SciELO - Scientific Electronic Library Online

vol.35 issue10Generalized method for analysis of unbalanced diallelsPapaya somatic embryogenic protocol author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Pesquisa Agropecuária Brasileira

On-line version ISSN 1678-3921


ANUNCIACAO, CARLOS EDUARDO  and  ASTOLFI-FILHO, SPARTACO. Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting. Pesq. agropec. bras. [online]. 2000, vol.35, n.10, pp. 2007-2015. ISSN 1678-3921.

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Keywords : breeding methods; molecular cloning; progeny testing; horses; identification; genetic polymorphism.

        · abstract in Portuguese     · text in English     · English ( pdf epdf )


Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License