Detection of antimicrobial resistance genes in beta-lactamase- and carbapenemase-producing <i>Klebsiella pneumoniae</i> by patient surveillance cultures at an intensive care unit in Rio de Janeiro, Brazil

Flores, Claudia; Romão, Célia Maria C. P. A.; Bianco, Kayo; Miranda, Catia Chaia de; Breves, Angela; Souza, Ana Paula S.; Santos, Rosana Maria R.; Fonseca, Bianca O.; Filippis, Ivano de; Clementino, Maysa M.

doi:10.5935/1676-2444.20160049

Acessibilidade / Reportar erro

Brasil

Jornal Brasileiro de Patologia e Medicina Laboratorial

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

LABORATORY MEDICINE, Original Article • J. Bras. Patol. Med. Lab. 52 (5) • Sep-Oct 2016 • https://doi.org/10.5935/1676-2444.20160049 copy

Detection of antimicrobial resistance genes in beta-lactamase- and carbapenemase-producing Klebsiella pneumoniae by patient surveillance cultures at an intensive care unit in Rio de Janeiro, Brazil

Detecção de genes de resistência a antimicrobianos em Klebsiella pneumoniae produtoras de betalactamases e carbapenemases por culturas de vigilância de pacientes em uma unidade de terapia intensiva no Rio de Janeiro, Brasil

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT

Introduction:

The increasing incidence of multi-resistant microorganisms has been considered a public health problem. One of the routines included in hospital practice is the screening of colonized and/or infected patients.

Objective:

The aim of this study was to evaluate the genetic variability and clonal relationships of extended-spectrum beta-lactamase (ESBL)-producing K. pneumoniae, from surveillance cultures, at an intensive care unit, in Rio de Janeiro, Brazil.

Material and methods:

Seventy K. pneumoniae isolates were obtained from rectal swabs (March 2013 to March 2014). Antimicrobial susceptibility was assessed by VITEK 2 System. Resistant genes bla_SHV, bla_TEM, bla_OXA-1, bla_KPC, bla_OXA-48, bla_CTX-M-15, bla_VIM, bla_IMP and bla_NDM were investigated by polymerase chain reaction (PCR); genetic diversity, by Enterobacterial Repetitive Intergenic Consensus-PCR (ERIC-PCR).

Results:

Strains showed high resistance rates to cefepime (94%), ceftazidime (96%), ertapenem (61%), imipenem (54%) meropenem (43%) and ciprofloxacin (69%). The most prevalent genes were bla_SHV (69%), bla_TEM (63%), bla_OXA-1 (60%), bla_KPC (57%), bla_CTX-M-15 (47%), bla_OXA-48 (16%). Genes bla_VIM, bla_IMP and bla_NDM were not detected. Twenty nine profiles of resistance genes were observed, with 23% carrying at least five genes. A great genetic diversity (68 ERIC profiles) was also observed among the strains.

Conclusion:

Although no clonal relationship was observed within the isolates, this study revealed alarming data on the antimicrobial resistance deficiently monitored for preventive purposes in Brazil. Our data allow us to conclude that the inclusion of surveillance cultures in health facilities is a recommended strategy aiming particularly at preventing the spread of resistance genes in the hospital environment and, consequently, reducing morbidity and mortality.

Key words:
infection control; epidemiological surveillance; Klebsiella pneumoniae; beta-lactamases; molecular typing

Gene	Sequence (5’-3’)	Annealing (ºC)	Fragment (pb)	Reference
bla _KPC-2	TGTCACTGTATCGCCGTC CTCAGTGCTCTACAGAAAACC	55	863	Yigit et al. (2001) ⁽²²22 Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001; 45(4): 1151-61. PubMed PMID: 11257029.⁾
bla _OXA-48	TGTTTTTGGTGGCATCGAT GTAAMRATGCTTGGTTCGC	58	177	Monteiro et al. (2012)⁽²³23 Monteiro J, Santos AF, Asensi MD, Peirano G. First report of KPC-2-producing Klebsiella pneumoniae strains in Brazil. Antimicrob Agents Chemother. 2009 Jan; 53(1): 333-4.⁾
bla _SHV-1	ATTTGTCGCTTCTTTACTCGC TTTATGGCGTTACCTTTGACC	55	1080	Jemina et al. (2008)⁽²⁴24 Jemima SA, Verghese S. Multiplex PCR for bla(CTX-M) & bla(SHV) in the extended spectrum β-lactamase (ESBL) producing gram-negative isolates. Indian J Med Res [Internet]. 2008 Set; 128(3): 313-7. Available at: http://medind.nic.in/iby/t08/i9/ibyt08i9p313.pdf. http://medind.nic.in/iby/t08/i9/ibyt08i9... ⁾
bla _CTX-M15	GGTTAAAAAATCACTGCGTC TTGGTGACGATTTTAGCCGC	54	863	Barguiga et al. (2011)⁽²⁵25 Barguigua A, El Otmani F, Talmi M, et al. Prevalence and genotypic analysis of plasmid mediated β-lactamases among urinary Klebsiella pneumoniae isolates in Moroccan community. J Antibiot (Tokyo). 2013; 66(1): 11-6. PubMed PMID: 23093031.⁾
bla _TEM-1	ATAAAATTCTTGAAGACGAAA GACAGTTACCAATGCTTAATCA	55	1051	Barguiga et al. (2011)⁽²⁵25 Barguigua A, El Otmani F, Talmi M, et al. Prevalence and genotypic analysis of plasmid mediated β-lactamases among urinary Klebsiella pneumoniae isolates in Moroccan community. J Antibiot (Tokyo). 2013; 66(1): 11-6. PubMed PMID: 23093031.⁾
bla _IMP	GAAGGCGTTTATGTTCATAC GTACGTTTCAAGAGTGATGC	58	587	Pitout et al. ( 2005)⁽²⁶26 Pitout JD, Laupland KB. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008 Mar; 8(3): 159-66. PubMed PMID: 18291338.⁾
bla _VIM	GTTTGGTCGCATATCGCAAC AATGCGCAGCACCAGGATAG	58	389	Pitout et al. ( 2005)⁽²⁶26 Pitout JD, Laupland KB. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008 Mar; 8(3): 159-66. PubMed PMID: 18291338.⁾
bla _OXA-1	CGCAAATGGCACCAGATTCAAC TCCTGCACCAGTTTTCCCATACAG	60	464	Mulvey et al. (2011)⁽²⁷27 Mulvey MR, Grant JM, Plewes K, Roscoe D, Boyd DA. New Delhi metallo-β-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada. Emerg Infect Dis. 2011 Jan; 17(1): 103-6. PubMed PMID: 21192866.⁾
bla _NDM-1	GGTGCATGCCCGGTGAAATC ATGCTGGCCTTGGGGAACG	58	660	Mulvey et al. (2011) ⁽²⁷27 Mulvey MR, Grant JM, Plewes K, Roscoe D, Boyd DA. New Delhi metallo-β-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada. Emerg Infect Dis. 2011 Jan; 17(1): 103-6. PubMed PMID: 21192866.⁾

Resistance profile	Resistance genotype	nº. of isolates/(%)
I	No gene	2 (2.9%)
II	bla _SHV-1	3 (4.3%)
III	bla _OXA-1	2 (2.9%)
IV	bla _KPC-2	6 (8.6%)
V	bla _TEM-1	1 (1.4%)
VI	bla_KPC-2 and bla_SHV-1	2 (2.9%)
VII	bla_TEM-1 and bla_SHV-1	7 (10%)
VIII	bla_KPC-2 and bla_OXA-1	1 (1.4%)
IX	bla_TEM-1 and bla_OXA-48	3 (4.3%)
X	bla_TEM-1 and bla_OXA-1	1 (1.4%)
XI	bla_CTX-M and bla_OXA-1	1 (1.4%)
XII	bla_KPC-2, bla_TEM-1 and bla_SHV-1	2 (2.9%)
XIII	bla_KPC-2, bla_SHV-1 and bla_OXA-1	1 (1.4%)
XIV	bla_KPC-2, bla_TEM-1 and bla_CTX-M15	1 (1.4%)
XV	bla_KPC-2, bla_TEM-1 and bla_OXA-1	1 (1.4%)
XVI	bla_TEM-1, bla_CTX-M15 and bla_OXA-1	1 (1.4%)
XVII	bla_SHV-1, bla_CTX-M15 and bla_OXA-48	1 (1.4%)
XVIII	bla_TEM-1, bla_SHV-1 and bla_CTX-M15	1 (1.4%)
XIX	bla_TEM-1, bla_SHV-1 and bla_OXA-1	2 (2.9%)
XX	bla_SHV-1, bla_CTX-M15 and bla_OXA-1	2 (2.9%)
XXI	bla_KPC-2, bla_TEM-1, bla_SHV-1 and bla_OXA-1	2 (2.9%)
XXII	bla_KPC-2, bla_SHV-1, bla_OXA-1 and bla_OXA-48	2 (2.9%)
XXIII	bla_KPC-2, bla_SHV-1, bla_CTX-M15 and bla_OXA-1	2 (2.9%)
XXIV	bla_KPC-2, bla_TEM-1, bla_CTX-M15 and bla_OXA-1	3 (4.3%)
XXV	bla_SHV-1, bla_CTX-M15, bla_OXA-1 and bla_OXA-48	2 (2.9%)
XXVI	bla_TEM-1, bla_SHV-1, bla_CTX-M15 and bla_OXA-1	2 (2.9%)
XXVII	bla_KPC-2, bla_TEM-1, bla_SHV-1, bla_CTX-M15 and bla_OXA-1	13 (18.6)
XXVIII	bla_TEM-1, bla_SHV-1, bla_CTX-M15, bla_OXA-1 and bla_OXA-48	1 (1.4%)
XXIX	bla_KPC-2, bla_TEM-1, bla_SHV-1, bla_CTX-M15, bla_OXA-1 and bla_OXA-48	2 (2.9%)

Sociedade Brasileira de Patologia Clínica, Rua Dois de Dezembro,78/909 - Catete, CEP: 22220-040v - Rio de Janeiro - RJ, Tel.: +55 21 - 3077-1400 / 3077-1408, Fax.: +55 21 - 2205-3386 - Rio de Janeiro - RJ - Brazil
E-mail: jbpml@sbpc.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] CORRESPONDING AUTHOR: Maysa Mandetta Clementino, Instituto Nacional de Controle de Qualidade em Saúde; Fundação Oswaldo Cruz; Av. Brasil, 4.365; 21045-900; Rio de Janeiro-RJ, Brasil; Phone.: +55 (21) 3865-5236; Fax: +55 (21) 2290-0915; e-mail: maysa.mandetta@incqs.fiocruz.br.