Open-access HB D Los Angeles in a Brazilian family

Hb D Los Angeles em família brasileira

Abstract

Inherited disorders of hemoglobin, the most common monogenic disease, are now well understood at the molecular level, knowledge, which has led to considerable improvements in their control and management. The Brazilian population is multiethnic, and the correct characterization of the Hb D is important, mainly because the method available for detection of abnormal hemoglobins, present a migration in the same zone at alkaline pH, for Hb S, D, and G for example. In this paper we studied a family with an abnormal hemoglobin like S in alkaline electrophoresis, by appropriated methods including HPLC and molecular analysis, characterized as hemoglobin D Los Angeles.

Hemoglobin D; variant hemoglobin; polymorphism hemoglobin


Resumo

As doenças hereditária da hemoglobina são as mais comuns doenças monogênicas e atualmente bem conhecidas do ponto de vista molecular, fato este que propiciou um avanço no seu controle e manuseio. A população brasileira caracteriza-se pela multiplicidade étnica e a caracterização da Hb D torna-se importante por este dado, associado ao fato de que os métodos de detecção das hemoglobinopatias comumente não identificam esta fração anormal que apresenta a peculiaridade de migração eletroforéticia em pH alcalino na mesma zona observada nas Hb S e G. Neste relato é apresentado um estudo familiar no qual é empregada metodologia adequada, o HLPC, que permite a identificação da Hb D.

Hemoglobina D; hemoglobina variante; hemoglobinopatia


Artigo

HB D Los Angeles in a Brazilian family

Guilherme G. Leoneli1 Silma M.A. Melo2 Marco A. Zago3 Wilson A. Silva Jr.3 Cláudia R. Bonini-Domingos1

Inherited disorders of hemoglobin, the most common monogenic disease, are now well understood at the molecular level, knowledge, which has led to considerable improvements in their control and management. The Brazilian population is multiethnic, and the correct characterization of the Hb D is important, mainly because the method available for detection of abnormal hemoglobins, present a migration in the same zone at alkaline pH, for Hb S, D, and G for example. In this paper we studied a family with an abnormal hemoglobin like S in alkaline electrophoresis, by appropriated methods including HPLC and molecular analysis, characterized as hemoglobin D Los Angeles.

Keywords: Hemoglobin D, variant hemoglobin, polymorphism hemoglobin

Introduction

More than 700 globin gene defects are known (1). Most of these hemoglobins (Hb) have been identified at the protein level by electrophoretic mobility on cellulose acetate and citrate agar, but the underlying molecular defect has not been determined for many hemoglobinopathies (2, 3).

The protocol for the detection and identification of hemoglobinopathies consists of initial screening by electrophoresis on cellulose acetate followed by further confirmatory testing [4]. Advanced molecular genetic techniques such as the polymerase chain reaction (PCR) and direct sequencing offer the possibility of identifying the underlying mutations in the variants (5).

Hemoglobin D Los Angeles, the most common D hemoglobin (Hb D), has the structure b121(GH4) GLU > GLN, normal stability and normal or slightly increased oxygen affinity. Homozygous generally has normal hemoglobin values and red cell indices (6, 7). Hb D presents an electrophoretic mobility similar to Hb S and thus confirmatory testing are necessary.

Hb S is very common in Brazil, and the correct characterization is important. The genetic variability in Brazilian population is high mainly by the immigration process and racial diversity. To detect the molecular defect of variant hemoglobins in our population, we studied in this paper a blood donor's family with abnormal hemoglobin such as Hb S in electrophoretic diagnosis.

Material and Methods

Peripheral blood samples were collected into a Vacutainers (Becton-Dickinson, Corkeysville, USA) with EDTA as coagulant. Informed consent was given. Hemoglobin analysis was done with red cell lysates using alkaline and acid electrophoresis, Isoelectric focusing (IEF) and cation exchange high performance liquid chromatography (HPLC) (8). The HPLC procedure was developed using the Variant-Biorad with beta thalassemia short program.

DNA was isolated from white cells by organic extraction. The molecular analysis included PCR followed by restriction enzyme digestion. Enzymatic amplification of the mutated genes with Taq polymerase were carried out as previously described (5). Primers 5'TGCCTCTTTGCACCAT3' and 5'GACCTCCCACATTCCCTTTT3' were used for amplification of the b globin gene comprising exon 3. The amplified DNA was digested by EcoRI and the product was analyzed in polyacrilamide gel electrophoresis. Direct sequencing of the amplified DNA was performed with ABI PRISM (Perkin Elmer) according to the protocol of the manufacturer.

Results and Discussion

The Brazilian population is multiethnic, and the correct characterization of the Hb D is important, mainly because of the method available for detection of abnormal hemoglobins, presents a migration in the same zone at alkaline pH, for Hb S, D, and G.

The family studied consisted of parents and two children, is caucasians, residing in Minas Gerais, Brazil, without symptoms. The parents had one child with abnormal hemoglobin diagnosed in the screening neonatal program, and the father has been a blood donor for several years. Alkaline and acid hemoglobin electrophoresis showed suspected heterozygous D hemoglobin in the father and son. The mother and the other son, have normal hemoglobin. Isoelectric focusing (IEF) showed a pattern similar to Hb AD, and in the globin chain electrophoresis showed a beta globin mutant. By rapid cation exchange chromatography - HPLC the chromatogram showed abnormal hemoglobin in the Hb D window with a retention time of 4.16 and 28,3% (Figure 1).


The molecular analysis by PCR followed by digestion with EcoRI restriction enzyme showed fragments of 296, 268, 564 pb. The globin gene mutation for Hb D Los Angeles abolishes a recognition site for this restriction enzyme. The hemoglobin D Los Angeles can easily be diagnosed by amplification of exon 3 of the beta globin gene, subsequent restriction enzyme digestion and gel electrophoresis. Direct sequencing after PCR amplification of exon 3 revealed a G®C transversion at position 1 in codon 121 leading to the replacement of glutamic acid by glutamine, corresponding to the underlying molecular defect of Hb D Los Angeles.

Hb D Los Angeles is also known as D-Punjab, D-North Caroline, D-Portugal; Oakrige and D Chicago. It's a hemoglobinopathy without severe clinical consequences, and results from a mutation in the external contact at the exon 3 of beta globin [beta 121 (GH4) Glu®Gln]. In alkaline electrophoresis Hb D moves slower than Hb A, as Hb S, and no separation at acid pH. It's primarily found in Northern India but is widespread and has been observed in persons from China, England, Holland, Australia, Greece, Yugoslavia, and Turkey. In heterozygote the quantity of abnormal hemoglobin is almost 40%. It has been found in combination with Hb S, Hb C, beta and alpha thalassemia. It's considered the fourth most frequently occourring Hb variant. The determination of hemoglobin variant may also assist in family studies and genetic counseling.

Acknowledgment

We thank Capes, Bio-Rad, Bio-Oxford and CELM by the support and technical assistance.

Hb D Los Angeles em família brasileira

G.G. Leoneli, S.M.A. Melo, M.A. Zago, W.A. Silva Jr., C.R. Bonini-Domingos

Resumo

As doenças hereditária da hemoglobina são as mais comuns doenças monogênicas e atualmente bem conhecidas do ponto de vista molecular, fato este que propiciou um avanço no seu controle e manuseio. A população brasileira caracteriza-se pela multiplicidade étnica e a caracterização da Hb D torna-se importante por este dado, associado ao fato de que os métodos de detecção das hemoglobinopatias comumente não identificam esta fração anormal que apresenta a peculiaridade de migração eletroforéticia em pH alcalino na mesma zona observada nas Hb S e G. Neste relato é apresentado um estudo familiar no qual é empregada metodologia adequada, o HLPC, que permite a identificação da Hb D.

Palavras-chave : Hemoglobina D, hemoglobina variante, hemoglobinopatia

Recebido: 03/07/01

Aceito: 10/10/01

Correspondence to: Guilherme G. Leoneli

Department of Biology, Hemoglobin Laboratory, UNESP

Rua Cristóvão Colombo, 2265. 15054-000. São José do Rio Preto. SP. Brazil

Fax: (17) 221-2390

References

  • 1 International Hemoglobin Information Center (IHIC). Alphabetical Hemoglobin Variants List 1996. 20(3): 313-335
  • 2. Schnee J, Aulehla-Scholz C, Eigel A, Horst J. Hb D Los Angeles (D-Punjab) and Hb Presbyterian; analysis o the defect at the DNA level Human Genetics 1999, 84: 365-367.
  • 3. Weatherall DJ & Clegg JB. The haemoglobinopathies, Bailliers Clinical Haematology. W.B. Saunders Company, London.1993.
  • 4. Bunn HF, Forget BG. Hemoglobin: molecular, genetic and clinical aspects W.B. Saunders Company, Philadelphia. 1986.
  • 5. Guideline. The laboratory diagnosis of haemoglobinopathies British. J. Haematol. 1998. 101: 783-92.
  • 6. Saiki RK, Gelfand DH, Stofel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase Science. 1988. 230: 487-491.
  • 7. Kirk CM, Papadea CN, Lazarchick J. Laboratory recognition of rare hemoglobinopathy- hemoglobins SS and SG Philadelphia associated with a-thalassemia-2 Arch. Pathol. Lab. Med. 1999. 123:963-966.
  • 8. Steinberg MH and Adams III JG. Laboratory diagnosis of sickling hemoglobinopathies Southern Medical Journal. 1978. 71(4): 413-416.
  • 9. Riou J, Godart C, Hurtrel D, Mathis M, Bimet C, Bardakdjian-Midrau J, Préhu C, Wajcman H, Galactéros F. Cation-exchange HPLC eveluated for presumptive identification of hemoglobin variants Clinical Chemistry 1997. 43: 34-39.
  • 10. Siguret V & Andreux JP. 1997. Biological diagnosis of hemoglobinopathies by phenotype analysis Ann. Biol. Clin 55(2): 103-112.
  • 11. Kutlar F, Kutlar A, Nuguid E, Prchal J, Huisman HTJ. Usefulness of HPLC methodology for the characterization of combinations of the common beta chain variants Hb S, C, and O-Arab and the alpha chain variant Hb G-Philadelphia Hemoglobin. 1993. 17(1); 55-66.
  • 12. Fucharoen S, Winichagoon P, Wiseppanichky R, Sae-Ngow B, Srephanich R, Oncoung W, Muangsapaya W, Chowthaworn J, Kanokpongsakdi S, Bunyratvey A, Piankijaguna A, Dewade C. 1998. Clinical Chemistry 44(4): 740-748.
  • 13. Vella F. Acid agar gel electrophoresis of Human hemoglobin Am. J. Clin. Path., 1968. 49(3): 440-2.
  • 14. Honig GR, Adams III JG. Human hemoglobin genetics. Wien: Springer, 986.
  • 1. Department of Biology, Hemoglobin Laboratory, UNESP, São José do Rio Preto, São Paulo, Brazil
    . Department of Biology, Hemoglobin Laboratory, UNESP, São José do Rio Preto, São Paulo, Brazil
    2. Hemocentro Foundation, Uberlandia, Minas Gerais, Brazil
    3. Hemocentro Foundation, Ribeirão Preto, São Paulo, Brazil
  • Publication Dates

    • Publication in this collection
      12 Aug 2002
    • Date of issue
      Sept 2001

    History

    • Accepted
      10 Oct 2001
    • Received
      03 July 2001
    location_on
    Associação Brasileira de Hematologia e Hemoterapia e Terapia Celular R. Dr. Diogo de Faria, 775 cj 114, 04037-002 São Paulo/SP/Brasil, Tel. (55 11) 2369-7767/2338-6764 - São Paulo - SP - Brazil
    E-mail: secretaria@rbhh.org
    rss_feed Stay informed of issues for this journal through your RSS reader
    Go to top Report error