo amarelado não ultrapassando 2 mm de diâmetro. As inoculações foram repetidas e os resultados obtidos foram consistentes, confirmando a classificação realizada.

Uma vez realizada a classificação dos isolados em CG e CGC, todos os 53 isolados foram utilizados para extração de DNA e posterior análise molecular. As análises de RAPD utilizando-se sete primers revelaram perfis de bandas distintos para dois grupos de isolados (Fig. 1). O primeiro grupo foi formado por 34 isolados, dos quais 19 foram identificados como CG (95%) e 15 como CGC (44%), baseado no teste de patogenicidade. O segundo grupo foi formado por 19 isolados, dos quais um foi identificado como CG (5%) e 18 como CGC (95%). Um dendrograma com os dados combinados dos 7 primers utilizados revelou dois grupos claramente distintos entre si a aproximadamente 75% de similaridade (Fig. 2). O primeiro grupo foi formado por 94% dos isolados das sementes e o segundo grupo por 95% dos isolados das folhas (Fig. 2).

 

 

 

 

Uma análise através de ERIC- e REP-PCR foi também realizada e resultados semelhantes aos observados em RAPD foram obtidos. Novamente um grupo foi formado por 30 isolados provenientes das sementes, dos quais 18 (60%) foram identificados como CG e 12 (40%) como CGC. O segundo grupo foi formado por 23 isolados dos quais, 3 (13%) foram identificados como CG e 20 (87%) como CGC (Fig. 3). O dendrograma construído utilizando os dados combinados de ERIC- e REP-PCR revelou um grupo formado por 93% dos isolados provenientes das sementes e um segundo grupo formado por 78% dos isolados provenientes das folhas (Fig. 4).

 

 

 

 

De maneira geral, os resultados obtidos por ERIC- e REP-PCR obtidos neste estudo, confirmam a eficiência desta metodologia como uma alternativa ao RAPD no estudo da variabilidade genética entre isolados de fungos. Mehta et al (10, 11) estudaram a diversidade genética entre os isolados de Drechslera avenae e Stemphylium solani da aveia e do algodoeiro respectivamente, através de ERIC- e REP-PCR e sequenciamento da região ITS rDNA. Foi reportado que as regiões amplificadas pelos primers ERIC e REP não são repetitivas e que os primers anelam em regiões não caracterizadas nos genomas de D. avenae e S. solani (10, 11). Os autores concluíram que os primers ERIC e REP anelam de maneira semelhante aos primers usados no método de RAPD. A técnica de ERIC- e REP-PCR foi inicialmente utilizada para bactérias fitopatogênicas (17), sendo altamente reproduzível e em anos recentes também está sendo utilizada para fungos fitopatogênicos (10, 11).

A análise da região ITS rDNA, também realizada neste estudo, revelou um produto de amplificação de aproximadamente 600 pb para todos os 53 isolados de CG e CGC. Entre as enzimas de restrição utilizadas, apenas Hinf I, Hae III, Bam HI e EcoR I digeriram o produto de amplificação. Entretanto, o perfil de digestão obtido foi semelhante para todos os isolados. A digestão com as enzimas de restrição Hinf I e EcoR I, revelaram uma banda de 400 pb e uma de 200 pb, a enzima Bam HI revelou um fragmento de 500 pb e outro de 100 pb, enquanto que a enzima Hae III revelou três bandas de 280 pb, 180 pb e 140 pb. Estes resultados demonstram que a região ITS é muito conservada para esses patógenos e portanto sua utilização não é adequada para acessar a diversidade genética em isolados de CG e CGC.

Os resultados obtidos no presente trabalho demonstram que as três técnicas moleculares utilizadas (RAPD, ERIC- e REP-PCR e PCR-RFLP da região ITS rDNA) não são suficientes para distinguir isolados de CG e CGC. Estudos futuros devem ser realizados utilizando-se outras técnicas moleculares e patológicas para esta finalidade. Além disso, a classificação dos isolados de CG e CGC deverá ser complementada por testes de virulência utilizando-se um conjunto de cultivares diferenciadoras para este patógeno, que é bastante desejável para futuras investigações.

As análises de RAPD, ERIC- e REP-PCR demonstraram que existem diferenças entre os isolados provenientes das sementes e aqueles provenientes da parte aérea da planta, Este resultado é intrigante e indica uma diferenciação entre os isolados baseada na capacidade de colonização de tecidos específicos da planta. Estudos futuros devem ser realizados para verificar as regiões no genoma sendo amplificadas pelos primers utilizados neste estudo. A determinação destas regiões poderá revelar informações interessantes a respeito da especificidade de colonização dos isolados de CG e CGC.

 

AGRADECIMENTOS

A assistência técnica foi proporcionada por Ademar Sabino Sousa.

 

REFERÊNCIAS BIBLIOGRÁFICAS

01. Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissues. Focus, USA. v. 12, p. 13-15. 1990.         [ Links ]

02. Hong, S.G.; Maccaroni, M.; Figuli, P.J.; Pryor, B.M., Belisario, A. Polyphasic classification of Alternaria isolated from hazelnut and walnut fruit in Europe. Mycological Research, Cambridge, v. 110, p. 1290-300. 2006.         [ Links ]

03. Jana, T.; Sharma, T.R.;;; Prasad, R.D.; Arora, D.K. Molecular characterization of Macrophomina phaseolina and Fusarium species by a single primer RAPD technique. Microbiological Research, Cambridge, v. 158, p. 249-57. 2003.         [ Links ]

05. Jiménez-Gasco, M.M.; Pérez-Artés, E.; Jiménez-Díaz, R.M. Identification of pathogenic races 0, 1B/C, 5, and 6 of Fusarium oxysporum f. sp. ciceris with random amplified polymorphic DNA (RAPD). European Journal of Plant Pathology, Wageningen, Netherlands, v. 107, p. 237-248. 2001.         [ Links ]

06. Kelly, A.G.; Alcalá-Jiménez, A.R.; Bainbridge, B.W., Heale J.B.; Pérez-Artés, E.; Jiménez-Díaz, R.M. Use of genetic fingerprinting and random amplified polymorphic DNA to characterize pathotypes of Fusarium oxysporumf. sp. ciceris infecting chickpea. Phytopathology, Davis, USA, v. 84, p. 1293-1298. 1994.         [ Links ]

07. Mehta, Y.R. Molecular and pathogenic variability of Drechslera isolates from oats. Fitopatologia Brasileira, Brasília, v. 26, p. 590-596. 2001a.         [ Links ]

08. Mehta, Y.R. Genetic diversity among isolates of Stemphylium solani from cotton. Fitopatologia Brasileira, Brasília, v. 26, p. 703-709. 2001b.         [ Links ]

09. Mehta, Y.R.; Avanzi, C.A.,Calvgo, E. Molecular characterization of Colletotrichum gossypii isolates from cotton. In: Congresso Brasileiro de Algodão, 3., 2001. Anais. Embrapa Agropecuaria Oeste: Mato Grosso, p. 32-35. (resumo). 2001.         [ Links ]

10. Mehta, A.; Mehta, Y.R., Rosato, Y.B. ERIC- and REP_PCR amplify non-repetitive fragments from the genome of Drechslera avenae and Stemphylium solani. FEMS Microbiology Letters, Birmingham, v. 211, p. 51-55. 2002a.         [ Links ]

11. Mehta, Y.R.; Mehta, A., Rosato, Y.B. ERIC and REP-PCR banding patterns and sequence analysis of the internal transcribed spacer of rDNA of Stemphylium solani isolates from cotton. Current Mycrobiology, Oxford, v. 44, p. 323-328, 2002b.         [ Links ]

12. Pizzinatto, M.A.; Tanaka, M.A.S. Método para identificação de Colletotrichum gossypii e C. gossypii var. cephalosporioides em sementes de algodoeiro baseado no hábito de crescimento. II. Avaliação em casa de vegetação. Summa Phytopathologica, Piracicaba, v. 22, p. 122-127, 1996.         [ Links ]

13. Rohlf, F.J. NTSYS-Pc. Numerical Taxonomy and Multivariable Analysis System, Version 1.50. New York: New Yorker Exeter Publisher, 1989.         [ Links ]

14. Silva-Mann, R.; Salgado, K.C.C.; Vieira, M.G.G.C.; Machado, J.C. Variabilidade genética de isolado de complexo Colletotrichum associados a sementes de algodoeiro, por meio de técnicas moleculares e inoculações em plantas. Fitopatologia Brasileira, Brasília, v.27, p.27-32, 2002.         [ Links ]

15. Silva-Mann, R.; Vieira, M.G.G.C.; Machado, J.C.; Bernardinho Filho, J.R.; Salgado, K.C.C.; Stevens, M.R. AFLP markers differentiate isolates of Colletotrichum gossypii from C. gossypii var. cephalosporioides. Fitopatologia Brasileira, Brasília, v.30, No. 2, p. 169-172, 2005.         [ Links ]

16. Tanaka, M.A.S.; Pizzinatto, M.A.; Soave, J. Método para identificação de Colletotrichum gossypii e C. gossypii var. cephalosporioides em sementes de algodoeiro baseado no hábito de crescimento. I. Avaliação em laboratório. Summa Phytopathologica, Piracicaba, v. 22, p.116-122, 1996.         [ Links ]

17. Versolovic, J.; Koeuth, T.; Lupski, J.R. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Research, Oxford, v. 19, p. 6823-6831, 1991.         [ Links ]

 

 

Data de chegada: 11/12/2006.
Aceito para publicação em: 28/09/2009.

 

 

1 Autor para correspondência: Angela Mehta (amehta@cenargen.embrapa.br)

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License