Abstract
Previously, only partial P element sequences have been reported in the saltans group of Drosophila but in this paper we report two complete P element sequences from Drosophila sturtevanti and Drosophila prosaltans. The divergence of these sequences from the canonical P element of Drosophila melanogaster is about 31% at the nucleotide level. Phylogenetic analysis revealed that both elements belong to a clade of divergent sequences from the saltans and willistoni groups previously described by other authors.
D. sturtevanti; D. prosaltans; full-size P element; phylogeny
ANIMAL GENETICS
RESEARCH ARTICLE
Characterization of two full-sized P elements from Drosophila sturtevanti and Drosophila prosaltans
Juliana Polachini de Castro; Claudia M.A. Carareto
Universidade Estadual Paulista, Departamento de Biologia, São José do Rio Preto, SP, Brazil
ABSTRACT
Previously, only partial P element sequences have been reported in the saltans group of Drosophila but in this paper we report two complete P element sequences from Drosophila sturtevanti and Drosophila prosaltans. The divergence of these sequences from the canonical P element of Drosophila melanogaster is about 31% at the nucleotide level. Phylogenetic analysis revealed that both elements belong to a clade of divergent sequences from the saltans and willistoni groups previously described by other authors.
Key words:D. sturtevanti, D. prosaltans, full-size P element, phylogeny.
Introduction
The P elements were first discovered in Drosophila melanogaster because of their ability to induce hybrid dysgenesis (Kidwell et al., 1977). Autonomous P elements are 2.9 kb in length and have four open reading frames which encode two polypeptides, an 87 kDa transposase enzyme necessary for transposition (Rio et al., 1986) and a 66 kDa repressor protein (Robertson and Engels, 1989). Also required for transposition are the element termini, which include flanking 31-bp perfect inverted repeats (O'Hare and Rubin, 1983), 11-bp subterminal repeats and unique terminal sequences comprising approximately 150 bp (see Engels, 1989 for a review).
Sequences belonging to the P family are particularly common in the four principal species groups (melanogaster, obscura, saltans and willistoni) which make up the subgenus Sophophora (Daniels et al., 1990) but have also been described in drosophilid species such as Drosophila mediopunctata which is not part of the Sophophora subgenus (Loreto et al., 2001) and also in Scaptomyza pallida, a drosophilid which does not belong to the genus Drosophila (Anxolabéhère et al., 1985; Simonelig and Anxolabéhère, 1991, 1994). Transposable elements similar to the P elements of the Drosophilidae have also been isolated from members of a few other Diptera families, e.g. Lucilia cuprina from the Calliphoridae (Perkins and Howells, 1992), Musca domestica from the Muscidae (Lee et al., 1999) and seven species Anopheles from the Culicidae (Sarkar et al., 2003). More divergent and rudimentary sequences related to P-transposable elements have also been described using 'in silico' searches such as Hoppel (Reiss et al., 2003) and Proto P (Kapitonov and Jurka, 2003) for the Drosophila melanogaster genome and Phsa (Hagemann and Pinsker, 2001) for the human genome.
Phylogenetic studies based on nucleotide sequences (Clark and Kidwell, 1997; Hagemann et al., 1994, 1996; Silva and Kidwell, 2000) indicated that the more than 200 P element sequences obtained to date fall into 16 distinct clades or subfamilies (Figure 1). Four of these subfamilies have been well characterized. The canonical subfamily appears to be restricted to the sophophoran New World species groups saltans and willistoni (Clark et al., 1995), with the notable exception of Drosophila mediopunctata, which contains P elements due to horizontal transfer (Loreto et al., 2001). Three P element subfamilies (M-, O- and T-type) are found in the Old World obscura species group (Hagemann et al., 1992, 1994, 1996), with the T-type appearing to be restricted to the obscura lineage (Hagemann et al., 1998) while the M- and O-types also occur in the saltans and willistoni groups. A new subfamily, the K-type (restricted to the montium subgroup species), has recently been described by Nouaud et al. (2003).
The descriptions of the P element subfamilies in the saltans and willistoni species groups have been based so far mainly on partial sequences (Clark et al., 1995; Clark and Kidwell, 1997; Haring et al., 2000; Silva and Kidwell, 2000). The work described in this paper compared two complete sequences obtained from two different saltans subgroups (sturtevanti and saltans) to some of the complete sequences from different P element subfamilies as well as to a data set consisting of 80 partial consensus sequences provided by Clark and Kidwell (1997) in order to establish their phylogenetic relationships.
Materials and Methods
Fly stocks
We used Drosophila sturtevanti collected in the Mexican town of Matlapa and Drosophila prosaltans collected in the town of Eldorado in the Brazilian state of Rio Grande do Sul both strains having been recently derived from natural populations and subsequently maintained in the laboratory, under standard conditions.
DNA Amplification and Sequencing
Polymerase chain reactions were carried out using a total volume of 50 mL containing 100 ng of genomic DNA, 1 mM MgCl2, 400 mM of each deoxynucleotide, 0.5 mM of M-IR primer (5'CATAAGGTGGTCCCGTCG3', corresponding to nt. 14-31 and 2877-2894, within the TIRs - terminal inverted repeats - of the D. melanogaster canonical P element; Haring et al., 1995) and 2 units of Taq polymerase in 1x polymerase buffer. Amplification consisted of 30 cycles of 45 s denaturation at 94 °C, 45 s of primer annealing at 57 °C and 1.5 min of primer extension at 72 °C. The first cycle was preceded by a step of 7 min at 94 °C for denaturation and the last cycle was followed by a final extension at 72 °C for 10 min. The PCR products were cloned into a TOPO TA cloning vector (Invitrogen) and both strands of a randomly-chosen single clone were sequenced for each species. The primers Stu1369 (5'GTTCCGTATCG AGAC CCGA C3'), Stu22402 (5'AATGACGAAGACTC GTCGC G3'), Stu51091 (5' GGAAGCAACCAGTTTTCT TT3') and Stu61598 (5'CACATCAAACCAATCATTTA3') were designed based on the clone sequences and used to complete the sequencing of the element.
Sequence alignment and phylogenetic analysis
For alignment we used a set (Clark and Kidwell, 1997) of 80 partial (429 bp) P-element consensus sequences mapped to positions 1328-1757 in open reading frame 2 (ORF 2) of the canonical P element and the following full-length P element nucleotide sequences obtained from the literature: D. melanogaster p25.1 (O'Hare and Rubin, 1983); Drosophila nebulosa N10 (Lansman et al., 1987); Drosophila willistoni (Daniels et al., 1990); Drosophila guanche, Drosophila bifasciata and D. bifasciata jbifM3 (Hagemann et al., 1992); Drosophila ambigua T-type (Hagemann et al., 1998); Drosophila helvetica M-type (Haring et al., 2000); D. mediopunctata (Loreto et al., 2001); Scaptomyza pallida (Simonelig and Anxolabéhère, 1991) and M. domestica (Lee et al., 1999). The P element DNA sequences obtained by us in this study have been deposited in the GenBank under accession number AF530052 for D. sturtevanti and AF530053 for D. prosaltans.
Alignments of sequences were done by the CLUSTAL W program (Thompson et al., 1994) and the phylogenetic relationships between the P sequences constructed using the maximum parsimony method as implemented in PAUP program version 4.0b10 (Swofford, 1997). Branch support was calculated using bootstrap analysis with 500 replicates. The distance matrix was constructed according to the Kimura two-parameter model of nucleotide substitution (Kimura, 1980).
Results and Discussion
Sequence features
The M-IR primer corresponds to positions 14-31 and 2877-2894 of the canonical P element, and so cannot amplify the first and last 13 bp of a complete P element. The D. sturtevanti P element is 2829 bp and the D. prosaltans 2828 bp, if the TIRs of these elements are complete they should be 2854 bp for D. sturtevanti and 2855 bp for D. prosaltans, which is about 50 bp less than the D. melanogaster canonical P element. The alignment of the two sequences against the D. melanogaster sequence showed that the D. sturtevanti and D. prosaltans P elements are similar in structure and sequence to each other (88%) but strongly divergent from the D. melanogaster canonical P element (31% different). Table 1 shows the main differences between the alignments from which it can be seen that, in general, D. sturtevanti has the same deletions and insertions as the D. prosaltans.
Even though the TIRs were not completely sequenced, PCR amplification with primers specific to the TIR regions indicates that at least the second half of the TIRs are present and well conserved both in D. sturtevanti and D. prosaltans. However, the transposase binding sites, located at positions 48-68 and 2855-2871 in D. melanogaster (Kaufman et al., 1989), the TATA box and the 11-bp subterminal inverted repeats are not well conserved. In all four exons the translational reading frame is interrupted by stop codons and frameshift mutations, suggesting that these sequences do not encode a functional protein. Indeed, leucine-zipper and helix-turn-helix motifs were not detected, supporting the suggestion that these sequences might be non-autonomous in the genome.
A nucleotide differentiation and genetic difference matrix based on Kimura's two-parameter method was calculated for the full-length P element sequences from the literature and the two sequences described here (Table 2) and it was found that the D. sturtevanti and D. prosaltans sequences present an overall divergence of 31% as compared to the canonical sequences described in D. melanogaster, D. willistoni, D. mediopunctata and D. nebulosa.
Phylogenetic analysis
Phylogenetic analyses of P elements in the subgenus Sophophora (Clark et al., 1995, 1998; Clark and Kidwell, 1997; Silva and Kidwell, 2000) indicate the existence of multiple P element subfamilies in lineages of single species that apparently must have entered the genome at different times during the past (Lee et al., 1999; Haring et al., 2000). The aim of our phylogenetic analysis was to determine if the D. sturtevanti and D. prosaltans P element sequences belonged to some of the well-characterized P element subfamilies. Figure 1 summarizes the results of our phylogenetic analysis of P element sequences using parsimony, from which it can be seen that in 100% of bootstrap replicates the D. sturtevanti and D. prosaltans sequences clustered in Clark and Kidwell's (1997) F clade, which contains P element sequences of some other saltans group species as well as some willistoni group species.
Based on an internal portion of the P element exon 2, Clark et al. (1995) and Clark and Kidwell (1997) placed the P elements of saltans group in four different clades or subfamilies (A, E, F and O) and found that the divergence within the other three saltans-willistoni clades, excluding the canonical P element clade, ranges from 17% to 30% up to 46%. Our sequences belong to Clark and Kidwell's (1997) clade F and have a nucleotide divergence varying from 6% to 17% within this clade. Clark and Kidwell thought that the F subfamily may be under represented in the saltans group because they had sampled only a few sequences, although they did not discard the hypothesis that this low frequency could be due to the use of PCR primers for sampling. However, our data suggest that the F clade P element subfamily might be more widely distributed in the saltans group than previously believed because this P element was detected in two different species in spite of the fact that canonical sequences (Castro and Carareto, 2004) also existed in these genomes.
Acknowledgments
We are indebted to Drs. M.G. Kidwell and A.J. Holyoake who kindly provided advice and laboratory facilities at the University of Arizona and for their critical comments on earlier versions of the manuscript. We also thank J.C. Silva (University of Arizona, Tucson, USA) and V.L.S. Valente (Universidade Federal do Rio Grande do Sul, Departamento de Genética, Porto Alegre-RS, Brazil) for supplying the drosophilid strains used in this study and J.B. Clark and M.G. Kidwell for the sequences data set. This work was supported by the Brazilian agencies FAPESP (Grants n. 95/7192-2, 98/08734-1 and 00/11313-0 and a fellowship to J.P.C.) and CNPq.
Associate Editor: Louis Bernard Klaczko
Received: May 28, 2003;
Accepted: February 16, 2004.
References
- Anxolabéhère D and Périquet G (1987) P-homologous sequences in Diptera are not restricted to the Drosophilidae family. Genet Iber 39:211-222.
- Castro JP and Carareto CMA (2004). Canonical P elements are transcriptionally active in the saltans group of Drosophila J Mol Evol 59:31-40.
- Clark JB and Kidwell MG (1997) A phylogenetic perspective on P transposable element evolution in Drosophila. Proc Natl Acad Sci USA 94:11428-11433.
- Clark JB, Altheide TK, Schlosser MJ and Kidwell MG (1995) Molecular evolution of P transposable elements in the genus Drosophila I. The saltans and willistoni species group. Mol Biol Evol 12:902-913.
- Clark JB, Kim P and Kidwell MG (1998) Molecular evolution of P transposable elements in the genus Drosophila III. The melanogaster species group. Mol Biol Evol 15:746-755.
- Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG and Chovnick A (1990) Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics 124:339-355.
- Engels WR (1989) P elements in Drosophila In: Berg D and Howe M (eds) Mobile DNA. American Society for Microbiology, Washington, DC, pp 437-484.
- Hagemann S and Pinsker W (2001) Drosophila P transposons in the human genome? Mol Biol Evol 18:1979-1982.
- Hagemann S, Miller WJ and Pinsker W (1992) Identification of a complete P-element in the genome of Drosophila bifasciata. Nucl Acids Res 20:409-413.
- Hagemann S, Miller WJ and Pinsker W (1994) Two distinct P element families subfamilies in the genome of Drosophila bifasciata. Mol Gen Genet 244:168-175.
- Hagemann S, Miller WJ and Pinsker W (1996) A new P element subfamily from Drosophila tristis, D. ambigua and D. obscura. Genome 39:978-985.
- Hagemann S, Haring E and Pinsker W (1998) Horizontal transmission versus vertical inheritance of P elements in Drosophila and Scaptomyza: Has the M-type subfamily spread from East Asia? J Zool Syst Evol Res 36:75-83.
- Haring E, Hagemann S and Pinsker W (1995) Different evolutionary behavior of P element subfamilies: M-type and O-type elements in Drosophila bifasciata and D. imaii. Gene 163:197-202.
- Haring E, Hagemann S and Pinsker W (2000) Ancient and recent horizontal invasions of drosophilids by P elements. J Mol Evol 51:577-586.
- Kapitonov VV and Jurka J (2003) Molecular paleontology of transposable elements in the Drosophila melanogaster genome. Proc Natl Acad Sci USA 100:6569-6574.
- Kaufman PD, Doll RF and Rio DC (1989) Drosophila P element transposase recognizes internal P element DNA sequences. Cell 59:359-371.
- Kidwell MG, Kidwell JF and Sved JA (1977) Hybrid dysgenesis in Drosophila melanogaster: A syndrome of aberrant traits including mutation, sterility and male recombination. Genetics 86:813-833.
- Kimura M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative analysis of nucleotide sequences. J Mol Evol 16:111-120.
- Lansman RA, Shade RO, Grigliatti TA and Brock HW (1987) Evolution of P transposable elements: Sequences of Drosophila nebulosa P elements. Proc Natl Acad Sci USA 84:6491-6495.
- Lee SH, Clark JB and Kidwell MG (1999) A P element-homologous sequence in the house fly, Musca domestica. Insect Mol Biol 8:491-500.
- Loreto ELS, Valente VLS, Zaha A, Silva JC and Kidwell MG (2001) Drosophila mediopunctata P elements: A new example of horizontal transfer. The J Hered 92:375-381.
- Nouad D, Quesneville H and Axolabéhère D (2003). Recurrent exon shuffling between distant P-element families. Mol Biol Evol 20:190-199.
- O'Hare K and Rubin GM (1983) Structure of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35.
- Perkins HD and Howells AJ (1992) Genomic sequences with homology to the P element of Drosophila melanogaster occur in the blowfly Lucilia cuprina. Proc Natl Acad Sci USA 89:10753-10757.
- Reiss D, Quesneville H, Nouaud D, Andrieu O and Anaxolabéhère D (2003) Hoppel, a P-like element without introns: A P-element ancestral structure or a retrotranscription derivative? Mol Biol Evol 20:869-879.
- Rio DC, Laski FA and Rubin GM (1986) Identification and immunochemical analysis of biologically active Drosophila P element transposase. Cell 44:21-32.
- Robertson HM and Engels WR (1989) Modified P elements that mimic P cytotype in Drosophila melanogaster Genetics 123:815-824.
- Sarkar A, Sengupta R, Krzywinski J, Wang X, Roth C and Collins FH (2003) P elements are found in the genomes of nematoceran insects of the genus Anopheles Insect Biochemistry and Molecular Biology 33:381-387.
- Saitou N and Nei M (1987) The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406-425.
- Silva JC and Kidwell MG (2000) Horizontal transfer and selection in the evolution of P elements. Mol Biol Evol 17:1542-1557.
- Simonelig M and Anxolabéhère D (1991) A P element of Scaptomyza pallida is active in Drosophila melanogaster Proc Natl Acad Sci USA 88:6102-6106.
- Simonelig M and Anxolabéhère D (1994) P elements are old components of the Scaptomyza pallida genome. J Mol Evol 38:232-240.
- Swofford D (1997) PAUP: Phylogenetic analysis using parsimony. Version 4.0b10. Smithsonian Institution, Washington, D.C.
- Thompson JD, Higgins DG and Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple alignment through sequence weighting, positions-specific gap penalties and weigh matrix choice. Nucl Acids Res 22:4673-4680.



