SciELO - Scientific Electronic Library Online

vol.35 issue10Generalized method for analysis of unbalanced diallelsPapaya somatic embryogenic protocol author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand




Related links


Pesquisa Agropecuária Brasileira

Print version ISSN 0100-204XOn-line version ISSN 1678-3921


ANUNCIACAO, CARLOS EDUARDO  and  ASTOLFI-FILHO, SPARTACO. Teste de paternidade em eqüinos Mangalarga-Marchador pela técnica do DNA-"fingerprinting". Pesq. agropec. bras. [online]. 2000, vol.35, n.10, pp.2007-2015. ISSN 0100-204X.

Sondas moleculares de minissatélites CG-ricas isoladas do genoma humano têm apresentado pouca habilidade de individualização em cavalos. Neste trabalho foram isoladas novas seqüências de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genômico de cavalos Mangalarga-Marchador foi tratado com enzimas de restrição que digerem preferencialmente seqüências não-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estão localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genômica com o oligonucleotídeo (TG)n, demonstraram um perfil de hibridização semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualização obtido foi de 10-8, 105 vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinação do parentesco em cruzamentos e apresentaram uma seqüência-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente.

Keywords : métodos de melhoramento; clonagem molecular; teste de progênie; cavalos; identificação; polimorfismo; genético.

        · abstract in English     · text in English     · English ( pdf epdf )


Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License