SciELO - Scientific Electronic Library Online

 
vol.35 issue10Generalized method for analysis of unbalanced diallelsPapaya somatic embryogenic protocol author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Pesquisa Agropecuária Brasileira

Print version ISSN 0100-204XOn-line version ISSN 1678-3921

Abstract

ANUNCIACAO, CARLOS EDUARDO  and  ASTOLFI-FILHO, SPARTACO. Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting. Pesq. agropec. bras. [online]. 2000, vol.35, n.10, pp.2007-2015. ISSN 0100-204X.  http://dx.doi.org/10.1590/S0100-204X2000001000012.

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Keywords : breeding methods; molecular cloning; progeny testing; horses; identification; genetic polymorphism.

        · abstract in Portuguese     · text in English     · English ( pdf epdf )

 

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License