Abstract
Among Bemisia tabaci species, the invasive MEAM1 and MED species are key agricultural pests for many crops. In Brazil, most part of B. tabaci population outbreaks were associated with MEAM1, which, since 1990s quickly spread across the entire country. Later in 2014, the MED was identified in Brazil, initially more restricted to greenhouses, but suddenly reaching new areas in the South and Southeast open regions. Thus, our objective was to investigate the geographical distribution of MEAM1 and MED on open field crops in Brazil. MEAM1 is still the predominant species on open field crops such as soybean, cotton, and tomato. The sequencing of a cytochrome c oxidase subunit I (COI) gene fragment revealed a single haplotype of MEAM1, suggesting the establishment of a single MEAM1 strain in the country. The haplotypes found for MEAM1 and MED are genetically related to the globally dispersed strains, Jap1 and Mch1, respectively. Continuous monitoring of B. tabaci species is crucial because landscape alterations, climatic changes, and pest management methods may shift the B. tabaci species distribution and dominance in Brazilian crop areas.
Keywords:
whitefly; DNA barcode; invasive species; tropical agriculture
Resumo
Dentre as espécies de Bemisia tabaci, as espécies invasoras MEAM1 e MED se destacam como pragas de grande importância para várias culturas. No Brasil, a maior parte dos surtos populacionais de mosca-branca são associados a presença da espécie MEAM1, que a partir 1990 se espalhou por todo o país. Por outro lado, em 2014 a espécie MED foi identificada no Brasil, inicialmente restrita a casas de vegetação, mas rapidamente se difundindo em novas áreas nas regiões Sul e Sudeste do Brasil. Assim, nosso objetivo foi investigar a distribuição geográfica das espécies MEAM1 e MED em grandes culturas no Brasil. A espécie MEAM1 continua sendo predominante nas monoculturas como algodão, soja e tomate. O sequenciamento de um fragmento do gene citocromo c oxidase subunidade I (COI) revelou a presença de um haplótipo para MEAM1, sugerindo o estabelecimento de apenas uma linhagem no país. Os haplótipos encontrados para MEAM1 e MED são geneticamente relacionados as linhagens globalmente dispersas Jap1 e Mch1, respectivamente. O monitoramento contínuo das espécies de B. tabaci é crucial pois as mudanças na paisagem, mudanças climáticas e métodos de manejo das pragas podem alterar a dominância e a distribuição dessas espécies nas áreas agrícolas do Brasil.
Palavras-chave:
mosca-branca; código de barras DNA; espécies invasoras; agricultura tropical
1. Introduction
Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a complex of polyphagous species worldwide distributed and damages many crops by direct feeding or phytopathogenic virus transmission (Bedford et al., 1994; Hadjistylli et al., 2016). Among B. tabaci species, MEAM1 (Middle-East-Asia Minor 1, commonly known as B biotype) and MED (Mediterranean, commonly known as Q biotype) are the most economically important due to their global distribution, frequent population outbreaks, high tolerance to insecticides, and high capacity of transmitting phytopathogenic viruses to cultivated plants (Rauch and Nauen, 2003; Barro and Ahmed, 2011; Barro et al., 2011).
In Brazil, the B. tabaci NW (New World, commonly known as A biotype) was the more frequent species in agricultural areas until the mid-1900s, when the invasive MEAM1 started to be reported in Brazil (Lourenção and Nagai, 1994). Currently, MEAM1 is well established throughout Brazil on a wide diversity of cultivated and non-cultivated hosts, becoming a primary pest in vegetables and commodity crops such as soybean and cotton (Silva et al., 2009; Fontes et al., 2012). In 2014, the B. tabaci MED was first reported in Brazil's southernmost state (Rio Grande do Sul) on Capsicum annuum at the greenhouse and Ipomoea batatas at the open field (Barbosa et al., 2015). After that, B. tabaci MED was found in the Southeast, marked by dispersion events associated with vegetables and ornamental plants but mainly at greenhouse conditions (Moraes et al., 2017).
Studies have shown that MEAM1 surpasses MED in some hosts due to better fecundity, high fertility, short lifecycle, and mating behavior (Pascual and Callejas, 2004; Pascual, 2006; Crowder et al., 2010; Smith et al., 2020). On the other hand, MED can be more competitive in protected crops (greenhouse or net house), under intensive insecticide use, or even in some specific hosts (Horowitz et al., 2005; Pascual, 2006; Kontsedalov et al., 2012; Laarif et al., 2015; Smith et al., 2020). These traits may contribute to MED colonization in open field areas in some countries, as well as in some southeast Brazil regions (Sun et al., 2013; Bello et al., 2020; Tang et al., 2019; Teng et al., 2020). Thus, the question has been raised if the MED species is dispersing to the Central and North regions from Brazil predominating over the MEAM1 species in open field crops. Therefore, our goal was to collect B. tabaci individuals on open field crops, in a wide geographic area, between 2016 and 2019 to reveal the current distribution of MEAM1 and MED in these crops in Brazil.
2. Material and Methods
Adult B. tabaci specimens were collected from 2016 to 2019 in eight hosts in 57 areas within nine states of Brazil (Figure 1) from November to June. Most of the sampling was carried out in open monoculture fields, 33 were collected in soybean (Glycine max), seven samples from tomato (Solanum lycopersicum), and six samples from cotton (Gossypium spp.). The insects were subsequently stored in alcohol absolute and maintained at -80 °C, at Bayer S.A Paulinia/SP.
Sample sites and geographical distribution of MEAM1 and MED in Brazil reveal the temperature gradient increases toward the Tropical region. Colors represent the annual mean temperatures, and the circles and X represent the different species. The point locations can be accessed in the Google Platform (Google, 2021). Image adapted from INMET (https://clima.inmet.gov.br/temp)
DNA extraction for each individual was performed according to Walsh et al. (1991) and Moraes et al. (2018), using Chelex 5% protocol. The microsatellite marker (SSR) Bem 23 (Barro et al., 2003) was used for MEAM1 and MED identification based on fragment size amplification. This marker amplifies a fragment of 200 bp to MEAM1 and a fragment of 400 bp to MED, as previously published by Kontsedalov et al. (2012), Moraes et al. (2017), and Bello et al. (2020). Twenty to 30 individuals were identified in each sampling site looking for different genotypes.
Later, 63 individuals from 12 different hosts and geographical locations (11 MEAM1 populations and one MED population) were selected for sequencing of cytochrome c oxidase subunit I (COI) gene fragment (Supplementary information, S1). For COI amplification and sequencing were used the specific primers MEAM1 F: [GAAGTTTATGTTCTTATCTTACCAG] and R: [AGCTGGTTTATTAATCTTTCATTCTA], and MED F: [TCC GGA AGT TTA TGT TCT TAT TTT AC] and R: [TAA GGG CTG GTT TAT TAA TTT TCC AT] developed by Elfekih et al. (2018). PCR reactions were performed using a Master Mix extraction kit (Qiagen) containing 3 µL of ultrapure water, 10 µL of Buffer Top Taq Master Mix (with MgCl2, and ultrapure dNTPs), 1 µL (F and R) of specific primer and 5 µL of individual DNA. The amplification reaction consisted of 5 minutes at 95 °C, 37 cycles at 95 °C for 1 minute, 45 seconds at 48 °C for MEAM1 and 50 °C for MED, 45 seconds at 72 °C, and 1 cycle at 72 °C for 5 minutes. The purification was performed with the ExoSap enzyme (Invitrogen Brazil, São Paulo, SP) and the samples were submitted for bidirectional Sanger sequencing at the Animal Biotechnology Laboratory (USP/ESALQ) in Brazil.
The sequences obtained were analyzed using the software Sequencher 4.8 software (Gene Codes., Ann Harbor, MI), and the consensus sequences were edited to 703 bp size for MEAM1 and 600 bp for MED. The sequences were aligned with the haplotypes from Elfekih et al. (2018) using the Clustal W algorithm in MEGA X software (Kumar et al., 2018). The nucleotide substitution model was selected using the Akaike Information Criterion (Akaike, 1974) in MRMODELTEST v2.3 (Nylander, 2004). Finally, the Bayesian tree was built in MrBAYES v3.1.2 (Ronquist and Huelsenbeck, 2003) using two simultaneous runs with 10 million of generations each, with one cold and three heated chains in each run. In the end, the first 250 trees were discarded as burn-in samples. The IO. KX954177 (Indian Ocean species) haplotype was used as outgroup in our analysis. The phylogenetic tree was esthetically adjusted on Microsoft Office 365 for better visualization.
3. Results
MEAM1 was identified in 55 sampling sites, whereas the MED was found on bell pepper and tomato, both cultivated in the greenhouse in Santo Antonio de Posse (SP) (Figure 1 and Table 1). The species MEAM1 and MED have not been found simultaneously in the same sampling site. Also, the SSR marker didn´t identify hybrids between MEAM1 and MED in our samples.
The specific primers used generated high-quality sequencing chromatograms. The partial COI gene sequencing revealed a single haplotype among all the MEAM1 individuals and a single haplotype among MED individuals (Figure 2). The nucleotide BLAST comparison (NCBI, 2021) and the phylogenetic analysis confirmed the species identification performed by SSR marker Bem 23 (Figure 2).
Phylogenetic tree of the COI haplotypes from MEAM1 and MED species, including two haplotypes (green and yellow) found in Brazil. The numbers in each node represent the Bayesian statistical support generated in MrBayes v3.1.2.
The MEAM1 haplotype showed 100% similarity with the haplotype KX954183 (MEAM1) found in Spain, Israel, and Pakistan (Figure 2). These sequences are genetically related to the Jap1 strain (AB204577). The MED haplotype found was genetically similar to the haplotype KX954192 (MED) from Tunisia and Croatia and matched identically as Mch1 strain (GU086329) (Figure 2). Therefore, the haplotypes found in Brazil for MEAM1 and MED are genetically related to the most invasive and aggressive strains globally, Jap1 and Mch1, respectively.
4. Discussion
MED suppressed MEAM1 in some agricultural areas such as in China (Tang et al., 2019; Teng et al., 2020). However, MEAM1 has remained dominant even after MED invasions in other localities, such as Florida (US) and Turkey (Smith et al., 2020; Topçu et al., 2020). In Brazil, MED spread across the southern region (Moraes et al., 2017), mainly on ornamentals and vegetables. MED was also reported in open fields on tomatoes (Bello et al., 2020) and soybean fields (Bello et al., 2021) in the Southern region, both events associated with population outbreaks and transmission of plant viruses. However, our results suggest that MED has not been established on open field crops in Brazil's Central and North regions.
Host preference, or even the cultivars, may affects B. tabaci species distribution and dominance (Pascual and Callejas, 2004; Liu et al., 2007; Barro et al., 2006; Smith et al., 2020; Topçu et al., 2020; Gorayeb et al., 2021). In our study, the sampling sites were predominantly on soybean, cotton, and tomato crops, historically colonized by MEAM1 in Brazil (Queiroz et al., 2017). Nonetheless, both B. tabaci species displayed good adaptation on soybean and cotton under laboratory conditions, with MED overcoming MEAM1 just on tomato, under laboratory and field (Watanabe et al. 2019; Bello et al., 2020), differing with results on tomatoes fields on USA (Smith et al., 2020). The MED species expansion to Central and North regions may be limited by the low presence of ornamentals trades and greenhouses, environments essential to MED spread and survival in new areas (Rodrigues et al., 2021).
The temperature gradient may influence the colonization of different B. tabaci species in crop areas. Most studies suggest that MED species is favored by higher temperature compared to the MEAM1 species (Kontsedalov et al., 2012; Shan et al., 2014; Xiao et al., 2016). However, this is the opposite that we found in Brazil open field areas, once we did not find MED in any of the samples from Brazil's central and northeast regions, characterized by a tropical savanna climate (Beck et al., 2018), as observed in the sample map in Figure 1.
Reproductive behavior also affects the MEAM1 and MED populations when both occur in the same area (Crowder et al., 2010). Apparently, MEAM1 is favored or less muddle when both species occupy the same place. First, MEAM1 males interfere more frequently in MED copula than the opposite, and second, MEAM1 females became less exigent to copulate with MEAM1 males when MED is present (Pascual and Callejas, 2004; Pascual, 2006; Liu et al., 2007; Crowder et al. 2010). Despite reproductive interactions between MEAM1 and MED, hybrid offspring between MEAM1 and MED was not detected in our samples, and it is not expected due to the high reproductive isolation between the species (Moya et al., 2001; Dinsdale et al., 2010; Boykin et al., 2013; Tahiri et al., 2013).
Lastly, insecticide management could drive the B. tabaci species distribution in Brazil, once is the main B. tabaci suppression strategy is the application of insecticides (Santos et al., 2021). The intense insecticide application seems to favor the MED over MEAM1 (Chu et al. 2012; Sun et al. 2013). However, insecticide resistance was reported in MEAM1 to different insecticides in Brazil (Silva et al., 2009; Dângelo et al., 2018). Insecticide susceptibility of species is a factor that needs to be known because it may drive the competition among MEAM1 and MED species and their distribution in different areas and crops in Brazilian territory (Cordeiro et al., 2014; Horowitz et al., 2005; El-Sherbeni et al., 2019).
The specific primers used in amplification and sequencing of COI gene fragment produced high-quality sequences and revealed a clear estimative of the haplotype and nucleotide diversity compared to universal COI primers used for B. tabaci studies (Elfekih et al., 2018). The unique haplotype found for MEAM1 species suggests that a single invasive strain has been established in Brazil. Other MEAM1 haplotypes were reported in previous studies (Silva et al. 2009; Fontes et al., 2010, 2012), but they still showed a low genetic diversity of MEAM1 in Brazil. The Brazilian MEAM1 and MED strains occurring on large open field crops are genetically associated with the globally dispersed strains, Jap1 and Mch1, respectively (Barro and Ahmed, 2011; Elfekih et al., 2018). The genealogic origins of MEAM1 and MED strains explains the rapid dispersion and adaptation of these B. tabaci species in Brazil since they were previously selected in the other regions of the world to rapid adaptation to new and disturbing environments as the agricultural areas (Barro and Ahmed, 2011; Tang et al., 2019).
We believe that the set of facts described here justify our results and may restrain the spread of MED species in open field crops in Brazil (Laarif et al., 2015; Smith et al., 2020; Topçu et al., 2020). However, Brazilian agriculture is characterized by complex landscapes where many crops are cultivated in rotation during the seasons in different climatic and management conditions (Silva et al., 2020; Dourado et al., 2021). This scenario makes it exceedingly difficult to understand the population dynamics of insects in agricultural areas (Corrêa et al., 2019). Thereby, a rapid change in MEAM1 and MED species distribution and abundance would not be astonishing. Therefore, despite our results indicating MEAM1 predominance, we suggest a continuous monitoring program for B. tabaci species in Brazil.
Acknowledgements
We greatly appreciated the scholarships provided by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) to ASC (311465/2018-8) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) (Finance Code 001) to LMPG.
References
-
AKAIKE, H., 1974. A new look at the statistical model identification. IEEE Transactions on Automatic Control, vol. 19, no. 6, pp. 716-723. http://dx.doi.org/10.1109/TAC.1974.1100705
» http://dx.doi.org/10.1109/TAC.1974.1100705 -
BARBOSA, F., YUKI, A., MASSAHARU, J., MARCHI, R., PERINI, L., PAVAN, M.A., BARROS, R., GHANIM, M., MORIONES, E., CASTILLO, J.N. and SAKATE, R.K., 2015. First report of Bemisia tabaci Mediterranean (Q biotype) species in Brazil. Pest Management Science, vol. 71, no. 4, pp. 501-504. http://dx.doi.org/10.1002/ps.3909 PMid:25212515.
» http://dx.doi.org/10.1002/ps.3909 -
BARRO, P.J. and AHMED, M.Z., 2011. Genetic networking of the Bemisia tabaci cryptic species complex reveals pattern of biological invasions. PLoS One, vol. 6, no. 10, pp. e25579. http://dx.doi.org/10.1371/journal.pone.0025579 PMid:21998669.
» http://dx.doi.org/10.1371/journal.pone.0025579 -
BARRO, P.J., BOURNE, A., KHAN, S.A. and BRANCATINI, V.A.L., 2006. Host plant and biotype density interactions – their role in the establishment of the invasive B biotype of Bemisia tabaci. Biological Invasions, vol. 8, no. 2, pp. 287-294. http://dx.doi.org/10.1007/s10530-005-1261-6
» http://dx.doi.org/10.1007/s10530-005-1261-6 -
BARRO, P.J., LIU, S., BOYKIN, L.M. and DINSDALE, A.B., 2011. Bemisia tabaci: a statement of species status. Annual Review of Entomology, vol. 56, no. 1, pp. 1-19. http://dx.doi.org/10.1146/annurev-ento-112408-085504 PMid:20690829.
» http://dx.doi.org/10.1146/annurev-ento-112408-085504 -
BARRO, P.J., SCOTT, K.D., GRAHAM, G.C., LANGE, C.L. and SCHUTZE, M.K., 2003. Isolation and characterization of microsatellite loci in Bemisia tabaci. Molecular Ecology Notes, vol. 3, no. 1, pp. 40-43. http://dx.doi.org/10.1046/j.1471-8286.2003.00344.x
» http://dx.doi.org/10.1046/j.1471-8286.2003.00344.x -
BECK, H.E., ZIMMERMANN, N.E., MCVICAR, T.R., VERGOPOLAN, N., BERG, A. and WOOD, E.F., 2018. Present and future Köppen-Geiger climate classification maps at 1-km resolution. Scientific Data, vol. 5, no. 1, 180214. http://dx.doi.org/10.1038/sdata.2018.214 PMid:30375988.
» http://dx.doi.org/10.1038/sdata.2018.214 -
BEDFORD, I.D., BRIDDON, R.W., BROWN, J.K., ROSELL, R.C. and MARKHAM, P.G., 1994. Geminivirus transmission and biological characterization of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Annals of Applied Biology, vol. 125, no. 2, pp. 311-325. http://dx.doi.org/10.1111/j.1744-7348.1994.tb04972.x
» http://dx.doi.org/10.1111/j.1744-7348.1994.tb04972.x -
BELLO, V.H., SILVA, F.B., WATANABE, L.F.M., VINCENTIN, E., MULLER, C. and BUENO, R.C.O., 2021. Detection of Bemisia tabaci Mediterranean cryptic species on soybean in São Paulo and Paraná States (Brazil) and interaction of cowpea mild mottle virus with whiteflies. Plant Pathology, vol. 70, no. 6, pp. 1508-1520. http://dx.doi.org/10.1111/ppa.13387
» http://dx.doi.org/10.1111/ppa.13387 -
BELLO, V.H., WATANABE, L.F.M., FUSCO, L.M., MARCHI, B.R., SILVA, F.B., GORAYEB, E.S., MOURA, M.F., SOUZA, I.M., MULLER, C., SALAS, F.J.S., YUKI, V.A., BUENO, R.C.O.F., PAVAN, M.A. and KRAUSE-SAKATE, R., 2020. Outbreaks of Bemisia tabaci Mediterranean species in vegetable crops in São Paulo. Bulletin of Entomological Research, vol. 110, no. 4, pp. 487-496. http://dx.doi.org/10.1017/S0007485319000841 PMid:31987066.
» http://dx.doi.org/10.1017/S0007485319000841 - BOYKIN, L.M., BELL, C.D., EVANS, G., SMALL, I. and BARRO, P.J., 2013. Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)? Dating, diversification and biogeographic evidence revealed. Evolutionary Biology, vol. 13, pp. 228. PMid:24138220.
-
CHU, D., TAO, Y., ZHANG, Y., WAN, F. and BROWN, J.K., 2012. Effects of host, temperature and relative humidity on competitive displacement of two invasive Bemisia tabaci biotypes [Q and B]. Insect Science, vol. 00, no. 5, pp. 1-9. http://dx.doi.org/10.1111/j.1744-7917.2011.01500.x
» http://dx.doi.org/10.1111/j.1744-7917.2011.01500.x -
CORDEIRO, E.M.G., CORRÊA, A.S. and GUEDES, R.N.C., 2014. Insecticide-mediated shift in ecological dominance between two competing species of grain beetles. PLoS One, vol. 9, no. 6, pp. e100990. http://dx.doi.org/10.1371/journal.pone.0100990 PMid:24959673.
» http://dx.doi.org/10.1371/journal.pone.0100990 -
CORRÊA, A.S., CORDEIRO, E.M. and OMOTO, C., 2019. Agricultural insect hybridization and implications for pest management. Pest Management Science, vol. 75, no. 11, pp. 2857-2864. http://dx.doi.org/10.1002/ps.5495 PMid:31124266.
» http://dx.doi.org/10.1002/ps.5495 -
CROWDER, D.W., SITVARIN, M.I. and CARRIÈRE, Y., 2010. Plasticity in mating behaviour drives asymmetric reproductive interference in whiteflies. Animal Behaviour, vol. 79, no. 3, pp. 579-587. http://dx.doi.org/10.1016/j.anbehav.2009.11.025
» http://dx.doi.org/10.1016/j.anbehav.2009.11.025 - DÂNGELO, R.A.C., MICHEREFF-FILHO, M., CAMPOS, M.R., SILVA, P.S., and GUEDES, R.N.C., 2018. Insecticide resistance and control failure likelihood of the whitefly Bemlisia tabaci (MEAM1, B biotype): a Neotropical scenario. Ann. App. Biology, vol. 172, pp. 88-99.
-
DINSDALE, A., COOK, L., RIGINOS, C., BUCKLEY, Y.M. and BARRO, P.J., 2010. Refined Global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase 1 to identify species level genetic boundaries. Annals of the Entomological Society of America, vol. 103, no. 2, pp. 196-208. http://dx.doi.org/10.1603/AN09061
» http://dx.doi.org/10.1603/AN09061 -
DOURADO, P.M., PANTOJA-GOMEZ, L.M., HORIKOSHI, R.J., CARVALHO, R.A., OMOTO, C., CORRÊA, A.S., KIM, J.H., MARTINELLI, S. and HEAD, G.PP., 2021. Host plant use of Helicoverpa spp. (Lepidoptera: Noctuidae) in the Brazilian agricultural landscape. Pest Management Science, vol. 77, no. 2, pp. 780-794. http://dx.doi.org/10.1002/ps.6079 PMid:32902104.
» http://dx.doi.org/10.1002/ps.6079 -
EL-SHERBENI, A.EH.ED., KHALEID, M.S., ABDALLAH, S.A.E.A., and ALI, O.S.M., 2019. Effect of some insecticides alone and in combination with salicylic acid against aphid, Aphis gossypii, and whitefly Bemisia tabaci on the cotton field. Bull Natl Res Cent, vol. 43, no. 57. https://doi.org/10.1186/s42269-019-0103-0
» https://doi.org/10.1186/s42269-019-0103-0 -
ELFEKIH, S., TAY, W.T., GORDON, K., COURT, L. and BARRO, P., 2018. Standardised molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex. Pest Management Science, vol. 74, no. 1, pp. 170-173. http://dx.doi.org/10.1002/ps.4676 PMid:28736873.
» http://dx.doi.org/10.1002/ps.4676 -
FONTES, F., COLOMBO, C.A. and LOURENÇÃO, A.L., 2010. Caracterização molecular e divergência genética de Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) em diferentes culturas e locais de cultivo. Neotropical Entomology, vol. 39, no. 2, pp. 221-226. http://dx.doi.org/10.1590/S1519-566X2010000200012 PMid:20498959.
» http://dx.doi.org/10.1590/S1519-566X2010000200012 -
FONTES, F., COLOMBO, C.A. and LOURENÇÃO, A.L., 2012. Structure of genetic diversity of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) populations in Brazilian crops and locations. Scientia Agrícola, vol. 69, no. 1, pp. 47-53. http://dx.doi.org/10.1590/S0103-90162012000100007
» http://dx.doi.org/10.1590/S0103-90162012000100007 -
GORAYEB, E.S., WATANABE, L.F.M., PEREIRA, Y.A.B., DOVIGO, L.H., BELLO, V.H., SOUZA, I.M., CRUCIOL, G.C.D., VINCENTIN, E., SARTORI, M.M.P. and SAKATE, R.K., 2021. Performance and preference of Bemisia tabaci on cucumbers: understanding the recent outbreaks of Mediterranean cryptic species in Brazil. Crop Protection, vol. 143, pp. 105468. http://dx.doi.org/10.1016/j.cropro.2020.105468
» http://dx.doi.org/10.1016/j.cropro.2020.105468 -
GOOGLE [online], 2021 [viewed 4 October 2021]. Available from: https://www.google.com/maps/d/edit?mid=1HfIkxIvvRf0HFB7U0xK09EumF2JaDHlm≪=-16.179675836220184%2C-54.103429420244154&z=4
» https://www.google.com/maps/d/edit?mid=1HfIkxIvvRf0HFB7U0xK09EumF2JaDHlm≪=-16.179675836220184%2C-54.103429420244154&z=4 -
HADJISTYLLI, M., RODERICK, G.K. and BROWN, J.K., 2016. Global population structure of a worldwide pest and virus vector: genetic diversity and population history of the Bemisia tabaci sibling species group. PLoS One, vol. 11, no. 11, e0165105. http://dx.doi.org/10.1371/journal.pone.0165105 PMid:27855173.
» http://dx.doi.org/10.1371/journal.pone.0165105 -
HOROWITZ, A.R., KONTSEDALOV, S., KHASDAN, V. and ISHAAYA, I., 2005. Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Insect Biochemistry and Physiology, vol. 58, no. 4, pp. 216-225. http://dx.doi.org/10.1002/arch.20044 PMid:15756703.
» http://dx.doi.org/10.1002/arch.20044 -
KONTSEDALOV, S., ABU-MOCH, F., LEBEDEV, G., CZOSNEK, H., HOROWITZ, A.R. and GHANIM, M., 2012. Bemisia tabaci biotype dynamics and resistance to insecticides in Israel during the years 2008-2010. Journal of Integrative Agriculture, vol. 11, no. 2, pp. 312-320. http://dx.doi.org/10.1016/S2095-3119(12)60015-X
» http://dx.doi.org/10.1016/S2095-3119(12)60015-X -
KUMAR, S., STECHER, G., LI, M., KNYAZ, C. and TAMURA, K., 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, vol. 35, no. 6, pp. 1547-1549. http://dx.doi.org/10.1093/molbev/msy096 PMid:29722887.
» http://dx.doi.org/10.1093/molbev/msy096 -
LAARIF, A., SALEH, D., CLOUET, C. and GAUTHIER, N., 2015. Regional co-occurrence between distinct Bemisia tabaci species in Tunisia with new insights into the role of host plants. Phytoparasitica, vol. 43, no. 2, pp. 135-150. http://dx.doi.org/10.1007/s12600-014-0437-y
» http://dx.doi.org/10.1007/s12600-014-0437-y -
LIU, S., BARRO, P.J., XU, J., LUAN, J.B., ZANG, L.S., RUAN, Y.M. and WAN, F.H., 2007. Asymmetric mating interactions drive widespread invasion and displacement in a whitefly. Science, vol. 318, no. 5857, pp. 1769-1772. http://dx.doi.org/10.1126/science.1149887 PMid:17991828.
» http://dx.doi.org/10.1126/science.1149887 -
LOURENÇÃO, A.L. and NAGAI, H., 1994. Surtos populacionais de Bemisia tabaci no Estado de São Paulo. Bragantia, vol. 53, no. 1, pp. 53-59. http://dx.doi.org/10.1590/S0006-87051994000100006
» http://dx.doi.org/10.1590/S0006-87051994000100006 -
MORAES, L.A., MARUBAYASHI, J.M., YUKI, V.A., GHANIM, M., BELLO, V.H., MARCHI, B.R., FONSECA, B.L., BOYKIN, L.M., SAKATE, K.R. and PAVAN, M.A., 2017. New invasion of Bemisia tabaci Mediterranean species in Brazil associated to ornamental plants. Phytoparasitica, vol. 45, no. 4, pp. 517-525. http://dx.doi.org/10.1007/s12600-017-0607-9
» http://dx.doi.org/10.1007/s12600-017-0607-9 -
MORAES, L.A., MULLER, C., CRISTINA, R., DE FREITAS, O., SANTOS, A., BELLO, V.H., MARCHI, B.R., FERNANDO, L., WATANABE, M., MARUBAYASHI, J.M., SANTOS, B.R., YUKI, V.A., TAKADA, H.M., BARROS, D.R., NEVES, C.G., NASCIMENTO, F., GONÇALVES, M.J., GHANI, M., BOYKIN, L., PAVAN, M.A. and SAKATE, R.K., 2018. Distribution and phylogenetics of whiteflies and their endosymbiont relationships after the Mediterranean species invasion in Brazil. Scientific Reports, vol. 8, no. 1, pp. 14589. http://dx.doi.org/10.1038/s41598-018-32913-1 PMid:30275487.
» http://dx.doi.org/10.1038/s41598-018-32913-1 -
MOYA, A., GUIRAO, P., CIFUENTES, D., BEITIA, F. and CENIS, J.L., 2001. Genetic diversity of Iberian populations of Bemisia tabaci (Hemiptera: Aleyrodidae) based on random amplified polymorphic DNA – polymerase chain reaction. Molecular Ecology, vol. 10, no. 4, pp. 891-897. http://dx.doi.org/10.1046/j.1365-294X.2001.01221.x PMid:11348498.
» http://dx.doi.org/10.1046/j.1365-294X.2001.01221.x -
NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION – NCBI, 2021 [viewed 4 October 2021]. BLAST®: Basic Local Alignment Search Tool [online]. Bethesda. Available from: https://blast.ncbi.nlm.nih.gov/Blast.cgi
» https://blast.ncbi.nlm.nih.gov/Blast.cgi - NYLANDER, J.A.A., 2004. MrModeltest v2. Program distributed by the author Uppsala: Evolutionary Biology Centre, Uppsala University.
-
PASCUAL, S. and CALLEJAS, C., 2004. Intra- and interspecific competition between biotypes B and Q of Bemisia tabaci (Hemiptera: Aleyrodidae) from Spain. Bulletin of Entomological Research, vol. 94, no. 4, pp. 369-375. http://dx.doi.org/10.1079/BER2003307 PMid:15301702.
» http://dx.doi.org/10.1079/BER2003307 -
PASCUAL, S., 2006. Mechanisms in competition, under laboratory conditions, between Spanish biotypes B and Q of Bemisia tabaci (Gennadius). Spanish Journal of Agricultural Research, vol. 4, no. 4, pp. 351-354. http://dx.doi.org/10.5424/sjar/2006044-217
» http://dx.doi.org/10.5424/sjar/2006044-217 -
QUEIROZ, P.R., LIMA, H.L., MARTINS, S.É., SUJII, R.E. and MONNERAT, G.R., 2017. Description of the molecular profiles of Bemisia tabaci (Hemiptera: Aleyrodidae) in different crops and locations in Brazil. Journal of Entomology and Nematology, vol. 9, no. 5, pp. 36-45. http://dx.doi.org/10.5897/JEN2017.0170
» http://dx.doi.org/10.5897/JEN2017.0170 -
RAUCH, N. and NAUEN, R., 2003. Identification of biochemical markers linked to neonicotinoid cross resistance in Bemisia tabaci (Hemiptera: aleyrodidae). Insect Biochemistry and Physiology, vol. 54, no. 4, pp. 165-176. http://dx.doi.org/10.1002/arch.10114 PMid:14635178.
» http://dx.doi.org/10.1002/arch.10114 -
RODRIGUES, C.S., NAKASU, E.Y.T., ORTIZ, G.V., PEREIRA, J.L., LEANDRO, V.S.L., MACHADO, C.M.R., SOUZA, T.A., MARTINS, T.P. and NAGATA, A.K.I., 2021. Evidence of spread of Bemisia tabaci (Hemiptera: Aleyrodidae) mediated by internal transportation of ornamental plants in Brazil. Neotropical Entomology, vol. 50, no. 5, pp. 850-857. http://dx.doi.org/10.1007/s13744-021-00881-3 PMid:33978919.
» http://dx.doi.org/10.1007/s13744-021-00881-3 -
RONQUIST, F. and HUELSENBECK, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics, vol. 19, no. 12, pp. 1572. http://dx.doi.org/10.1093/bioinformatics/btg180 PMid:12912839.
» http://dx.doi.org/10.1093/bioinformatics/btg180 -
SANTOS, T.L.B., BALDIN, E.L.L., RIBEIRO, L.P., SOUZA, C.M., SOARES, M.C.E., FANELA, T.L.M. and LOURENÇÃO, A.L., 2021. Resistance sources and antixenotic factors in Brazilian bean genotypes against Bemisia tabaci. Neotropical Entomology, vol. 50, no. 1, pp. 129-144. http://dx.doi.org/10.1007/s13744-020-00821-7 PMid:33151469.
» http://dx.doi.org/10.1007/s13744-020-00821-7 -
SHAN, H.W., LU, Y.H., BING, X.L., LIU, S.S. and LIU, Y.Q., 2014. Differential responses of whitefly Bemisia tabaci symbionts to unfavorable low and high temperatures. Microbial Ecology, vol. 68, no. 3, pp. 472-482. http://dx.doi.org/10.1007/s00248-014-0424-3 PMid:24788211.
» http://dx.doi.org/10.1007/s00248-014-0424-3 -
SILVA, C.S., CORDEIRO, E.M., DE PAIVA, J.B., DOURADO, P.M., CARVALHO, R.A., HEAD, G., MARTINELLI, S. and CORRÊA, A.S., 2020. Population expansion and genomic adaptation to agricultural environments of the soybean looper, Chrysodeixis includens. Evolutionary Applications, vol. 13, no. 8, pp. 2071-2085. http://dx.doi.org/10.1111/eva.12966 PMid:32908605.
» http://dx.doi.org/10.1111/eva.12966 -
SILVA, M.C., LEMOS, R.N.S., LIMA, L.H.C., FILHO, L.R.G. and PEREIRA, S.R.F., 2009. Variabilidade genética de Bemisia tabaci (Gennadius) biótipo B (Hemiptera: Aleyrodidae) em cultivos olerícolas em São Luís, MA. Neotropical Entomology, vol. 38, no. 6, pp. 762-768. http://dx.doi.org/10.1590/S1519-566X2009000600009 PMid:20098922.
» http://dx.doi.org/10.1590/S1519-566X2009000600009 -
SMITH, H.A., SHRESTHA, D., VAN SANTEN, E., MASROOR, Q. and WONG, A., 2020. Development of Bemisia tabaci MEAM1 and MED on tomato (Solanum lycopersicum) alone and in a mixed population. The Florida Entomologist, vol. 103, no. 1, pp. 72-79. http://dx.doi.org/10.1653/024.103.0412
» http://dx.doi.org/10.1653/024.103.0412 -
SUN, D., LIU, Y., QIN, L., XU, J., LI, F. and LIU, S., 2013. Competitive displacement between two invasive whiteflies: insecticide application and host plant effects. Bulletin of Entomological Research, vol. 103, no. 3, pp. 344-353. http://dx.doi.org/10.1017/S0007485312000788 PMid:23458717.
» http://dx.doi.org/10.1017/S0007485312000788 -
TAHIRI, A., HALKETT, F., GRANIER, M., GUEGUEN, G. and PETERSCHMITT, M., 2013. Evidence of gene flow between sympatric populations of the middle east-Asia minor 1 and Mediterranean putative species of Bemisia tabaci. Ecology and Evolution, vol. 3, no. 8, pp. 2619-2633. http://dx.doi.org/10.1002/ece3.655
» http://dx.doi.org/10.1002/ece3.655 -
TANG, X.T., CAI, L., SHEN, Y., XU, L.L. and DU, Y.Z., 2019. Competitive displacement between Bemisia tabaci MEAM1 and MED and evidence for multiple invasions of MED. Insects, vol. 11, no. 1, pp. 35. http://dx.doi.org/10.3390/insects11010035 PMid:31906186.
» http://dx.doi.org/10.3390/insects11010035 - TENG, X., WAN, F. and CHU, D., 2020. Bemisia tabaci biotype Q dominates other biotypes across China. The Florida Entomologist, vol. 93, pp. 363-368.
-
TOPÇU, İ., KARACA, M.M. and KARUT, K., 2020. Dominance of Bemisia tabaci MEAM1 species over MED (Hemiptera: Aleyrodidae) in greenhouse vegetables in Mersin, Turkey. Phytoparasitica, vol. 48, no. 2, pp. 159-166. http://dx.doi.org/10.1007/s12600-020-00794-8
» http://dx.doi.org/10.1007/s12600-020-00794-8 - WALSH, P.S., METZGER, D.A. and HIGUCHI, R., 1991. Biotechniques 30th anniversary gem Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques, vol. 54, no. 4, pp. 506-513. PMid:1867860.
-
WATANABE, L.F.M., BELLO, V.H., MARCHI, B.R., SILVA, F.B., FUSCO, L.M., SARTORI, M.M.P., PAVAN, M.A. and KRAUSE-SAKATE, R., 2019. Performance and competitive displacement of Bemisia tabaci MEAM1 and MED cryptic species on different host plants. Crop Protection, vol. 124, pp. 104860. http://dx.doi.org/10.1016/j.cropro.2019.104860
» http://dx.doi.org/10.1016/j.cropro.2019.104860 -
XIAO, N., PAN, L.L., ZHANG, C.R., SHAN, W.W. and LIU, S.S., 2016. Differential tolerance capacity to unfavorable low and high temperatures between two invasive whiteflies. Scientific Reports, vol. 6, no. 1, pp. 24306. http://dx.doi.org/10.1038/srep24306 PMid:27080927.
» http://dx.doi.org/10.1038/srep24306
Publication Dates
-
Publication in this collection
23 Feb 2022 -
Date of issue
2024
History
-
Received
04 Oct 2021 -
Accepted
08 Jan 2022




