The effect of Lacticaseibacillus casei on inflammatory cytokine (IL-8) gene expression induced by exposure to Shigella sonnei in Zebrafish (Danio rerio)

[O efeito do Lacticaseibacillus casei na citoquina inflamatória (IL-8) expressão genética induzida pela exposição a Shigella sonnei em Zebrafish (Danio rerio)]

ABSTRACT

This study aimed to evaluate the protective function of probiotics against Shigella sonnei pathogenicity. For this purpose, 400 zebrafish were divided into four groups with two replications: (T1): receiving Lacticaseibacillus casei for 27 days, (T2): receiving L. casei for 27 days followed by 72 hr exposure to S. sonnei, (T3): receiving basal diet for 27 days followed by 72 hr exposure to S. sonnei, and control group (C): receiving basal diet without exposure to the pathogen. According to the results, feeding with L. casei for 27 days reduced the interleukin-8 (IL-8) expression significantly (P<0.05). The results showed a decrease in IL-8 expression in the group exposed to the pathogen and fed with the probiotic compared to the group only fed with the basal diet (P<0.05). Considering the role of IL-8 as a pro-inflammatory cytokine, our results indicated that feeding with L. casei could modulate inflammatory responses.

Keywords:
Lacticaseibacillus casei; Shigella sonnei; Interleukin-8; Zebrafish

RESUMO

Este estudo teve como objetivo avaliar a função protetora dos probióticos contra a patogenicidade Shigella sonnei. Para este fim, 400 zebrafish foram divididos em quatro grupos com duas réplicas: (T1): recebendo Lacticaseibacillus casei por 27 dias, (T2): recebendo L. casei por 27 dias seguido por 72 horas de exposição a S. sonnei, (T3): recebendo dieta basal por 27 dias seguido por 72 horas de exposição a S. sonnei, e grupo controle (C): recebendo dieta basal sem exposição ao patógeno. De acordo com os resultados, a alimentação com L. casei por 27 dias reduziu significativamente a expressão da interleucina-8 (IL-8) (P<0,05). Os resultados mostraram uma diminuição na expressão de IL-8 no grupo exposto ao patógeno e alimentado com o probiótico em comparação com o grupo alimentado apenas com a dieta basal (P<0,05). Considerando o papel da IL-8 como uma citocina pró-inflamatória, nossos resultados indicaram que a alimentação com L. casei poderia modular as respostas inflamatórias.

Palavras-chave:
Lacticaseibacillus casei; Shigella sonnei; Interleukin-8; Zebrafish

INTRODUCTION

Shigella sp. is one of the most common causes of gastrointestinal diseases and the most important cause of dysentery worldwide (Zhang et al., 2012; Mattock and Blocker, 2017). This Bacterium is responsible for about 165 million shigellosis (Duggan and Mostowy, 2018) and over half a million deaths annually (Lima et al., 2015, Kotloff et al., 2018). Shigella pathogenicity is triggered by penetrating the intestinal epithelium, proliferating within the epithelial cells, and spreading to the adjacent cells (Bolla et al., 2016). This causes an acute inflammatory response known as "shigellosis" Schroeder and Hilbi (2008), which is a common form of bacillary dysentery resulted from infections with four species of Shigella including S. flexneri, S. dysentery, S. buidi, and S. sonnei (Moorthy et al., 2010).

The infection with S. sonnei is observed in developed and developing countries (Levine et al., 2007; Kotloff et al., 2018). However, the pathogenicity of this infection is still not fully understood (Duggan and Mostowy, 2018). Shigella infection is generally known to modulate the inflammatory and innate immune responses by inducing specific mediators, limiting the adaptive immune response, and aiding the infection spread (Mattock and Blocker, 2017). Deaths from shigellosis are commonly associated with complications such as uremic hemolytic syndrome, systemic symptoms, hypoglycemia, and pneumonia (Caboni et al., 2015).

Nowadays, the emergence of antibiotic-resistant bacteria is a significant threat, and Shigella is one of the bacteria associated with the resistance to antibiotics such as fluoroquinolones, cephalosporins, and azithromycin (Puzari et al., 2018). The resistance of Shigella species to antibiotics, like other Gram-negative bacteria, is increasing (Harrington, 2015), and the World Health Organization (WHO) has placed the shigellosis among the 12 major diseases (Tacconelli et al., 2018). Considering the limited applicability of the current antimicrobial drugs for treating shigellosis (Moorthy et al., 2010), it is important to seek alternative therapeutic agents.

One of the critical issues in the pathogenesis of S. sonnei is to understand how the bacterium interacts with the intestinal epithelial cells, which ultimately leads to the inflammation. Due to their protective roles as barriers against penetrating pathogens and modulators of inflammatory processes in the mucosa, the intestinal epithelial cells are particularly important in S. sonnei pathogenesis (Moorthy et al., 2010). Besides, many intestinal functions such as nutrient uptake, creating a mucosal barrier, and angiogenesis are, in part, promoted by the bacteria, which are a part of the intestinal flora (Hooper et al., 2001; Stappenbeck et al., 2002). In this regard, it has been shown that some bacteria of the intestinal flora including Lactobacilli can protect the host against pathogens, including those that cause diarrhea (Moorthy et al., 2010). Lactobacilli, which belong to the natural bacterial flora of intestine, are among the most common probiotic groups (Cui et al., 2004; Zhang et al., 2012).

The probiotics include microorganisms with numerous health benefits for the host FAO/WHO (Guidelines..., 2002). Several studies have reported the Lactobacilli ability to protect the host against infectious diseases caused by intestinal pathogens (Gupta and Garg, 2009). Lactic acid bacteria (LABs) are used in the processed food industries and the products containing Lactobacillus selectively modulate gut microbiota composition by producing antimicrobial compounds such as bacteriocin, organic acids, and hydrogen peroxide, which inhibit the growth of pathogens and improve the intestinal barrier function (Eor et al., 2020). Lacticaseibacillus casei (L. casei) is one of these probiotics and a component of the natural intestinal flora, which is used either alone or in an enriched form (García-Peñalvo, 2019). It has been shown to modulate mucosal innate immune response and inflammatory reactions (Tien et al., 2006; Borruel et al., 2002). Probiotics apply their effects by neutralizing the pathogens, augmenting the intestinal barrier, and modulating the immune response (Plaza-Diaz et al., 2014). In general, probiotics beneficial effects may be derived by regulating the innate and adaptive immune responses. For example, Lactobacilli have been shown to reduce the inflammatory response induced by the Shigella strains invading the intestinal epithelial cells (Tien et al., 2006). The mechanisms of action of L. casei include improvement in the antioxidant activity of blood, increase in the concentration of bioactive peptides caused by hyperglycemia, immune system regulation, improvement in inflammation, and blood cholesterol lowering (Grom et al., 2020).

Cytokines are the key inflammatory mediators in inflammatory bowel disease (IBD) (Gopal et al., 2017). Investigation of the cytokine gene expression in the intestine of the patients with acute shigellosis revealed the elevated levels of pro-inflammatory interleukins (ILs) such as IL-8 (Phalipon and Sansonetti, 2007). The IL-8 is a potent pro-inflammatory chemokine produced by the epithelial cells and basolateral epithelial membrane in response to Shigella (Köhler et al., 2002).

Zebrafish is an important laboratory model because of the numerous features such as rapid growth, high genetic similarity to humans, body transparency, and the lack of adaptive immunity at early stages of embryogenesis, which allows the specific studies on the innate immunity (Lieschke and Currie, 2007; Sullivan et al., 2017; Lieschke, 2009. This fish is also a valuable model to study Shigella pathogenesis as many of the disease symptoms observed in humans have also been identified in zebrafish (Duggan and Mostowy, 2018).

The effect of L. casei in reducing Shigella pathogenicity has been proven (Tien et al., 2006); however, the exact mechanisms involved in this effect have not yet been investigated thoroughly. In this study, the probiotic L. casei effects were investigated on the intestinal epithelium structure and inflammatory response in zebrafish exposed to S. sonnei.

MATERİALS AND METHODS

The clinical strain of S. sonnei (ATCC 9290) was prepared from the Microbial Bank of Iranian Biological Resources (Tehran, Iran) and grown in Shigella-Salmonella (SS) agar (Merck, Germany) for 18 hr at 37°C (Gopal et al., 2017). After ensuring the appropriate growth of the bacteria, they were transferred to MacConkey culture medium and incubated for 20 hr at 37°C (Andrews and Jacobson, 2019). Finally, 0.5 McFarland (1.5×10⁸ CFU/mL) concentration was determined based on the method of Eduardo et al., (2018) by preparing bacterial suspension in Muller Hinton broth and measuring turbidity using a spectrophotometer at 625nm wavelength of (Eduardo et al., 2018).

The lyophilized L. casei was provided from the Microbial Bank of Iranian Biological Resources (Tehran, Iran) and grown in MRS broth culture medium (Merck, Germany) for 18-20 hr at 37°C (Moorthy et al., 2010). Afterward, the grown bacteria were centrifuged (2500 rpm) for 25 min at 4°C, and then washed three times with phosphate-buffered saline (PBS). Finally, a suspension with a concentration of 1.5 × 10⁸ CFU was prepared (Zang et al., 2019). The suspension was kept at -20°C with 20% glycerol until use (Barbour and Priest, 1986).

The commercial feed used in this study was BioMar (France). The probiotic diet was prepared by combining probiotic L. casei suspension (1.5 × 10⁸ CFU/mL) (2mL) with commercial feed based on 2% fish body weight. The diet was prepared daily. Briefly, probiotic was mixed with commercial feed, then; the mixture was incubated on ice for 15 minutes to allow bacteria to absorb and finally, combined with 1% skim milk as a preservative. The basic diet was prepared by combining the commercial feed with 2mL sterile PBS (Wang et al, 2016). Feeding was done twice a day at 9 a.m. and 16 p.m.

Zebrafish were purchased from an ornamental fish breeding center in Tehran, Iran, and transferred to the "Razef" Research Center of the Science and Research University (Shahriar, Tehran, Iran). The fish were kept at 26±1°C and dark/light cycles of 8:14 for 2 weeks to adapt to the condition. They were fed twice a day with commercial feed. During this time, the physicochemical factors were examined to ensure an ideal maintenance condition.

Fish were divided into four groups with two replications in the form of T1; Feeding with probiotic L. casei (1.5×10⁸ CFU/mL) for 27 days, T2; Feeding with probiotic L. casei for 27 days and then 72 hr exposure to S. sonnei (1.5×10⁸ CFU/ml), T3; Feeding with the basal diet for 27 days and then 72 hr exposure to S. sonnei, and control group (C); Feeding with the basal diet for 27 days and no exposure to S. sonnei.

Sampling was performed on days 1, 14, 27, and 30. To examine the IL-8 gene expression, three fish were randomly collected from each tank, anesthetized by clove powder, and euthanized (Wong et al., 2014). The prepared samples were placed in RNAse-free microtubes and kept at -80°C for the gene expression analysis.

Real-time PCR was performed to evaluate the expression level of IL-8 gene. First, total RNA was extracted from fish intestine using TRIzol reagent according to the manufacturer's protocol. Three replications were performed for each test. Extracted RNA was quantified using Nanodrop Spectrophotometer (Thermo Scientific™). CDNA synthesis was performed using the Revert Aid^TM First Strand cDNA Synthesis Kit (Thermo Scientific™ Fermentas, USA), and real-time PCR was performed by Real-Time PCR Detection Systems (Bio-Rad). The primers were designed using GeneRunner software (Table 1). The gene expression was analyzed using the 2^-△△ct method, and β-actin was considered as the endogenous reference (Yang et al., 2019).

Table 1
Primer specifications used for IL-8 and β-actin genes

Primers	Primer sequence	Length of product
Forward primer IL-8	CGTGAAGTGAACGTGGTGGA	160bp
Reverse primer IL-8	CTTTCAAGTCGCTGCTTCCG
Forward primer Beta Actin	CCTTCTTGGGTATGGAATCT	194bp
Reverse primer Beta Actin	GATCTTGATCTTCATTGTGCTA

The statistical data analysis was performed by SPSS 16 software (SPSS Inc., Chicago, IL., USA) using the one-way analysis of variance (One-way ANOVA). Tukey's HSD post-hoc test was used to investigate the differences in the expression of the desired genes between the control and experimental groups. Finally, the data was presented as mean ± standard deviation (SD). The P<0.05 was considered as statistically significant.

To determine the effect of L. casei on the cellular and molecular immune responses of zebrafish against S. sonnei invasion, the IL-8 gene expression was assessed using real-time PCR molecular technique.

The expression levels of IL-8 (mean ± SD) in various groups are summarized in Table 2. Based on these results, the IL-8 pro-inflammatory cytokine expression decreased in zebrafish intestine in the groups fed with the probiotic diet on days 14 (P>0.05) and 28 (P<0.05), and this trend continued in the T1 group until day 30 (Figure 1). This observation indicated the immunomodulatory effects of probiotic L. casei diet. On the other hand, the expression of this cytokine gene was down-regulated significantly after exposure to S. sonnei in the T2 group compared to the T3 group (Figure 1, P<0.05), reflecting the inflammatory damaged induced by S. sonnei in zebrafish intestine and modulation of the cellular and molecular immune responses in the group fed with the probiotic regimen.

Figure 1
The expression of IL-8 gene in different groups.

Table 2
The IL-8 gene expression in different experimental groups in different days

Day/ treatment	T1	T2	T3	C
0	1.38±0.39	1.56±0.19	1.62±0.29	1.23± 0.23
14	0.722±0.63	0.816±0.23	1.29±0.44	1.29±0.82
27	0.409±0.55	0.429±0.82	2.06±0.19	1.52±0.16
30	0.268±0.560	0.602±0.39	3.29±0.38	1.69±0.34

The IL-8 is a pro-inflammatory cytokine produced by the intestinal epithelial cells in response to the invasive agents (Eckmann et al., 2000; Köhler et al., 2002). The production of IL-8 by intestinal epithelial cells may be one of the first signals of the acute mucosal inflammation in bacterial infections (Eckmann et al., 1993).

In this study, we initially examined the effects of feeding with non-pathogenic bacteria, L. casei, on the IL-8 gene expression. According to the obtained results, feeding with L. casei led to a significant reduction in the gene expression of IL-8 pro-inflammatory cytokine in zebrafish intestine, which was consistent with the results of Wallace et al., (2003) who assessed the effects of treating HT-29 human intestinal epithelial cell line (IEC) with L. rhamnosus, L. delbrueckii, and L. acidophilus (Wallace et al., 2003).

Regarding the mechanism of action of L. casei, Tien et al. (2006) stated that L. casei can reduce the expression of some pro-inflammatory cytokines through the ubiquitin-proteasome pathway (Tien et al., 2006). It was also shown that DNA of probiotics reduced the production of IL-8 by the epithelial cells via a mechanism involved in I-κB stabilization (Jijon et al., 2004).

In this regard, several studies have investigated the effects of probiotic bacteria on pro-inflammatory immune responses and IL-8 gene expression (Lazado and Caipang, 2014b; Al‐Hisnawi et al., 2019).

Some studies presented opposing results from our study. Lammers et al., (2002) and Bolla et al. (2016) reported that treating intestinal epithelial cells with Lactobacilli had no effect on the IL-8 gene expression (Bolla et al., 2016; Lammers et al., 2002). Also, in a study by Lazado and Caipang (2014), the host-derived potential probiotics (GP21 and GP12), which were either alive or inactivated by heat, did not modify the IL-8 gene expression significantly in the intestinal epithelial cells (IEPC) of Atlantic cod fish (Lazado and Caipang, 2014a). On the other hand, Pérez-Sánchez et al. (2011) found that feeding rainbow trout with probiotics L. plantarum, L. lactis, and Leuconostoc mesenteroides increased the of IL-8 gene expression (Pérez Sánchez et al., 2011). Accordingly, Wallace et al. (2003) declared strain-specific differences in the ability of LABs to modulate the intestinal production of cytokines. Therefore, the differences observed among the results of the mentioned studies can be attributed to the variability in the type of probiotics, as well as different test conditions (in vivo and in vitro), different hosts, and variable treatment periods (Wallace et al., 2003).

The induction of pro-inflammatory cytokines can act like a double-edged sword, causing cellular damage and tissue inflammation in certain conditions (Wallace et al., 2003). In this regard, the results of the present study showed an increase in the IL-8 gene expression in both groups exposed to S. sonnei; however, this elevation was lesser in the group treated with L. casei compared with the group fed with the basic diet. In accordance with our results, several studies, including those of Bolla et al. (2016), Tien et al. (2006), and Moorthy et al. (2010), have shown the inhibitory effects of probiotics on the IL-8 gene expression after exposure to Shigella bacteria.

It has been shown that lipopolysaccharides from Gram-negative bacteria can disrupt the integrity of the intestinal barrier by activating Toll-Like Receptor (TLR) 4 signaling pathway, which leads to the intestinal inflammation (Eor et al., 2020) or. In this regard, the ability of Shigella in inducing pro-inflammatory responses and IL-8 gene expression has been reported in previous studies (Bolla et al., 2016). Also, Pédron et al. (2013) showed the prominent effects of Shigella flexneri on inducing IL-8 gene expression in the intestinal epithelial cells, suggesting this cytokine as a major regulator of mucosal inflammation in shigellosis (Pédron et al., 2003). Gopal et al. (2017) highlighted the role of β-catenin/NF-κB signaling pathway as a mechanism through which Shigella infection could activate the pro-inflammatory response and induce the IL-8 gene expression in the rat model of ileal loop.

The intestinal immune responses are mediated by the receptors expressed on the apical and/or basolateral surfaces of the epithelial cells. Commensal and pathogenic bacteria in the gastrointestinal tract can activate these signaling cascades and therefore trigger pro-inflammatory genes transcription and immune responses (Kelly et al., 2004). Although the presence of virulence factors in the pathogenic bacteria is responsible for the development of inflammatory responses, commensal bacteria (including Lactobacilli) modulate immune responses via various mechanisms. It is important to understand the molecular and cellular mechanisms through which probiotic bacteria balance the immune homeostasis, which can pave the path for developing new treatments for the inflammatory bowel diseases (Kelly et al., 2004).

The primary target of probiotic bacteria includes intestinal epithelial cells (Kelly et al., 2004), and such interaction blocks the binding of pathogens to the epithelial cells (Zhang et al., 2012). In this regard, according to the report of Moorthy et al. (2010), L. rhamnosus and L. acidophilus reduced S. sonnei pathogenicity in the human intestine by inhibiting the pathogen attachment to the epithelial cells and suppressing the release of pro-inflammatory cytokines (Moorthy et al., 2010). Also, according to the results of Bolla et al. (2016), the treatment of intestinal epithelial cells with three Lactobacillus strains and two kefir-isolated yeasts reduced pathogen invasion to HT-29 and Caco-2 cells and reduced pathogen entry into HT-29 and Caco-2 cells, suppressing the pro-inflammatory response and IL-8 gene expression upon exposure to S. flexneri (Bolla et al., 2016). This was consistent with the findings of the present study. In accordance with our observation, Tien et al. (2006) also assessed the anti-inflammatory effects of L. casei on the intestinal cells exposed to S. flexneri and showed that the probiotic blocked the NF-κB pathway induced by the pathogen, alleviating the pro-inflammatory responses.

In another study, Hersh et al. (1998) stated that Shigella flexneri induced macrophage apoptosis, resulting in the release of pro-inflammatory cytokines from the dying cells and subsequently the initiation of inflammatory responses and mucosal tissue destruction (Hersh et al., 1998). On the other hand, Kelly et al. (2004) described a unique anti-inflammatory mechanism, which was activated by non-pathogenic commensal bacteria that selectively antagonized NF-κB transcription factor. This bacterium attenuated pro-inflammatory cytokines expression by promoting the nuclear export of NF-κB RelA subunit via PPAR-γ-dependent pathway (Kelly et al., 2004). In another report, Eor et al. (2020) noted that feeding with L. casei reduced osteoporosis and subsequently diminished pro-inflammatory factors and the intestinal inflammation was induced by liposaccharides derived from Gram-negative bacteria (Eor et al., 2020).

Based on our results, probiotic L. casei suppressed the excessive production of IL-8 in the intestine of zebrafish exposed to S. sonnei, thus, it can play a protective role against pathogenic agents, suggesting a novel therapeutic strategy to treat this infection and other intestinal inflammatory diseases. However, further studies are needed to determine the mechanisms and signaling pathways involved in the IL-8 alternations in the zebrafish infected by S. sonnei.

REFERENCES

• AL‐HISNAWI, A.; RODILES, A.; RAWLING, M.D. et al. Dietary probiotic Pediococcus acidilactici MA18/5M modulates the intestinal microbiota and stimulates intestinal immunity in rainbow trout (Oncorhynchus mykiss). J. World Aquac. Soc., v.50, p.1133-1151, 2019.
• ANDREWS, W.H.; JACOBSON, A. BAM: shigella. New York: Food and Drug Administration, 2019.
• BARBOUR, E.A.; PRIEST, F. The preservation of lactobacilli: a comparison of three methods. Lett. Appl. Microbiol., v.2, p.69-71, 1986.
• BOLLA, P.A.; ABRAHAM, A.G.; PEREZ, P.F. et al. Kefir-isolated bacteria and yeasts inhibit Shigella flexneri invasion and modulate pro-inflammatory response on intestinal epithelial cells. Beneficial Microbes, v.7, p.103-110, 2016.
• BORRUEL, N.; CAROL, M.; CASELLAS, F. et al. Increased mucosal tumour necrosis factor α production in Crohn’s disease can be downregulated ex vivo by probiotic bacteria. Gut, v.51, p.659-664, 2002.
• CABONI, M.; PEDRON, T.; ROSSI, O. et al. An O antigen capsule modulates bacterial pathogenesis in Shigella sonnei. PLoS Pathog., v.11, p.e1004749, 2015.
• CUI, H.H.; CHEN, C.L.; WANG, J.D. et al. Effects of probiotic on intestinal mucosa of patients with ulcerative colitis. World J. Gastroenterol., v.10, p.1521, 2004.
• DUGGAN, G.M.; MOSTOWY, S. Use of zebrafish to study Shigella infection. Dis. Model. Mech., v.11, n.2, 2018.
• ECKMANN, L.; KAGNOFF, M.F.; FIERER, J. Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry. Infect. Immun., v.61, p.4569-4574, 1993.
• ECKMANN, L.; SMITH, J.R.; HOUSLEY, M.P. et al. Analysis by high density cDNA arrays of altered gene expression in human intestinal epithelial cells in response to infection with the invasive enteric bacteriaSalmonella. J. Biol. Chem., v.275, p.14084-14094, 2000.
• EDUARDO, L.G.; RAMIREZ, B.S.; MARIBEL, C.F. et al. Low accuracy of the McFarland method for estimation of bacterial populations. Afr. J. Microbiol. Res., v.12, p.736-740, 2018.
• EOR, J.Y.; TAN P.L.; SON, Y.J. et al. Milk products fermented by Lactobacillus strains modulate the gut-bone axis in an ovariectomised murine model. Int. J. Dairy Technol., v.73, p.743-756, 2020.
• GARCÍA-PEÑALVO, F.J. Innovative teaching approaches to attract, engage, and maintain women in Stem: W-stem project. In: CONFERENCE COIMBRA GROUP SEMINAR. INNOVATION IN LEARNING AND TEACHING IN SCIENCE, 2019, Granada. Proceedings… Granada: University of Salamanca, 2019.
• GOPAL, A.; CHIDAMBARAM, I.S.; DEVARAJ, N.; DEVARAJ, H. Shigella dysenteriae infection activates proinflammatory response through β-catenin/NF-κB signaling pathway. PloS One, 12, p.e0174943, 2017.
• GROM, L.C.; COUTINHO, N.M.; GUIMARÃES, J.T. et al. Probiotic dairy foods and postprandial glycemia: a mini-review. Trends Food Sci. Technol., v.101, p.165-171, 2020.
• GUIDELINES for the evaluation of probiotics in food. Report of a joint FAO/WHO Working Group on drafting guidelines for the evaluation of probiotics in food. Geneva, Switzerland: World Health Organization, 2002.
• GUPTA, V.; GARG, R. Probiotics. Indian J. Med. Microbiol., v.27, p.202, 2009.
• HARRINGTON, R. Drug-resistant stomach bug. Sci. Am., v.313, p.88, 2015.
• HERSH, D.; WEISS, J.; ZYCHLINSKY, A. How bacteria initiate inflammation: aspects of the emerging story. Curr. Opin. Microbiol., v.1, p.43-48, 1998.
• HOOPER, L.V.; WONG, M.H.; THELIN, A. et al. Molecular analysis of commensal host-microbial relationships in the intestine. Science, v.291, p.881-884, 2001.
• JIJON, H.; BACKER, J.; DIAZ, H. et al. DNA from probiotic bacteria modulates murine and human epithelial and immune function. Gastroenterology, v.126, p.1358-1373, 2004.
• KELLY, D.; CAMPBELL, J.I.; KING, T.P.; GRANT, G. et al. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear cytoplasmic shuttling of PPAR γ and RelA. Nature Immunol., v.5, p.104-112, 2004.
• KÖHLER, H.; RODRIGUES, S.P.; MCCORMICK, B.A. Shigella flexneri interactions with the basolateral membrane domain of polarized model intestinal epithelium: role of lipopolysaccharide in cell invasion and in activation of the mitogen-activated protein kinase ERK. Infect. Immun., v.70, p.1150-1158, 2002.
• KOTLOFF, K.L.; RIDDLE, M.S.; PLATTS-MILLS, J.A.; PAVLINAC, P.; ZAIDI, A.K. Shigellosis. Lancet, v.391, p.801-812, 2018.
• LAMMERS, K.; HELWIG, U.; SWENNEN, E.; RIZZELLO, F. et al. Effect of probiotic strains on interleukin 8 production by HT29/19A cells. Am. J. Gastroenterol., v.97, p.1182-1186, 2002.
• LAZADO, C.; CAIPANG, C. Bacterial viability differentially influences the immunomodulatory capabilities of potential host‐derived probiotics in the intestinal epithelial cells of Atlantic cod Gadus morhua. J. Appl. Microbiol., v.116, p.990-998, 2014a.
• LAZADO, C.C.; CAIPANG, C.M.A. Mucosal immunity and probiotics in fish. Fish Shellfish Immunol., v.39, p.78-89, 2014b.
• LEVINE, M.M.; KOTLOFF, K.L.; BARRY, E.M.; PASETTI, M.F.; SZTEIN, M.B. Clinical trials of Shigella vaccines: two steps forward and one step back on a long, hard road. Nature Rev. Microbiol., v.5, p.540-553, 2007.
• LIESCHKE, G.J.; CURRIE, P.D. Animal models of human disease: zebrafish swim into view. Nature Rev. Genet., v.8, p.353-367, 2007.
• LIESCHKE, G.J.; TREDE, N.S. Fish immunology. Curr. Biol., v.19, p.R678-R682, 2009.
• LIMA, I.F.; HAVT, A.; LIMA, A.A. Update on molecular epidemiology of Shigella infection. Curr. Opin. Gastroenterol., v.31, p.30-37, 2015.
• MATTOCK, E.; BLOCKER, A.J. How do the virulence factors of Shigella work together to cause disease? Front. Cell. Infect. Microbiol., v.7, p.64, 2017.
• MOORTHY, G.; MURALI, M.; DEVARAJ, S.N. Lactobacilli inhibit Shigella dysenteriae 1 induced pro-inflammatory response and cytotoxicity in host cells via impediment of Shigella-host interactions. Digest. Liver Dis., v.42, p.33-39, 2010.
• PÉDRON, T.; THIBAULT, C.; SANSONETTI, P.J. The invasive phenotype of Shigella flexneri directs a distinct gene expression pattern in the human intestinal epithelial cell line Caco. 2. J. Biol. Chem., v.278, p.33878-33886, 2003.
• PÉREZ SÁNCHEZ, M.; FUNDORA HERNÁNDEZ, H.; NOTARIO RODRÍGUEZ, M. et al. Factores de riesgo inmunoepidemiológicos en niños con infecciones respiratorias recurrentes. Rev. Cubana Pediatría, v.83, p.225-235, 2011.
• PHALIPON, A.; SANSONETTI, P.J. Shigella’s ways of manipulating the host intestinal innate and adaptive immune system: a tool box for survival? Immunol. Cell Biol., v.85, p.119-129, 2007.
• PLAZA-DIAZ, J.; GOMEZ-LLORENTE, C.; FONTANA, L.; GIL, A. Modulation of immunity and inflammatory gene expression in the gut, in inflammatory diseases of the gut and in the liver by probiotics. World J. Gastroenterol., v.20, p.15632, 2014.
• PUZARI, M.; SHARMA, M.; CHETIA, P. Emergence of antibiotic resistant Shigella species: a matter of concern. J. Infect. Public Health, v.11, p.451-454, 2018.
• SCHROEDER, G.N.; HILBI, H. Molecular pathogenesis of Shigella spp.: controlling host cell signaling, invasion, and death by type 3. secretion. Clin. Microbiol. Rev., v.21, p.134-156, 2008.
• STAPPENBECK, T.S.; HOOPER, L.V.; GORDON, J.I. Developmental regulation of intestinal angiogenesis by indigenous microbes via Paneth cells. Proc. Nat. Acad. Sci., v.99, p.15451-15455, 2002.
• SULLIVAN, C.; MATTY, M.; JURCZYSZAK, D.; GABOR, K. et al. Infectious disease models in zebrafish. Methods in cell biology. Amsterdam, Netherlands: Elsevier, 2017. p.101-136.
• TACCONELLI, E.; CARRARA, E.; SAVOLDI, A.; HARBARTH, S. et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis., v.18, p.318-327, 2018.
• TIEN, M.T.; GIRARDIN, S.E.; REGNAULT, B.; LE BOURHIS, L. et al. Anti-inflammatory effect of Lactobacillus casei on Shigella-infected human intestinal epithelial cells. J. Immunol., v.176, p.1228-1237, 2006.
• WALLACE, T.D.; BRADLEY, S.; BUCKLEY, N.D.; GREEN-JOHNSON, J.M. Interactions of lactic acid bacteria with human intestinal epithelial cells: effects on cytokine production. J. Food Prot., v.66, p.466-472, 2003.
• WANG, Y.; XIE, J.; LI, Y.; DONG, S. et al. Probiotic Lactobacillus casei Zhang reduces pro-inflammatory cytokine production and hepatic inflammation in a rat model of acute liver failure. Eur. J. Nutr., v.55, p.821-831, 2016.
• WONG, D.; VON KEYSERLINGK, M.A.; RICHARDS, J.G.; WEARY, D.M. Conditioned place avoidance of zebrafish (Danio rerio) to three chemicals used for euthanasia and anaesthesia. PLoS One, v.9, p.e88030, 2014.
• YANG, Y.; FANG, Q.; SHEN, H.B. Predicting gene regulatory interactions based on spatial gene expression data and deep learning. PLoS Comput. Biol., v.15, p.e1007324, 2019.
• ZANG, L.; MA, Y.; HUANG, W.; LING, Y. et al. Dietary Lactobacillus plantarum ST-III alleviates the toxic effects of triclosan on zebrafish (Danio rerio) via gut microbiota modulation. Fish Shellfish Immunol., v.84, p.1157-1169, 2019.
• ZHANG, Y.C.; ZHANG, L.W.; MA, W.; YI, H.X. et al. Screening of probiotic lactobacilli for inhibition of Shigella sonnei and the macromolecules involved in inhibition. Anaerobe, v.18, p.498-503, 2012.

• FUNDİNG

  The research was supported by the student for the thesis project.

• ETHİCS APPROVAL

  Approved by Islamic Azad University Ethical Committee by the code: IR.IAU.TMB.REC.42.440

• CONSENT TO PARTİCİPATE

  No clinical trials were included in this research.

Publication Dates

• Publication in this collection
  30 May 2022
• Date of issue
  Mar-Apr 2022

History

• Received
  15 Aug 2021
• Accepted
  18 Oct 2021