Mitochondrial DNA: a promising tool for characterising the population of the Tiúba stingless bee, Melipona fasciculata (Apidae, Meliponini)

DNA mitocondrial: uma ferramenta promissora para caracterizar a população da abelha-sem-ferrão Tiúba, Melipona fasciculata (Apidae, Meliponini)

Abstract

The Melipona fasciculata popularly known as Tiúba, is a specie of stingless bee that is distributed in the north of Brazil, over-represented in Maranhão State. This bee is of great importance to stingless bees (SLB) beekeepers, as it produces a large quantity of honey with an excellent taste. The genetic diversity of the Tiúba populations was examined with molecular approach using the mitochondrial DNA (mtDNA) marker. A total of 30 samples from cities in Maranhão State were analysed for the mtDNA intergenic region located between the cytochrome c oxidase I (COI). The molecular analyses identified 8 haplotypes, 3 of which are shared between locations, where the commercialization of beehives is very common and the commercialization of beehives is very common. The populations of Imperatriz and São Bento have the highest diversity indices, and the neutrality tests showed that the populations might be expansion. The fixation index of the study populations showed a high differentiation rate of 0.6218. These Tiúba populations exhibit a high level of genetic structuring, as well as potentially being in a population expansion phase.

Keyworlds: molecular genetics; COI; genetic variability; haplotype networks; meliponiculture; Maranhão

Resumo

A Melipona fasciculata, popularmente conhecida como Tiúba, é uma espécie de abelha-sem-ferrão que se distribui no norte do Brasil, com maior representatividade no estado do Maranhão. Esta abelha é de grande importância para os criadores de abelhas sem ferrão (ASF), pois produz uma grande quantidade de mel com excelente sabor. A diversidade genética das populações de Tiúba foi examinada com uma abordagem molecular usando o marcador de DNA mitocondrial (mtDNA). Um total de 30 amostras de cidades do estado do Maranhão foram analisadas para a região intergênica do mtDNA localizada entre a citocromo c oxidase I (COI). As análises moleculares identificaram 8 haplótipos, 3 dos quais são compartilhados entre as localidades, sendo a comercialização de colmeias muito comum. As populações de Imperatriz e São Bento apresentam os maiores índices de diversidade, e os testes de neutralidade mostraram que as populações estão em expansão. O índice de fixação das populações estudadas apresentou uma alta taxa de diferenciação de 0,6218. Essas populações de Tiúba exibem um alto nível de estruturação genética, além de estarem potencialmente em uma fase de expansão populacional.

Palavras-chave:
genética molecular; COI; variabilidade genética; redes de haplótipos; meliponicultura; Maranhão

1. Introduction

Meliponini, popularly known as stingless bees, play an important role in ecosystems through pollination (Morgado et al., 2002). Bees from the Meliponini tribe are distributed almost all over the globe, mainly around the tropical and subtropical belt, in countries in Central America, South America, Africa, and in some countries in Asia and Australia (Michener, 2007; Ascher and Pickering, 2022; Engel et al., 2023).

Brazil has the greatest diversity of species of the Melipona genus in the world, and among the meliponines distributed in the state of Maranhão is predominantly M. fasciculata, popularly known as Tiúba (Nogueira, 2023). Also called gray Urucu, it is characterised as a bee with very hygienic habits, producing excellent quality honey (Sousa et al., 2022; Venturieri et al., 2003) and has a high honey yield, with an average production of 3.5 to 7 liters per year (Venturieri, 2015).

This group of bees ensures the balance of the ecosystem by pollinating angiosperms, which can form fruit used as food (Klein et al., 2007). Although stingless bees are very important for maintaining the ecosystem, the reduction in vegetation cover in Brazil's various biomes has led to a decrease in the number of species, many of which have not been described or catalogued (Santos and Duarte, 2018).

Knowledge of the basic ecology of bees is essential to support the development and implementation of conservation strategies. Understanding the factors that regulate bee populations and communities and the sensitivity of bee characteristics to these factors allows specific management options to be identified for individual species (Murray et al., 2009).

In order for conservation practices for stingless bee species to be effective, certain topics become essential when planning actions, such as morphophysiology, behavior, genetic studies and taxonomy (Silva, 2018), which guarantee the formulation of effective conservation management strategies in order to maintain and expand population stocks in meliponaries (Biesmeijer et al., 2006), especially during periods of the year when climatic conditions are more adverse (Silva et al., 2019).

Due to the constant deforestation and indiscriminate use of pesticides that tend to reduce bee populations, Meliponiculture has become crucial, not only for the conservation of the species, but also as a source of income for farmers with lower purchasing power (Cámara et al., 2004; Silva et al., 2014). The reduction in the genetic variability of the populations of these bees as a result of the visible degradation of the environment and its consequences for the conservation of meliponids must be studied, and for this to be possible, the molecular characterisation of these species is necessary (Souza et al., 2018).

The COI gene encodes subunit I of cytochrome C, an electron-terminal receptor protein of the respiratory chain, considered to be transmembrane, whose function is to catalyse the reduction of oxygen into H₂O and the pumping of protons through the mitochondrial cristae membranes (Alberts et al., 2017). As it is a fundamental component of the respiratory chain, it is fairly conserved among the species that use oxidative phosphorylation in their metabolism. The mtDNA comes from maternal inheritance and has conserved regions and regions with high rates of nucleotide substitution and reduced size (Weinlich et al., 2004). The use of molecular techniques has proved to be efficient when it comes to assessing populations in a given ecosystem, making it possible to monitor and understand its dynamics, trough the Polymerase Chain Reaction (PCR) (Mullis and Faloona, 1987). Given this situation, conservation research is necessary due to factors such as: urban growth, agricultural expansion, deforestation and fires in preserved areas, resulting in loss of species richness, population decline and extinction, contributing to ecological imbalance (Souza et al., 2018).

We have characterized the M. fasciculata population from 5 different municipalities in the Maranhão State by the mtDNA using COI gene. We assessed how these populations are genetically structured and a potential population expansion.

2. Materials and Methods

2.1. Biological material

The Melipona fasciculata samples were collected in the state of Maranhão, in the northeast of Brazil. These samples consist of bees collected from single beehives in their respective municipalities: Arari (7 samples), Imperatriz (3 samples), Nova Olinda (10 samples), Pinheiro (7 samples) and São Bento (3 samples), totaling 30 sample (Figure 1). The material collected was preserved in 100% alcohol and stored at -20 ºC until DNA extraction.

Figure 1
Map of cities in Maranhão, Brazil.

2.2. DNA extraction

The extraction of genomic DNA from the bees was based on the methodology adapted from the technique described by Sambrook et al. (1989), Phenol-Chloroform, where the genomic DNA was obtained from the mesosoma of the collected bees, eliminating the wings, head and metasoma, using one thorax of M. fasciculata. In adapting this technique, only the thorax of the bees was used to extract the genetic material. According to Francisco (2002), the heads are removed to avoid contaminating the extractions with glandular products and eye pigments, as these contaminants could interfere with the DNA digestion process and the PCR reaction. The concentrations and purities of the DNA samples (ng/µL) were assessed using a Biodrop µLite spectrophotometer at 260 nm, and purity was analysed using ratios between the absorbance measurements at 260/280 nm and 260/230 nm.

2.3. Amplification condition of the mtDNA region

The genetic material extracted and quantified was submitted to the PCR (Polymerase Chain Reaction) technique following the methodology used by Saiki et al. (1985); for the amplification of the specific regions of the mtDNA, all the reactions were set up with a final volume of 25µl for each sample with the following reagents: 5 X PCR Buffer (5µl); 10 mM dNTP (0.8µl), 25 mM MgCl₂ (2.0µl), 10 µM each Primer (2.0µl), DNA 50 ng/µl (1µl), Taq DNA polymerase (Promega) 5 U/µl (0.2µl) and ultrapure water in sufficient quantity to complete the final volume. The primer pair F - 5’ GGAGGATTTGGAAATTGATTAGTTCC 3’ and R - 5’ CCCGGTAAAATTAAAATATAAACTTCC 3’ (Bonatti, 2012) was used in the PCR amplification reactions.

The amplification conditions used for this work were: initial denaturation for 4 minutes at 94 ºC, followed by 35 cycles of: denaturation at 92 ºC for 2 minutes; ringing at 57 ºC for 1 minute and 50 seconds for the COI region, extension at 72 ºC for 2 minutes. Extra extension at 72 ºC for 7 minutes and left at 4 ºC. To check the quality and size of the amplified fragments, the PCR products were subjected to electrophoresis in agarose gel at a concentration of 1.2% (w/v), with TBE 1X buffer (890mM Tris-borate, 890mM boric acid, 20mM EDTA) and stained with Ethidium Bromide (10mg/ml) using the 100 bp DNA Ladder molecular marker (Promega) as a parameter to check the size of the amplified fragments.

2.4. Genetics and bioinformatics analyses

The PCR products were sent for sequencing, and the sequences were delivered via email in .seq and .ab1 formats by ACTGene, a company that uses the Sanger method for DNA sequencing.

Then, sequence alignment and correction analyses were carried out in the MEGA X v. 11.0 programme (Kumar et al., 2018), which has extensions such as CLUSTAL-W that enabled multiple alignment, with penalty parameters suggested by Schneider (2007). Using the programmes DnaSP v. 6.12.3 (Rozas et al., 2017) and Arlequin v. 3.5.2.2 (Excoffier and Lischer, 2010) genetic diversity parameters were calculated: haplotypic diversity (Hd), which estimates the probability of sampling two haplotypes from the total sample and having them be different (Nei, 1987); nucleotide diversity (π), which represents the average number of differences between two sequences (per site) taken at random from the total sample, for each population (Nei and Miller, 1990); fixation index (FST), the fixation index for alleles per locus, i.e. it is the probability that two genes are homologous, combined at random in the population, both originating from one gene in the population (Wright, 1965); Hierarchical Analysis of Molecular Variance (AMOVA), to check the homogeneity of a set of data, thus identifying whether this variability is structured between groups, subgroups or organised within individuals (Nei, 1987).

MEGA X v. 11.0 programme (Kumar et al., 2018) was used to generate a genetic distance matrix between the specimens, considering the Kimura-2-parameter (K2P) evolutionary model (Kimura, 1980), in GenBank six sequences were used as a used as close groups for the COI gene analyses: M. fasciculata (MH680930.1), M. bicolor (AF466146.1), M. scutellaris (NC_026198.1), M. compressipes interrupta (EU163128.1), M. favosa (EU163127.1) and M. grandis (EU163117.1). A. mellifera bees were used as the outgroup: A. mellifera mellifera (AY114459.1), A. mellifera YN2 (MH138083.1) and A. mellifera carnica (AY114463.1). The sequences are in the process of being submission at NCBI.

The haplotype network was built using the NETWORK v. 10.2 programme (Polzin and Daneshmand, 2003), using the Median Joining algorithm, which identifies the closest related haplotypes. The dendrogram was constructed based on genetic distances, using the Neighbour Joining method, using the MEGA X v. 11.0 programme (Kumar et al., 2018).

In the Arlequin 3.5.2.2 software (Excoffier and Lischer, 2010), neutrality tests were conducted using Tajima's D method. (Tajima, 1989), and Fu's Fs parameter was estimated (Fu, 1997). The Tajima D test is based on the differences between the number of segregating sites (S) or the number of distinct nucleotides (π) between pairs of sequences. Fu's Fs test compares the observed number of alleles with the number expected if the population remained constant, with the Fs value given by the equation "$Fs=In\left(S\text{'}/1-S\text{'}\right)$" (Fu, 1997). These tests were used to verify the possible occurrence of demographic expansion or population bottlenecks.

3. Results

A total of 30 sequences of the COI gene were analysed and, after editing, 400 bp fragments were obtained. Its nucleotide composition was A=31.63%; T= 45.49%; C= 12.45; G= 10.49%, with a higher composition of adenine (A) and thymine (T), demonstrating the abundance of A and T bases, as expected for insect mitochondrial genomes (Crozier and Crozier, 1993; Simon et al., 1994).

The genetic variability indices results demonstrate a higher haplotype diversity (Hd) compared to nucleotide diversity (π) among the municipalities studied. Regarding the sample size, a large number of haplotypes (NHap) is observed. On the other hand, there is a small number of polymorphic sites (NPS) (Table 1).

Table 1
Genetic variability indices of M. fasciculata populations from Maranhão State.

Populations	N	NPS	NHap	K	Molecular diversity index
					Hd	π
Arari	7	10	2	2.857	0.286	0.010
Imperatriz	3	13	2	2.666	0.667	0.032
Nova Olinda	10	5	4	1.533	0.644	0.005
Pinheiro	7	3	3	0.857	0.524	0.003
São Bento	3	1	2	0.666	0.667	0.002

• (N) Number of bee individuals; (NPS) Number of polymorphic sites; (NHap) Number of haplotypes; (K) Average number of nucleotide differences. (Hd) Haplotype diversity; (π) Nucleotide diversity.

Regarding haplotypes, eight haplotypes were found corresponding to 28 mutation points (Figure 2).

Figure 2
Haplotype network of the mtDNA COI region for samples of M. fasciculata represented by cities in Maranhão State.: H1 - A1/ H2 - A2, A3, A4, A5, A6, A7, NO1, NO3, NO5, NO8, NO9, NO10, P1, P2, P4, P5 and P6/ H3 - NO2 and P7/ H4 - NO4, NO7 and P3/ H5 - NO6/ H6 – SB1 and SB3/ H7 – SB2, ITZ1 and ITZ3/ H8 – ITZ3. H = Haplotype; A = Arari; NO = Nova Olinda; P = Pinheiro; SB = São Bento; ITZ = Imperatriz.

The dendrogram (Figure 3) demonstrated that the Tiúba bee populations from Maranhão are in a different group from the Melipona fasciculata currently available in the NCBI (Corvalán et al., 2023), indicating that the Maranhão bees may be diverging from the deposited M. fasciculata. The Maranhão Tiúba populations clustered into eight different clades. It was evident that no group showed exclusivity of bees solely from the same municipality of origin, with the group containing the highest number of individuals comprising bees from three different municipalities: Arari, Pinheiro and Nova Olinda do Maranhão. It is worth noting that in all formed groups, there was the presence of bees from the region known as Baixada Maranhense, which encompasses 21 municipalities, including Arari, Pinheiro Peri Mirim, and São Bento.

Figure 3
Phylogenetic dendrogram of COI gene constructed according to nucleotide sequences of 30 samples of M. fasciculata. Representants of A. mellifera were used as outgroup. Bootstrap values using 1000 replicates are indicated at branching points. Accession numbers are shown in brackets. Bar: 0.020 estimated substitutions. The cluster of bees are in curly brackets.

When analysing the haplotype network together with the dendrogram, it is possible to observe that the clusters formed in the dendrogram corroborate the haplotype sharing. The individuals ITZ1, SB2 and ITZ3, which form cluster 8 in the dendrogram, correspond to haplotype H7. The same can be observed for haplotype H2, which includes individuals from Nova Olinda, Pinheiro, and Arari. This haplotype corresponds to cluster 4 in the dendrogram. Furthermore, haplotype H1 corresponds to cluster 1; haplotype H3 to cluster 5; haplotype H4 to cluster 2; haplotype H5 to cluster 3; haplotype H6 to cluster 7; and haplotype 8 to cluster 6 (Figures 2 and 3).

In the AMOVA, the genetic structuring results (Table 2) showed greater genetic diversity within populations with 62.18%, and less diversity between populations with 37.82%, with an Fst (Φ) of 0.621.

Table 2
Analysis of Molecular Variance (AMOVA).

Variance component	% total	Variance	(Φ)	p-value
Interpopulation	62.18	1.8005	0.6218	0.000
Intrapopulation	37.82	1.0950

• (Φ): Fixation index; p-value: 0.05.

In relation to the neutrality tests, Tajima's D test and Fu's Fs obtained results equal to -2.26714 and -25.51999 respectively, being statistically significant (p-value < 0.05) (Table 3).

Table 3
Analysis of neutrality tests.

Test	Tajima D	Fs of FU
value	-2.26714	-25.51999
p-value	0.00100	0.00000

4. Discussion

In the nucleotide composition of COI gene, the same proportion of A and T was found by Souza et al. (2018), who obtained a nucleotide composition of A = 32.50%, C = 9.60%, G = 13.30%, T = 44.50%, for the M. subnitida bee and by Sayusti et al. (2023), who obtained a nucleotide composition for AT of 65,8%, for the Tetragonula laeviceps bee. Bonatti et al. (2014), when amplifying and sequencing the COI region for the M. subnitida bee, obtained 446 bp of the gene after editing the sequences.

Compared to other studies that have used mtDNA as a marker to analyse genetic variability in stingless bees, the interpopulation average Hd was higher than in the work by Assis (2010) where he obtained Hd = 0.264, and lower than that found by Bonatti (2012) Hd = 0.79. It is observed that individuals from different municipalities exhibit greater haplotype diversity than nucleotide diversity. This fact is related to the large number of haplotypes found and the small number of polymorphic sites identified. It is worth noting that among the haplotypes found, those exclusive to specific municipalities are infrequent (Table 1). High haplotype diversity, low nucleotide diversity, and the presence of low-frequency exclusive haplotypes, as observed in our study, were also reported for species of Partamona in Brazil using the COI and CytB genes (Dessi et al., 2024).

The dendrogram obtained was made by comparing it with samples from GenBank (Figure 3), and the cohomologous coefficient was 0.960, which is a high reliability value in the test carried out using the Neighbour Joining method (Saitou and Nei, 1987). A different result was found by Bonatti et al. (2014) when they studied the M. subnitida bee, where of the 11 haplotypes found in their study only 4 were shared between at least two populations, indicating little gene flow, different from what was observed in the present study where there was a lot of sharing between populations.

Factors such as limited queen dispersal and large distances between populations may restrict gene flow among bee populations, potentially leading to inbreeding and genetic drift due to the subdivision and isolation of these populations (Francisco et al., 2013). However, the extensive sharing of haplotypes found in our study may be associated with the fact that the Baixada Maranhense region is highly significant in meliponiculture (Farfan, 2021), which could imply that many Meliponas beekeepers acquire swarms from this location. Kerr (1998) highlights the Baixada Maranhense as a region historically known for beekeepers of Meliponas managing large numbers of colonies, with some keeping up to 2,000 colonies. Thus, there may be significant queen dispersal due to the swarming from the Baixada Maranhense region to the studied municipalities. This may explain why all formed clusters include individuals from the Baixada Maranhense.

In the haplotype network (Figure 2) it can be seen that in H2 we have sequences from the municipalities of Arari, Nova Olinda and Pinheiro. This is due to the fact that these municipalities have a high commercialisation of the native Tiúba bee in the Baixada Maranhense micro-region, because of the supplementation of income for family farmers (Farfan et al., 2023) and, according to Kerr et al. (2001), bees have become a great restorer of vegetation and also due to their high honey production, favouring areas previously degraded by deforestation for the implementation of monocultures. The commercialisation of colonies is a common practice in Indonesia, where bee colonies are frequently transferred from their native areas to other regions through human translocation. This has resulted in the sharing of haplotypes between native areas and regions with traded bees (Sayusti et al., 2023). The acquisition of colonies creates human-driven gene flow, which can lead to bee populations becoming more similar (Solórzano-Gordillo et al., 2021), particularly in regions where swarms are commercially traded. This is a common practice among Brazilian beekeepers of Meliponas, aimed not only at generating income but also at diversifying their meliponaries (Jaffe et al., 2016; Koser et al., 2020).

For AMOVA, Bonatti (2012) found similar results of 61.9% between populations and 38.1% within populations, and Fst of 0.61898, where values for Fst (ɸ) can vary from 0 (no genetic diversity) to 1 (allele fixation). Similar Fst results (0.672) were found by Vale et al. (2021) for the native bee Scaptotrigona depilis.

Wright (1978) proposed the interpretation of Fst values, where: from 0 to 0.05, little genetic differentiation; from 0.05 to 0.15, moderate differentiation; from 0.15 to 0.25, great genetic differentiation; and values above 0.25 mean high genetic differentiation. Therefore, the populations of M. fasciculata studied have high genetic differentiation, i.e. high genetic structuring. This high genetic differentiation observed may be linked to habitat loss caused by monocultures, leading to a reduction in bee populations and potentially resulting in a loss of genetic diversity due to the fragmentation and isolation of populations over large distances (Vale et al., 2021). Maranhão, having become an agricultural frontier, especially in the Cerrado, has drawn the attention of large landowners investing in soybean and eucalyptus cultivation, causing significant damage to the Maranhense Cerrado (Barreto et al., 2012).

If we relate the data from Fu's Fs test and the low nucleotide diversity, these populations may be suffering from population bottlenecks followed by recent demographic expansion, the same results observed by Batalha-Filho (2008).

5. Conclusion

This study provides a comprehensive analysis of the mtDNA genetic diversity of the M. fasciculata bee populations, using COI region such us a marker. It was possible by Molecular Variance analysis to determine a high level of genetic group structuring of population. Which indicated that the population studied may be undergoing in expansion in different zones sampled of the Maranhão State. This study allowed us to understand the genetic variability of the Tiúba bee in different regions of Maranhão. This study made it possible to understand the genetic variability of the Tiúba bee in Maranhão, highlighting that there is sharing of haplotypes between municipalities, with emphasis on the Baixada Maranhense region.

Acknowledgements

The authors gratefully acknowledge the Universidade Estadual do Maranhão (UEMA), Laboratório de Genética e Biologia Molecular Warwick Estevam Kerr (LabWick), Fundação de Amparo à Pesquisa e Desenvolvimento Científico e Tecnológico do Maranhão (FAPEMA) and Fundação Vale/ Estação Conhecimento together with the Núcleo de Desenvolvimento Rural do Município de Arari - MA. We thank the beekeepers of Meliponas bee from Arari, Pinheiro, Nova Olinda, Imperatriz and São Bento for the collaboration and donation of the stingless bees analysed in this study. RNS was supported by the FAPEMA fellowship under grant [Number: BM-02252/23]; GGS was supported by FAPEAM fellowship under grant [POSGRAD 2022-2023-PPGGCBEV-INPA]; BFSDeS was supported by the FAPEMA fellowship under grant [Number: BATI-00114/15]; SLN was supported by the FAPEMA fellowship under grant [Number: BIC-04177/23]; GCF was supporyed by th Conselho Nacional de Desenvolvimento Científico e Tecnológico fellowship under Grant [Number: 119017/2023-7].

• ^†Current address: Centro de Biologia Molecular Severo Ochoa, Universidad Autónoma de Madrid (UAM), Spain

References

• ALBERTS, B., JOHNSON, A., LEWIS, J., RAFF, M., ROBERTS, K. and WALTER, P., 2017. Molecular biology of the cell 4th ed. New York: Garland Science. http://doi.org/10.1201/9781315735368
  » http://doi.org/10.1201/9781315735368
• ASCHER, J. and PICKERING, J., 2022 [viewed 28 June 2024]. Discover Life bee species guide and world checklist [online]. Available from: https://www.discoverlife.org/
  » https://www.discoverlife.org/
• ASSIS, A.F.D., 2010.Estudo populacional e molecular de Nannotrigona testaceicornis Cockerell (Hymenoptera, Apidae, Meliponini) através do DNA mitocondrial Ribeirão Preto: Faculdade de Medicina de Ribeirão Preto, 77 p. Dissertação de Mestrado em Ciências.
• BARRETO, L., VAN EUPEN, M., KOK, K., JONGMAN, R.H., RIBEIRO, M.C., VELDKAMP, A., HASS, A. and OLIVEIRA, T.G., 2012. The impact of soybean expansion on mammal and bird, in the Balsas region, north Brasilian Cerrado. Journal for Nature Conservation, vol. 20, no. 6, pp. 374-383. http://doi.org/10.1016/j.jnc.2012.07.003
  » http://doi.org/10.1016/j.jnc.2012.07.003
• BATALHA-FILHO, H., 2008. Distribuição geográfica, filogeografia e história evolutiva da abelha sem ferrão Melipona quadrifasciata (Hymenoptera, Apidae) Viçosa: Universidade Federal de Viçosa, 67 p. Dissertação de mestrado em Genética e Melhoramento.
• BIESMEIJER, J.C., HARTFELDER, K. and IMPERATRIZ-FONSECA, V.L., 2006. Stingless bees: biology and management. Apidologie, vol. 37, no. 2, pp. 121-123. http://doi.org/10.1051/apido:2006020
  » http://doi.org/10.1051/apido:2006020
• BONATTI, V., 2012.Caracterização genético-morfológica de populações de Melipona subnitida (Apidae, Meliponini) no nordeste brasileiro São Paulo: Universidade de São Paulo, 96 p. Dissertação de Mestrado em Ciências.
• BONATTI, V., SIMÕES, Z.L.P., FRANCO, F.F. and FRANCOY, T.M., 2014. Evidence of at least two evolutionary lineages in Melipona subnitida (Apidae, Meliponini) suggested by mtDNA variability and geometric morphometrics of forewings. Naturwissenschaften, vol. 101, no. 1, pp. 17-24. http://doi.org/10.1007/s00114-013-1123-5 PMid:24384774.
  » http://doi.org/10.1007/s00114-013-1123-5
• CÁMARA, J.Q., DE SOUSA, A.H., DE VASCONCELOS, W.E., DA SILVEIRA MAIA, P.H., DE ALMEIDA, J.C. and BORGES, P.M., 2004. Estudos de meliponíneos, com ênfase a Melipona subnitida D. no município de Jandaíra, RN. Revista de Biologia e Ciências da Terra, vol. 4, no. 1, pp. 1-21.
• CORVALÁN, L.C.J., CARVALHO, L.R., DIAS, R.O., BRAGA-FERREIRA, R.S., TARGUETA, C.P., BRITO, P.V.A., TELLES, M.P.C., SILVA-NETO, C.M. and NUNES, R., 2023. The complete mitochondrial genome of Melipona fasciculata and Melipona quadrifasciata: molecular evolution dynamics in stingless bees (Hymenoptera: Meliponini) mitogenomes. Journal of Apicultural Research, in press.
• CROZIER, R.H. and CROZIER, Y.C., 1993. The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization. Genetics, vol. 133, no. 1, pp. 97-117. http://doi.org/10.1093/genetics/133.1.97 PMid:8417993.
  » http://doi.org/10.1093/genetics/133.1.97
• DESSI, M.C., MAGRI, L.A., FRANCO, F.F., and DEL LAMA, M.A., 2024. Genetic and morphometric variation in populations of Partamona cupira and Partamona mulata, stingless bees endemic to the Cerrado biome in Brazil.Biological Journal of the Linnean Society, blae072. https://doi.org/10.1093/biolinnean/blae072
  » https://doi.org/10.1093/biolinnean/blae072
• ENGEL, M.S., RASMUSSEN, C., AYALA, R. and DE OLIVEIRA, F.F., 2023. Stingless bee classification and biology (Hymenoptera, Apidae): a review, with an updated key to genera and subgenera. ZooKeys, vol. 1172, pp. 239-312. http://doi.org/10.3897/zookeys.1172.104944 PMid:37547181.
  » http://doi.org/10.3897/zookeys.1172.104944
• EXCOFFIER, L. and LISCHER, H.E., 2010. Arlequin suite ver. 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, vol. 10, no. 3, pp. 564-567. http://doi.org/10.1111/j.1755-0998.2010.02847.x PMid:21565059.
  » http://doi.org/10.1111/j.1755-0998.2010.02847.x
• FARFAN, S.J.A., 2021. A meliponicultura como indutora de processos de resiliência socioecológica em agroecossistemas camponeses na Baixada Maranhense Maranhão: Universidade Estadual do Maranhão, 148 p. Tese de Doutorado em Agroecologia.
• FARFAN, S.J.A., CELENTANO, D., SILVA JUNIOR, C.H.L., DE FREITAS SILVEIRA, M.V., SERRA, R.T.A., GUTIERREZ, J.A.M., BARROS, H.C., RIBEIRO, M.H.M., BARTH, O.M., ALVES, R.M.O., GARCÍA, L.M.H. and ROUSSEAU, G.X., 2023. The effect of landscape composition on stingless bee (Melipona fasciculata) honey productivity in a wetland ecosystem of Eastern Amazon, Brazil. Journal of Apicultural Research, vol. 62, no. 5, pp. 1102-1114. http://doi.org/10.1080/00218839.2022.2137307
  » http://doi.org/10.1080/00218839.2022.2137307
• FRANCISCO, F.D.O., 2002.Diversidade genética de populações da abelha sem ferrão Plebeia remota: análise do DNA mitocondrial e microssatélites São Paulo: Universidade de São Paulo, 147 p. Dissertação de mestrado em Ciências.
• FRANCISCO, F.D.O., SANTIAGO, L.R. and ARIAS, M.C., 2013. Molecular genetic diversity in populations of the stingless bee Plebeia remota: A case study. Genetics and Molecular Biology, vol. 36, no. 1, pp. 118-123. http://doi.org/10.1590/S1415-47572013000100017 PMid:23569417.
  » http://doi.org/10.1590/S1415-47572013000100017
• FU, Y.X., 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, vol. 147, no. 7, pp. 915-925. http://doi.org/10.1093/genetics/147.2.915 PMid:9335623.
  » http://doi.org/10.1093/genetics/147.2.915
• JAFFÉ, R., POPE, N.S., ACOSTA, A.L., ALVES, D.A., ARIAS, M.C., LA RÚA, P., DE. and FRANCISCO, F., 2016. Beekeeping practices and geographic distance, not land use, drive gene flow across tropical bees. Molecular Ecology, vol. 25, no. 21, pp. 5345-5358. http://doi.org/10.1111/mec.13852 PMid:27662098.
  » http://doi.org/10.1111/mec.13852
• KERR, W.E., 1998. As abelhas e o meio ambiente. In: Anais do XII Congresso Brasileiro de Apicultura, 1998, Salvador. Salvador: Confederação Brasileira de Apicultura, vol. 12, pp. 27-30.
• KERR, W.E., CARVALHO, G.A., SILVA, A.C. and ASSIS, M.D.G.P.D., 2001. Aspectos pouco mencionados da biodiversidade amazônica. Parcerias Estratégicas, vol. 12, pp. 20-41.
• KIMURA, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, vol. 16, no. 2, pp. 111-120. http://doi.org/10.1007/BF01731581 PMid:7463489.
  » http://doi.org/10.1007/BF01731581
• KLEIN, A.M., VAISSIÈRE, B.E., CANE, J.H., STEFFAN-DEWENTER, I.S., CUNNINGHAM, S.A., KREMEN, C. and TSCHARNTKE, T., 2007. Importance of pollinators in changing landscapes for world crops. Proceedings. Biological Sciences, vol. 274, no. 1608, pp. 303-313. http://doi.org/10.1098/rspb.2006.3721 PMid:17164193.
  » http://doi.org/10.1098/rspb.2006.3721
• KOSER, J.R., BARBIERI, C. and FRANCOY, T.M., 2020. Legislation on meliponiculture in Brazil: a social and environmental demand. Sustainability in Debate, vol. 11, pp. 179-194. http://doi.org/10.18472/SustDeb.v11n1.2020.30319
  » http://doi.org/10.18472/SustDeb.v11n1.2020.30319
• KUMAR, S., STECHER, G., LI, M., KNYAZ, C. and TAMURA, K., 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, vol. 35, no. 6, pp. 1547-1549. http://doi.org/10.1093/molbev/msy096 PMid:29722887.
  » http://doi.org/10.1093/molbev/msy096
• MICHENER, C.D., 2007. The bees of the World 2nd ed. Baltimore: Johns Hopkins University Press, 953 p. http://doi.org/10.56021/9780801885730
  » http://doi.org/10.56021/9780801885730
• MORGADO, L.N., CARVALHO, C.F., SOUZA, B. and SANTANA, M.P., 2002. Fauna de abelhas (Hymenoptera: Apoidea) nas flores de girassol Helianthus annuus L. Lavras-MG. Ciência e Agrotecnologia, vol. 26, pp. 1167-1177.
• MULLIS, K.B. and FALOONA, F.A., 1987. Specific synthesis of DNA in vitro via polymerase catalysed chain reaction. Methods in Enzymology, vol. 155, pp. 335-350. http://doi.org/10.1016/0076-6879(87)55023-6 PMid:3431465.
  » http://doi.org/10.1016/0076-6879(87)55023-6
• MURRAY, T.E., KUHLMANN, M. and POTTS, S.G., 2009. Conservation ecology of bees: populations, species and communities. Apidologie, vol. 40, no. 3, pp. 211-236. http://doi.org/10.1051/apido/2009015
  » http://doi.org/10.1051/apido/2009015
• NEI, M. and MILLER, J.C., 1990. A simple method for estimating average number of nucleotide substitutions within and between populations from restriction data. Genetics, vol. 125, no. 4, pp. 873-879. http://doi.org/10.1093/genetics/125.4.873 PMid:1975792.
  » http://doi.org/10.1093/genetics/125.4.873
• NEI, M., 1987.Molecular evolutionary genetics 2nd ed. New York: Columbia University Press, 512 p. http://doi.org/10.7312/nei-92038
  » http://doi.org/10.7312/nei-92038
• NOGUEIRA, D.S., 2023. Overview of Stingless Bees in Brazil (Hymenoptera: Apidae: Meliponini). EntomoBrasilis, vol. 16, pp. e1041. http://doi.org/10.12741/ebrasilis.v16.e1041
  » http://doi.org/10.12741/ebrasilis.v16.e1041
• POLZIN, T. and DANESHMAND, S.V., 2003. On Steiner trees and minimum spanning trees in hypergraphs. Operations Research Letters, vol. 31, no. 1, pp. 12-20. http://doi.org/10.1016/S0167-6377(02)00185-2
  » http://doi.org/10.1016/S0167-6377(02)00185-2
• ROZAS, J., FERRER-MATA, A., SÁNCHEZ-DELBARRIO, J.C., GUIRAO-RICO, S., LIBRADO, P., RAMOS-ONSINS, S.E. and SÁNCHEZ-GRACIA, A., 2017. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution, vol. 34, no. 12, pp. 3299-3302. http://doi.org/10.1093/molbev/msx248 PMid:29029172.
  » http://doi.org/10.1093/molbev/msx248
• SAIKI, R.K., SCHARF, S., FALOONA, F., MULLIS, K.B., HORN, G.T., ERLICH, H.A. and ARNHEIM, N., 1985. Enzymatic amplification of β-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, vol. 230, no. 4732, pp. 1350-1354. http://doi.org/10.1126/science.2999980 PMid:2999980.
  » http://doi.org/10.1126/science.2999980
• SAITOU, N. and NEI, M., 1987. The neighbor-joning method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, vol. 4, no. 4, pp. 406-425. http://doi.org/10.1093/oxfordjournals.molbev.a040454 PMid:3447015.
  » http://doi.org/10.1093/oxfordjournals.molbev.a040454
• SAMBROOK, J., FRITSCH, E.F. and MANIATIS, T., 1989.Molecular Cloning: a Laboratory Manual 4th ed. New York: Cold Spring Harbor Laboratory Press, 2344 p.
• SANTOS, F.S. and DUARTE, O.M.P., 2018. Percepção de moradores rurais do entorno de um fragmento de Mata Atlântica em Porto Seguro-BA sobre as abelhas sem ferrão. Revista PINDORAMA, vol. 7, pp. 9-9. http://doi.org/10.55847/pindorama.v7i07.430
  » http://doi.org/10.55847/pindorama.v7i07.430
• SAYUSTI, T., RAFFIUDIN, R., ATMOWIDI, T., AISYAH, C.N., LUDIRO, F.R., BAHER, R.A., PUTRA, R.E., SOESILOHADI, R.C.H. and PURNOBASUKI, H., 2023. High genetic variations of the stingless bee Tetragonula laeviceps based on mitochondrial DNA of cytochrome c oxidase subunit 1 (CO1) gene in Sumatra and Java, Indonesia. Serangga, vol. 28, no. 3, pp. 295-311. http://doi.org/10.17576/serangga-2023-2803-20
  » http://doi.org/10.17576/serangga-2023-2803-20
• SCHNEIDER, H., 2007. Métodos de análise filogenética: um guia prático 3. ed. Ribeirão Preto: Holos e Sociedade Brasileira de Genética, 200 p.
• SILVA, G.R. 2018. Genômica e genética populacional da Abelha-Sem-Ferrão Melipona fasciculata no Brasil Piauí: Universidade Federal do Piauí, 191 p. Tese de Doutorado em Ciência Animal.
• SILVA, G.R., DE MELLO PEREIRA, F., DE ALMEIDA SOUZA, B., DO RÊGO LOPES, M.T. and DINIZ, F.M., 2019. Pesquisas com abelhas-sem-ferrão (Hymenoptera: Meliponini) e aplicabilidade dos marcadores moleculares: uma revisão sistemática da literatura. Pubvet, vol. 13, no. 1, pp. 1-19. http://doi.org/10.31533/pubvet.v12n2a260.1-7
  » http://doi.org/10.31533/pubvet.v12n2a260.1-7
• SILVA, G.R., PEREIRA, F.D.M., SOUZA, B.D.A., LOPES, M.T.D.R., CAMPELO, J.E.G. and DINIZ, F.M., 2014. Aspectos bioecológicos e genético-comportamentais envolvidos na conservação da abelha Jandaíra, Melipona subnitida Ducke (Apidae, Meliponini), e o uso de ferramentas moleculares nos estudos de diversidade. Arquivos do Instituto Biológico, vol. 81, no. 3, pp. 299-308. http://doi.org/10.1590/1808-1657000812012
  » http://doi.org/10.1590/1808-1657000812012
• SIMON, C., FRATI, F., BECKENBACH, A., CRESPI, B., LIU, H. and FLOOK, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America, vol. 87, no. 6, pp. 651-701. http://doi.org/10.1093/aesa/87.6.651
  » http://doi.org/10.1093/aesa/87.6.651
• SOLÓRZANO-GORDILLO, E.J., NIEH, J.C., CRUZ-LÓPEZ, L. and SÁNCHEZ, D., 2021. Gene flow from wild to managed colonies in the stingless bee Scaptotrigona mexicana and an update on its mating frequency. Journal of Apicultural Science, vol. 65, no. 2, pp. 291-301. http://doi.org/10.2478/jas-2021-0020
  » http://doi.org/10.2478/jas-2021-0020
• SOUSA, B.F.S., SANTOS, G.G., MESQUITA, J.A., NASCIMENTO, C.A.J., FREIRE, G.C., SANTOS, V.T.F., CARVALHO-ZILSE, G.A. and BARROS, J.R.S., 2022. Physicochemical composition and microbiological quality of honey produced from Tiúba, Melipona fasciculata (Apidae, Meliponini) in Brazil. Journal of Apicultural Research, vol. vol. 63, pp. 968-976. http://doi.org/10.1080/00218839.2022.2143145
  » http://doi.org/10.1080/00218839.2022.2143145
• SOUZA, F.S., COSTA, M.A.P.D.C., DE OLIVEIRA, E.J.F., RIBEIRO, M.D.F., SOUZA, B.D.A., ARAÚJO, E.D., IMPERATRIZ-FONSECA, V.L. and DE CARVALHO, C.A.L., 2018. Genetic Variability of Melipona subnitida (Hymenoptera: Apidae) in Introduced and Native Populations. Journal of Insect Science, vol. 18, no. 5, pp. 4. http://doi.org/10.1093/jisesa/iey089 PMid:30215802.
  » http://doi.org/10.1093/jisesa/iey089
• TAJIMA, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, vol. 123, no. 3, pp. 585-595. http://doi.org/10.1093/genetics/123.3.585 PMid:2513255.
  » http://doi.org/10.1093/genetics/123.3.585
• VALE, K.A.G., RODRIGUES, A.K.D.S., CARVALHO, K.S.S., MOURA, S.G., SOUZA, D.C. and BRITTO, F.B., 2021. Evidences of high genetic differentiation among populations of the stingless bee Scaptotrigona depilis (Moure, 1942) in Piauí, Brazil. Bee World, vol. 98, no. 3, pp. 83-88. http://doi.org/10.1080/0005772X.2020.1854998
  » http://doi.org/10.1080/0005772X.2020.1854998
• VENTURIERI, G.C., RAIOL, V.D.F.O. and PEREIRA, C.A.B., 2003. Avaliação da introdução da criação racional de Melipona fasciculata (Apidae: Meliponina), entre os agricultores familiares de Bragança-PA, Brasil. Biota Neotropica, vol. 3, no. 2, pp. 1-7. http://doi.org/10.1590/S1676-06032003000200003
  » http://doi.org/10.1590/S1676-06032003000200003
• VENTURIERI, G.R., 2015. Ecologia da polinização do açaizeiro (Euterpe oleracea) com e sem a introdução de colônias da abelha uruçu-amarela (Melipona flavolineata) Florianópolis: Universidade Federal de Santa Catarina, 120 p. Dissertação de mestrado em Agroecossitemas.
• WEINLICH, R., DE OLIVEIRA FRANCISCO, F. and ARIAS, M.C., 2004. Mitochondrial DNA restriction and genomic maps of seven species of Melipona (Apidae: meliponini). Apidologie, vol. 35, no. 4, pp. 365-370. http://doi.org/10.1051/apido:2004027
  » http://doi.org/10.1051/apido:2004027
• WRIGHT, S., 1965. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution; International Journal of Organic Evolution, vol. 19, no. 3, pp. 395-420. http://doi.org/10.2307/2406450.
• WRIGHT, S., 1978.Evolution and the genetics of populations Chicago: University of Chicago Press, 590 p. Variability Within and Among Natural Populations, vol. 4.

Publication Dates

• Publication in this collection
  07 Feb 2025
• Date of issue
  2024

History

• Received
  28 June 2024
• Accepted
  22 Nov 2024