Male and female association in <i>Trichomyia</i> Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil

A new species of Trichomyia from the state of Bahia, Brazil, is described and illustrated, and male and female are associated using DNA barcoding. Additionally, fragments of the COI of two other species, Trichomyia cerdosa Araújo & Bravo, 2016 and Trichomyia ituberensis Araújo & Bravo, 2016, and the females of two unidentified species, are sequenced.

Keywords
DNA-barcoding; COI; Neotropical Region; Psychodid; Trichomyiinae

Authorship

Maíra Xavier Araújo ^** Corresponding author. E-mail: E-mail:mah.biology@gmail.com (M.X. Araújo).

Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, BrazilUniversidade Estadual de Feira de SantanaBrazilFeira de Santana, BA, BrazilUniversidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil

Marcos Aragão

Danilo Cordeiro

Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, BrazilInstituto Nacional de Pesquisa da AmazôniaBrazilManaus, AM, BrazilInstituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil

Freddy Bravo

Claudio José Barros de Carvalho

Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, BrazilUniversidade Federal do ParanáBrazilCuritiba, PR, BrazilUniversidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil

Sergio R. Andena

* Corresponding author. E-mail: E-mail:mah.biology@gmail.com (M.X. Araújo).

Conflicts of interest

The authors declare no conflicts of interest.

Associate Editor: Andrzej Grzywacz

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (3)
Tables (3)

Thumbnail

Fig. 1.
1–9 Trichomyia pseudoannae sp. nov. 1. Scape, pedicel and flagellomeres 1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate).

Thumbnail

Fig. 2.
1–3 Trichomyia pseudoannae sp. nov. 1. Female terminalia, ventral; 2. Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate).

Thumbnail

Fig. 3.
Dendrogram of genetic similarity among Trichomyia species analyzed, F, female.

Thumbnail

Table 1
Primer pairs used for the amplification of COI gene fragments.

Thumbnail

Table 2
Specimens analyzed in this work, including the species names; BR, Brazil; gender (M, male; F, female); code, primer, pair base sequence, GenBank accession numbers and locality.

Thumbnail

Table 3
Matrix of p-distances among males and females of specimens ofTrichomyia. Bold denotes shortest distances; F, female.

Fig. 1. 1–9 Trichomyia pseudoannae sp. nov. 1. Scape, pedicel and flagellomeres 1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate).

Fig. 2. 1–3 Trichomyia pseudoannae sp. nov. 1. Female terminalia, ventral; 2. Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate).

Fig. 3. Dendrogram of genetic similarity among Trichomyia species analyzed, F, female.

Table 1 Primer pairs used for the amplification of COI gene fragments.

Primer	Sequence (5′ → 3′)	References
LCO1490	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294-299.
HCO2198	TAAACTTCAGGGTGACCAAAAAATCA	Folmer et al. (1994)Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294-299.
MtD6	GGAGGATTTGGAAATTGATTAGTTCC	Simon et al. (1994)Simon, C., Frati, F., Becknbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651-701.
MtD9	CCCGGTAAAATTAAAATATAAACTTC	Simon et al. (1994)Simon, C., Frati, F., Becknbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651-701.

Table 2 Specimens analyzed in this work, including the species names; BR, Brazil; gender (M, male; F, female); code, primer, pair base sequence, GenBank accession numbers and locality.

Species	Gender	DNA extraction	Primer	Sequence	GenBank accession	Locality
		code		(pb)	numbers
T. cerdosaAraújo &Araújo, M.X., Bravo, F., 2016. Description of forty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera: Psychodidae, Trichomyiinae). Zootaxa 4130, 1-76. Bravo, 2016	M	T15	lco/hco	657	MH042537	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 15.VI.2013 (light trap), M. Aragão & E. Menezes leg.
T. cerdosaAraújo &Araújo, M.X., Bravo, F., 2016. Description of forty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera: Psychodidae, Trichomyiinae). Zootaxa 4130, 1-76. Bravo, 2016	M	P4	mtd6/mtd9	480	MH042535	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 15.VI.2013 (light trap), M. Aragão & E. Menezes leg.
T. pseudoannae sp. nov.	M	P28	lco/hco	468	MH042538	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 18.V.2013 (light trap), M. Aragão & E. Menezes leg.
T. ituberensisAraújo &Araújo, M.X., Bravo, F., 2016. Description of forty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera: Psychodidae, Trichomyiinae). Zootaxa 4130, 1-76. Bravo, 2016	M	P21	mtd6/mtd9	480	MH042540	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Vila 5, 28.IV–19.V.2013 (Malaise), M. Aragão & E. Menezes leg.
T. pseudoannae sp. nov.	F	P46	lco/hco	657	MH042536	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 22.IX.2012 (light trap), M. Aragão & E. Menezes leg.
Trichomyia sp1	F	P29	mtd6/mtd9	467	MH042539	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 18.V.2013 (light trap), M. Aragão & E. Menezes leg.
Trichomyia sp2	F	P44	lco/hco	633	MH042541	BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, 24.III.2013 (light trap), E. Mota, M. Aragão & E. Menezes leg.

Table 3 Matrix of p-distances among males and females of specimens ofTrichomyia. Bold denotes shortest distances; F, female.

	#P4 T.	#P46 T.	#T15 T.	#P28 T.	#P29 Trichomyia	#P21 T.	#P44 Trichomyia
	cerdosa	pseudoannae (F)	cerdosa	pseudoannae	sp1 (F)	ituberensis	sp2 (F)
#P4 T. cerdosa		0.156	0.010	0.162	0.197	0.216	0.276
#P46 T.	0.156		0.166	0.002	0.188	0.139	0.287
pseudoannae (F)
#T15 T. cerdosa	0.010	0.166		0.168	0.201	0.220	0.294
#P28 T.	0.162	0.002	0.168		0.202	0.154	0.304
pseudoannae
#P29 Trichomyia	0.197	0.188	0.201	0.202		0.218	0.388
sp.1 (F)
#P21 T. ituberensis	0.216	0.139	0.220	0.154	0.218		0.314
#P44 Trichomyia	0.276	0.287	0.294	0.304	0.388	0.314
sp.2 (F)

How to cite

copy

Sociedade Brasileira De Entomologia Caixa Postal 19030, 81531-980 Curitiba PR Brasil , Tel./Fax: +55 41 3266-0502 - São Paulo - SP - Brazil
E-mail: sbe@ufpr.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Male and female association in <i>Trichomyia</i> Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil

PlumX

Mensagem

[1] * Corresponding author. E-mail: E-mail:mah.biology@gmail.com (M.X. Araújo).