Abstract
HLA class II genes are strongly associated with susceptibility and resistance to insulin-dependent diabetes mellitus (IDDM). The present study reports the HLA-DRB1 genotyping of 41 IDDM patients and 99 healthy subjects from the Southeast of Brazil (Campinas region). Both groups consisted of an ethnic mixture of Caucasian, African Negro and Amerindian origin. HLA-DRB1*03 and *04 alleles were found at significantly higher frequencies among IDDM patients compared to the controls (DRB1*03: 48.8% vs 18.2%, P<0.005, RR = 4.27; DRB1*04: 43.9% vs 15.1%, P<0.008, RR = 4.37) and were associated with a susceptibility to the disease. DRB1*03/*04 heterozygosity conferred a strong IDDM risk (RR = 5.44). In contrast, the HLA-DRB1*11 allele frequency was lower among IDDM patients (7.3% vs 26.3% in controls), but the difference was not significant. These data agree with those described for other populations and allow genetic characterization of IDDM in Brazil
insulin-dependent diabetes mellitus; genetic markers; DNA typing; HLA-DRB1
Braz J Med Biol Res, March 1998, Volume 31(3) 365-368
Distribution of HLA-DRB1 alleles in a mixed population with insulin-dependent diabetes mellitus from the Southeast of Brazil
S.B.D. Marques1, W. Volpini2, S. Caillat-Zucman3, S.R. Lieber1, E.J. Pavin2 and L.B. Persoli1
1Laboratório de Histocompatibilidade do Hemocentro and 2Disciplina de Endocrinologia, Hospital das Clínicas, Universidade Estadual de Campinas, Campinas, SP, Brasil
3INSERM U-25, Hôpital Necker, Paris, France
Abstract
Introduction
Material and Methods
Results
Discussion
References
HLA class II genes are strongly associated with susceptibility and resistance to insulin-dependent diabetes mellitus (IDDM). The present study reports the HLA-DRB1 genotyping of 41 IDDM patients and 99 healthy subjects from the Southeast of Brazil (Campinas region). Both groups consisted of an ethnic mixture of Caucasian, African Negro and Amerindian origin. HLA-DRB1*03 and *04 alleles were found at significantly higher frequencies among IDDM patients compared to the controls (DRB1*03: 48.8% vs 18.2%, P<0.005, RR = 4.27; DRB1*04: 43.9% vs 15.1%, P<0.008, RR = 4.37) and were associated with a susceptibility to the disease. DRB1*03/*04 heterozygosity conferred a strong IDDM risk (RR = 5.44). In contrast, the HLA-DRB1*11 allele frequency was lower among IDDM patients (7.3% vs 26.3% in controls), but the difference was not significant. These data agree with those described for other populations and allow genetic characterization of IDDM in Brazil.
Key words: insulin-dependent diabetes mellitus, genetic markers, DNA typing, HLA-DRB1
Insulin-dependent diabetes mellitus (IDDM) is an autoimmune syndrome resulting from the destruction of pancreatic ß cells by autoreactive T lymphocytes (1,2). The development of the disease involves the interaction of multiple genes and environmental factors (1,2). Several studies have indicated a prominent role for major histocompatibility complex (MHC) genes on chromosome 6 in conferring susceptibility and resistance to IDDM in a variety of human populations (3-5). In particular, the class II HLA region that encodes molecules involved in antigen presentation to CD4+ T cells represents the strongest genetic marker for the disease (3-5). The association of IDDM with the HLA-DR specificities DR3 and DR4 was initially demonstrated by serological HLA analysis (6-8). HLA genotyping has now confirmed these data and has also facilitated the identification, in Caucasians, of the two most strongly predisposing haplotypes, the DRB1*03-DQA1*0501-DQB1*0201, and DRB1*04-DQA1*0301-DQB1*0302 (3).
The genetic basis of IDDM has been poorly investigated in the Brazilian population. Only one report by Eizirik et al. (9) has described the frequency of serologically defined DR antigens in IDDM patients. The Brazilian population is characterized by a complex genetic background resulting from the intermixing of Caucasians, Negroes and Amerindians (10). The aim of the present study was to determine the distribution of HLA-DRB1* alleles in a mixed population of IDDM patients from Southeastern Brazil.
Subjects
Forty-one unrelated IDDM patients diagnosed according to the National Diabetes Data Group criteria (11) and accompanied at the Endocrinology Service of the University Hospital of the State University of Campinas (UNICAMP) were studied. The group consisted of 26 women and 15 men. Mean age at the time of IDDM diagnosis was 17.7 ± 7.9 years. All of the patients were residents of Campinas and the surrounding region in the State of São Paulo, and had a mixed genetic background of European, African and Amerindian origin. Ninety-nine racially matched healthy subjects from the same geographic area were included as the control group. All subjects gave informed consent to participate in the study, which was approved by the Ethics Committee of the Hospital.
HLA genotyping
HLA-DRB1* genotyping was performed using the polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) protocol recommended by the XII International Histocompatibility Workshop. Briefly, DNA was obtained from peripheral leucocytes by classic phenol/chloroform extraction. The amplification of exon 2 of the HLA-DRB1 locus was performed by PCR using aliquots of DNA (0.5 µg) in the presence of a forward primer spanning intron-4 (CCGGATCCTTCGTGTCCCCACAGCACG) and a reverse primer spanning 88-94 bp (TCGCCGCTGCACTGTGAA). Thirty cycles were carried out with Taq DNA polymerase in a Perkin-Elmer Cetus DNA thermal cycler, as follows: 1 min at 95oC (denaturing), 1 min at 55oC (annealing) and 1 min at 72oC (elongation). The resulting 292-bp fragment was blotted onto nylon membranes and hybridized overnight at 54oC with a set of 18 SSO probes, labeled with digoxigenin-11-ddUTP (Boehringer Mannheim). The membranes were then incubated with a Fab anti-digoxigenin IgG (Boehringer Mannheim) and detection was performed with a chemiluminescence substrate (Lumigen PPD, Boehringer Mannheim). The dots were visualized after a 10- to 20-min exposure to Kodak XAR films at room temperature.
Statistical analysis
The distribution of HLA-DRB1* alleles was compared between IDDM patients and controls by the chi-square test with Yates correction. Odds ratios were calculated according to the formula of Woolf and, by convention, expressed as relative risks (RR). When one element was 0, the Haldane formula was used to deduce the RR. The level of significance was set at 0.05. The P value was corrected by the Bonferoni inequality method, by multiplying P by the number of alleles compared.
The HLA-DRB1* phenotype and allele frequencies among IDDM patients and normal individuals are shown in Table 1 and Table 2, respectively. HLA-DRB1*03 frequency (Table 1) was significantly higher in the IDDM than in the control group (48.8% in IDDM, 18.2% in controls, RR = 4.27, P<0.005). The HLA-DRB1*04 frequency was also significantly higher in the IDDM group (43.9% vs 15.1% in controls, RR = 4.37, P<0.008). HLA-DRB1*03/*04 heterozygosity conferred a strong IDDM risk (14.6% in patients vs 3.0% in controls, RR = 5.44).
Homozygosity for DRB1*03 and DRB1*04 did not confer a higher risk than having a single dose of these alleles (Table 2).
In contrast, the HLA-DRB1*11 frequency was decreased in IDDM patients (7.3%) compared with the control group (26.3%), but the difference was not significant when the P value was corrected by the number of DRB1 alleles tested (P<0.02 before correction). The frequencies of the other HLA-DRB1* alleles were similar in both groups.
Susceptibility and resistance to IDDM are controlled, in part, by HLA class II genes (3). In addition to the role of the encoded molecules (particularly HLA-DQ) in the immunopathogenesis of IDDM, these gene products also serve as genetic markers that are widely used to identify individuals with a risk of developing IDDM (12,13).
Little is known about class II HLA genes and IDDM in Brazilians. In the present study, we used HLA genotyping to perform DRB1* analysis in IDDM patients and normal individuals from Southeastern Brazil. There was an increased frequency of HLA-DRB1*03 and *04 among IDDM patients compared to the controls. These results are in agreement with data obtained for other Caucasian, African and Oriental groups (14-16). The strong IDDM risk conferred by DRB1*03/*04 heterozygosity in the Brazilian IDDM group is of the same order of magnitude as that observed in Caucasian patients (14,16).
We found a tendency to a lower frequency of HLA-DRB1*11 in IDDM patients than in healthy individuals, although the difference was not significant after P correction. Other studies have previously reported the association betwen HLA-DRB1*11 and protection from IDDM in non-Caucasian populations such as Blacks and North-Africans (17,18). In Caucasians, protection is usually conferred by the DRB1*15-DQA1*0102-DQB1*0602 haplotype (3). However, DRB1*15 frequency was not decreased in our IDDM patients compared to controls.
The HLA-DRB1* genes found in the above Brazilian IDDM patients need to be re-evaluated in conjunction with an analysis of HLA-DQA1*, DQB1* haplotypes since the latter represent the primary HLA genes involved in susceptibility to the disease. Since the combination of DQA1 and DQB1 genes can vary among populations, detailed haplotype studies of different ethnic groups are required in order to better define the nature of the HLA-associated susceptibility and resistance to IDDM.
1. Rossini AA, Greiner DL, Friedman HP & Mordes JP (1993). Immunopathogenesis of diabetes mellitus. Diabetes Reviews, 1: 43-75.
2. Bach JF (1994). Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine Reviews, 15: 516-542.
3. Thorsby E & Ronningen KS (1993). Particular HLA-DQ molecules play a dominant role in determining susceptibility or resistance to type I (insulin-dependent) diabetes mellitus. Diabetologia, 36: 371-377.
4. Todd JA, Bell JI & McDevitt HO (1987). HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature, 329: 599-604.
5. Khalil I, D'Auriol L, Gobet M, Morin L, Lepage G, Deschamps I, Park MS, Degos L, Galibert F & Hors J (1990). A combination of HLA-DQß Asp57-negative and HLA-DQa Arg52 confers susceptibility to insulin-dependent diabetes mellitus. Journal of Clinical Investigation, 85: 1315-1319.
6. Wolf E, Spencer KM & Cudworth AG (1983). The genetic susceptibility of type-I (insulin dependent) diabetes: analysis of the HLA-DR association. Diabetologia, 24: 224-229.
7. Reitnauter PJ, Roseman JM, Barger BO, Murphy CC, Kirk KA & Acton RT (1981). HLA associations with insulin-dependent diabetes mellitus in a sample of the American black population. Tissue Antigens, 17: 286-293.
8. Sakurami T, Ueno Y, Nagaoka K, Kuno S, Iwaki Y & Park MS (1982). HLA-DR specifications in Japanese with juvenile-onset insulin-dependent diabetes mellitus. Diabetes, 31: 105-106.
9. Eizirik DL, Monteiro CMC, Voltarelli JC & Foss MC (1987). Frequency of HLA antigens in a Brazilian type I diabetic population. Brazilian Journal of Medical and Biological Research, 20: 533-537.
10. Moraes ME, Fernandez-Viña M, Salatiel I, Tsai S, Moraes JR & Stastny P (1993). HLA class II DNA typing in two Brazilian populations. Tissue Antigens, 41: 238-242.
11. National Diabetes Data Group (1979). Classification and diagnosis of diabetes mellitus and other categories of glucose intolerance. Diabetes, 28: 1039-1057.
12. Tillil H & Kobberling J (1987). Age-corrected empirical genetic risks estimates for first degree relatives of IDDM patients. Diabetes, 36: 93-99.
13. Skyler JS & Marks JB (1993). Immune intervention in type I diabetes mellitus. Diabetes Reviews, 1: 15-42.
14. Ronningen KS, Spurkland A, Iwe T, Vartdal F & Thorsby E (1991). Distribution of HLA-DRB1, -DQA1 and -DQB1 alleles and DQA1-DQB1 genotypes among Norwegian patients with insulin-dependent diabetes mellitus. Tissue Antigens, 37: 105-111.
15. Fernandez-Viña M, Ramirez LC, Raskin P & Stastny P (1993). Genes for insulin-dependent diabetes mellitus (IDDM) in the major histocompatibility complex (MHC) of African-Americans. Tissue Antigens, 41: 57-64.
16. Buyse I, Sandkuyl LA, Zamani Ghabanbasani M, Gu XX, Boillon R, Bex M, Dooms L, Emonds MP, Duhamel M, Marynen P & Cassiman JJ (1994). Association of particular HLA class II alleles, haplotypes and genotypes with susceptibility to IDDM in the Belgian population. Diabetologia, 37: 808-817.
17. Djoulah S, Khalil I, Beressi JP, Benhamamouch S, Bessaoud K, Deschamps I, Degos L & Hors J (1992). The HLA-DRB1*0405 haplotype is most strongly associated with IDDM in Algerians. European Journal of Immunogenetics, 19: 381-389.
18. Garcia-Pacheco JM, Herbut B, Cutbush S, Hitman GA, Zhonglin W, Magzoub M, Bottazzo GF, Kiere C, West G, Mvere D, Biro PA & Sachs JA (1992). Distribution of HLA-DQA1, -DQB1 and -DRB1 alleles in black IDDM patients and controls from Zimbabwe. Tissue Antigens, 40: 145-149.
Address for correspondence: L.B. Persoli, Laboratório de Histocompatibilidade do Hemocentro, UNICAMP, Rua Carlos Chagas, 480, 13081-970 Campinas, SP, Brasil. Fax: 55 (019) 239-3181.
Research supported by the Fundo de Apoio ao Ensino e Pesquisa (FAEP, UNICAMP). Publication supported by FAPESP. Received April 24, 1997. Accepted October 24, 1997.
References
- 1. Rossini AA, Greiner DL, Friedman HP & Mordes JP (1993). Immunopathogenesis of diabetes mellitus. Diabetes Reviews, 1: 43-75.
- 2. Bach JF (1994). Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine Reviews, 15: 516-542.
- 3. Thorsby E & Ronningen KS (1993). Particular HLA-DQ molecules play a dominant role in determining susceptibility or resistance to type I (insulin-dependent) diabetes mellitus. Diabetologia, 36: 371-377.
- 4. Todd JA, Bell JI & McDevitt HO (1987). HLA-DQ beta gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature, 329: 599-604.
- 5. Khalil I, D'Auriol L, Gobet M, Morin L, Lepage G, Deschamps I, Park MS, Degos L, Galibert F & Hors J (1990). A combination of HLA-DQß Asp57-negative and HLA-DQa Arg52 confers susceptibility to insulin-dependent diabetes mellitus. Journal of Clinical Investigation, 85: 1315-1319.
- 6. Wolf E, Spencer KM & Cudworth AG (1983). The genetic susceptibility of type-I (insulin dependent) diabetes: analysis of the HLA-DR association. Diabetologia, 24: 224-229.
- 7. Reitnauter PJ, Roseman JM, Barger BO, Murphy CC, Kirk KA & Acton RT (1981). HLA associations with insulin-dependent diabetes mellitus in a sample of the American black population. Tissue Antigens, 17: 286-293.
- 9. Eizirik DL, Monteiro CMC, Voltarelli JC & Foss MC (1987). Frequency of HLA antigens in a Brazilian type I diabetic population. Brazilian Journal of Medical and Biological Research, 20: 533-537.
- 10. Moraes ME, Fernandez-Vińa M, Salatiel I, Tsai S, Moraes JR & Stastny P (1993). HLA class II DNA typing in two Brazilian populations. Tissue Antigens, 41: 238-242.
- 11. National Diabetes Data Group (1979). Classification and diagnosis of diabetes mellitus and other categories of glucose intolerance. Diabetes, 28: 1039-1057.
- 12. Tillil H & Kobberling J (1987). Age-corrected empirical genetic risks estimates for first degree relatives of IDDM patients. Diabetes, 36: 93-99.
- 13. Skyler JS & Marks JB (1993). Immune intervention in type I diabetes mellitus. Diabetes Reviews, 1: 15-42.
- 14. Ronningen KS, Spurkland A, Iwe T, Vartdal F & Thorsby E (1991). Distribution of HLA-DRB1, -DQA1 and -DQB1 alleles and DQA1-DQB1 genotypes among Norwegian patients with insulin-dependent diabetes mellitus. Tissue Antigens, 37: 105-111.
- 15. Fernandez-Vińa M, Ramirez LC, Raskin P & Stastny P (1993). Genes for insulin-dependent diabetes mellitus (IDDM) in the major histocompatibility complex (MHC) of African-Americans. Tissue Antigens, 41: 57-64.
- 16. Buyse I, Sandkuyl LA, Zamani Ghabanbasani M, Gu XX, Boillon R, Bex M, Dooms L, Emonds MP, Duhamel M, Marynen P & Cassiman JJ (1994). Association of particular HLA class II alleles, haplotypes and genotypes with susceptibility to IDDM in the Belgian population. Diabetologia, 37: 808-817.
- 17. Djoulah S, Khalil I, Beressi JP, Benhamamouch S, Bessaoud K, Deschamps I, Degos L & Hors J (1992). The HLA-DRB1*0405 haplotype is most strongly associated with IDDM in Algerians. European Journal of Immunogenetics, 19: 381-389.
- 18. Garcia-Pacheco JM, Herbut B, Cutbush S, Hitman GA, Zhonglin W, Magzoub M, Bottazzo GF, Kiere C, West G, Mvere D, Biro PA & Sachs JA (1992). Distribution of HLA-DQA1, -DQB1 and -DRB1 alleles in black IDDM patients and controls from Zimbabwe. Tissue Antigens, 40: 145-149.


