Identification and validation of novel EST-SSR markers in olives

Arbeiter, Alenka Baruca; Hladnik, Matjaž; Jakše, Jernej; Bandelj, Dunja

doi:10.1590/1678-992X-2016-0111

Acessibilidade / Reportar erro

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Genetics and Plant Breeding • Sci. agric. (Piracicaba, Braz.) 74 (3) • May-Jun 2017 • https://doi.org/10.1590/1678-992X-2016-0111 copy

Identification and validation of novel EST-SSR markers in olives

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT:

The olive (Olea europaea L.) is a leading oil crop in the Mediterranean area. Limited information on the inheritance of agronomic significant traits hinders progress in olive breeding programs, which encourages the development of markers linked to the traits. In this study, we report on the development of 46 olive simple sequence repeat (SSR) markers, obtained from 577,025 expressed sequence tags (ESTs) in developing olive fruits generated in the framework of the Slovenian national olive transcriptome project. Sequences were de novo assembled into 98,924 unigenes, which were then used as a source for microsatellites searching. We identified 923 unigenes that contained 984 SSRs among which dinucleotide SSRs (36 %) were the most abundant, followed by tri- (33 %) and hexa- (21 %) nucleotides. Microsatellite repeat motif GA (37 %) was the most common among dinucleotides, while microsatellite repeat motif GAA was the most abundant trinucleotide SSR motif (16 %). Gene ontology annotations could be assigned to 27 % of the unigenes. A hundred and ten expressed sequence tag-derived-simple sequence repeats (EST-SSRs) with annotated genes were selected for primer designing and finally, 46 (42 %) polymorphic EST-SSRs were successfully amplified and used to validate genetic diversity among 24 olive varieties. The average number of alleles per locus, observed heterozygosity, expected heterozygosity, and polymorphic information content were 4.5, 0.649, 0.604 and 0.539, respectively. Twenty-seven EST-SSRs showed good diversity properties and were recommended for further olive genome investigation.

Keywords:
expressed sequence tags; microsatellites; genic markers; genetic diversity; functional annotation

GenBank Accession No.	Locus	Primer sequence (5′-3′)	Repeat motif	SSR location	T_a1,T_a2 (°C)	Size range (bp)	Putative function; accession code
GDUL01003735	OeUP-01	F: TGTCTCATGCCAGATAAACAG R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GCAGCAATCCCACAAACTAA	(AAG)11	5′ UTR	55, 50	200-221	aquaporin-like protein [Petunia × hybrida]; AAL49750.1
GDUL01018604	OeUP-02	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TTTGTCGCTTGCAGATTCCC R: CTCCCTTACCAGTTGTCGGA	(TGC)7	CDS	50, 45	197-255	ribosomal lysine N-methyltransferase 3 isoform X2 [Sesamum indicum]; XP_011076932.1
GDUL01058010	OeUP-03	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCATACGGGCTAGTCGATCG R: ATCTGCGCTAGTAACACAT	(TC)13(AC)8	3′ UTR	50, 45	166-170	pre-mRNA cleavage factor Im 25 kDa subunit 2-like [Sesamum indicum]; XP_011084411.1
GDUL01030423	OeUP-04	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCCGAAATCCCAGTAGAGTTTT R: GCAGCAGAAATCACCAATCCT	(TCT)7	5′ UTR	50, 45	196-232	uncharacterized protein LOC104247946 [Nicotiana sylvestris]; XP_009802414.1
GDUL01046188	OeUP-05	F: GGCACCAAAGCTAAGCTCAA R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CCCGGGAAAAGTGTTCTGT	(CAG)8	CDS	58, 53	186-201	ethylene-responsive transcription factor ERF113 isoform X2 [Sesamum indicum]; XP_011086885.1
GDUL01026627	OeUP-06	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TGAAGTTCCAAGCAGTCCAA R: CTCTTTCTTCAACAGTGGCTGA	(TTC)11	CDS	50, 45	141-163	cyclin-D3-2-like [Nicotiana sylvestris]; XP_009769846.1
GDUL01021889	OeUP-07	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TATTGATCACACGGGAATCG R: AACACAATCCAATCCAAGCTG	(GA)11	3′ UTR	50, 45	207-235	phosphatidylinositol transporter, putative [Ricinus communis]; XP_002512943.1
GDUL01011676	OeUP-08	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. AACGCTCAAGTTCGGTGTTC R: CCAATCCGGTGGCATGATG	(TGC)7	3′ UTR	50, 45	196-208	mediator of RNA polymerase II transcription subunit 8 [Fragaria vesca subsp. vesca]; XP_004296540.1
GDUL01009850	OeUP-09	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TGCTTAGAGCCAGAGGACGA R: CCCAAAATCCATTTTACACCA	(TGA)8	CDS	58, 53	141-156	hypothetical protein M569_16005, partial [Genlisea aurea]; EPS58808.1
GDUL01002589	OeUP-10	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACCGGAGCTGAGAATATCCA R: TCTTCCACTGCCACTACTCG	(TCG)7	CDS	58, 53	212-218	zinc finger CCCH domain-containing protein 11- like [Sesamum indicum]; XP_011077389.1
GDUL01041395	OeUP-11	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ATAGTAACCACCAGCGCCAT R: GTGATTGTCATTAAATTGCATCA	(TGG)7	3′ UTR	53, 48	137-165	abscisic stress-ripening protein 3-like isoform X1 [Populus euphratica]; XP_011044239.1
GDUL01003880	OeUP-12	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GAGCTGCTGGGATAGGACTG R: CTCGATCCCTCACGTTACAAG	(TGTA)6	3′ UTR	50, 45	140-151	proteasome-associated protein ECM29 homolog isoform X2 [Cucumis melo]; XP_008449628.1
GDUL01008284	OeUP-13	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CAATAACCCCATCAGCAGCC R: AGTCCATTAAAACCTTGCAGTCA	(TATG)7	3′ UTR	53, 48	162-174	DDB1- and CUL4-associated factor 8 [Sesamum indicum]; XP_011089371.1
GDUL01006921	OeUP-14	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TTCCCTTTCGCTTGAAGGTA R: GTGTGGATGGCGCTTTAGTC	(AC)11	5′ UTR	55, 50	153-165	predicted protein [Phaeodactylum tricornutum CCAP 1055/1]; XP_002185470.1
GDUL01000672	OeUP-15	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCTGGGGTTGCTAATTGTAG R: TTTCCTTCATCATAAAGCTT	(GTG)7	3′ UTR	58, 53	184-190	enhancer of mRNA-decapping protein 4-like [Nelumbo nucifera]; XP_010279236.1
GDUL01011852	OeUP-16	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CCACCTCCAAGCCTCAGTAA R: GCCCACGTGCATCAAGAAAT	(TC)10	5′ UTR	60, 55	234-258	growth regulator-like protein [Medicago truncatula]; XP_003601898.2
GDUL01008290	OeUP-17	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCTGGCCTGAGACCTTAAACA R: CGTGGAGTAATTTCATTGGATG	(GA)11	5′ UTR	50, 45	158-167	Embryo sac development arrest 6, putative [Theobroma cacao]; XP_007035194.1
GDUL01002948	OeUP-18	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TACCCGTTTCCCTTCACTTG R: AGCTGGTGACCCTACAATGG	(TCC)9	CDS	50, 45	177-200	disease resistance response protein 206-like [Glycine max]; XP_003525358.1
GDUL01011678	OeUP-19	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TACAATTCATCTGCGGCATC R: GGCTTCGATTGATTTGCTGT	(GA)10	3′ UTR	58, 53	175-183	E3 ubiquitin-protein ligase CIP8 [Erythranthe guttatus]; XP_012839188.1
GDUL01012584	OeUP-20	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACCAACCGAGCAAAGCAAAA R: TTGCCATCGTCTGAGAGTGT	(TTC)7	5′ UTR	50, 45	191-212	hypothetical protein CICLE_v10016930mg [Citrus clementina]; XP_006445829.1
GDUL01010877	OeUP-21	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GGCTGAAGTGAAAGCAAAGG R: GCGGACAAGTGGGATGTACT	(AC)15	3′ UTR	55, 50	190-205	intersectin-1 [Nicotiana tomentosiformis]; XP_009631701.1
GDUL01019797	OeUP-22	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TAGATTCAAAGGGCGGCTAA R: GAGGATCTATGGCATCGTCA	(GA)13	5′ UTR	50, 45	153-184	MIP18 family protein At1g68310-like [Solanum tuberosum]; XP_006366991.1
GDUL01016632	OeUP-23	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CAATTGCTGCTGCTGACTTC R: CATTCAGTTCCTCCCTTCCA	(AGA)7	CDS	53, 48	194-197	senescence-associated family protein [Populus trichocarpa]; XP_006372581.1
GDUL01018333	OeUP-24	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACCAGATGAAAACTCGTGATCT R: ATACGTTCGTCTAGCAGCCA	(CAG)7	5′ UTR	53, 48	185-200	UBP1-associated proteins 1C [Vitis vinifera]; XP_002280767.1
GDUL01023602	OeUP-25	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. AAACATTTTGCACCATTCCA R: TCAATTGGCTTCTTCCCTCA	(ATC)7	5′ UTR	55, 50	171-178	poly(ADP-ribose) glycohydrolase 1 isoform X1 [Vitis vinifera]; XP_002280371.1
GDUL01004307	OeUP-26	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. AGGAAGTAGCAGCACCAGTT R: TCCCTCCTTTCCTGGCTTTT	(GAT)7	3′ UTR	53, 48	177-204	60S ribosomal protein L36-2-like [Gossypium raimondii]; XP_012482487.1
GDUL01015903	OeUP-27	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GGCTCACCCTTTCAGTTTCA R: CAGCCCATGAATCAGCATCC	(TTC)9	5′ UTR	55, 50	159-181	protein dehydration-induced 19 homolog 3-like isoform X1 [Erythranthe guttatus]; XP_012837687.1
GDUL01057837	OeUP-28	F:TTTTAGTTCAAACTACATAGGAACGTA R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CAAGCTGGTGCCTTATGGTT	(AG)10	5′ UTR	50, 45	152-184	glutaredoxin-C9-like [Nicotiana sylvestris]; XP_009767693.1
GDUL01000197	OeUP-29	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GTCCTGCCTTCAAGATCCAC R: GCGGTGGCCTGAGATACTTA	(CA)10	CDS	55, 50	205-215	protein yippee-like At5g53940-like [Solanum tuberosum]; XP_006358970.1
GDUL01007444	OeUP-30	F:GAGTCACACTCGTCCCTACCA R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GAATCGCGCGTGTAACATTT	(AC)11	5′ UTR	55, 50	190-196	autophagy-related protein 8i-like [Solanum tuberosum]; NP_001275429.1
GDUL01003407	OeUP-31	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CATTTTCCGACCAACTGATGAA R: TCTTCTTGCGGTTAGGTTGC	(ACC)8	5′ UTR	60, 55	203-212	E3 ubiquitin-protein ligase UBR2 [Sesamum indicum]; XP_011077478.1
GDUL01001906	OeUP-32	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACGAACCGTGGCAGTACATT R: CCTTCCCTTTGCCTGTATGA	(AGA)7	5′ UTR	55, 50	171-188	Rubredoxin-like superfamily protein [Theobroma cacao]; XP_007038169.1
GDUL01002038	OeUP-33	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACGTCAACCATGCTTCAACC R: TCAGTACCGAAGCAGCCATA	(TCA)7	3′ UTR	53, 48	220-234	Cold-regulated 413-plasma membrane 2 isoform 1 [Theobroma cacao]; XP_007047094.1
GDUL01058412	OeUP-34	F: CCTTCATAGGCAAAATGGTCA R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CACCAAAGCATTTGCAGAGA	(GA)12	3′ UTR	55, 50	193-226	xyloglucan endotransglucosylase/hydrolase 3 [Actinidia eriantha]; ACD03213.1
GDUL01009565	OeUP-35	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GGTGGGGTCTGAATATATGTCA R: GGCAATGACTTTACGACAAGA	(ATT)7	3′ UTR	58, 53	225-231	hypothetical protein MIMGU_mgv1a003502mg [Erythranthe guttata]; EYU41540.1
GDUL01055178	OeUP-36	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TGCTTTCTCATTTTCACCACCA R: AGACTGCACCACCATCATCA	(GTC)7	3′ UTR	58, 53	142-154	ADNP homeobox protein 2 [Tupaia chinensis]; XP_006165827.1
GDUL01015452	OeUP-37	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. AATGGCTGCGAAATGAGAAG R: CAAAGATTTCAATTTTGTTCTTGGT	(TTC)9	CDS	50, 45	148-188	pentatricopeptide repeat-containing protein, putative [Ricinus communis]; XP_002509440.1
GDUL01057556	OeUP-38	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. AGAACCACCTCAACCACCAA R: GTCGTCTGTTGTTGGCGATA	(CAT)7	CDS	53, 48	150-167	Serine/threonine-protein kinase HuHRK1 [Hanseniaspora uvarum DSM 2768]; KKA02402.1
GDUL01033407	OeUP-39	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCTCGGTTCCTTCCATTCCA R: GCGAAACAGAAATACATACAAGG	(AG)10	3′ UTR	50, 45	193-209	hypothetical protein L484 004798 [Morus notabilis]; XP_010099372.1
GDUL01030115	OeUP-40	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. ACCCAGTAGCTTAAATCTGT R: ACGACGATGCGATTTCTTCA	(TCT)7	3′ UTR	53, 48	179-197	High chlorophyll fluorescence phenotype 173 protein isoform 1 [Theobroma cacao]; XP_007023557.1
GDUL01029326	OeUP-41	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CGGTGACCCTTTAGCCTGTA R: ATCAGAGGCTTCGAGGAGGT	(AAG)7	CDS	50, 45	160-163	lisH domain-containing protein C1711.05-like [Citrus sinensis]; XP_006482262
GDUL01034902	OeUP-42	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CGATTTCAAAGGGAATCGAA R: ACCCGCAATTTACCATGAAA	(CTG)8	CDS	58, 53	162-183	vacuolar protein sorting-associated protein 8 homolog isoform X1 [Vitis vinifera]; XP_002267626.3
GDUL01048166	OeUP-43	F: AAAATCAAACACAACTTGGCAAT R: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. CTTCCAATCTGAAAATGCACA	(TTC)7	CDS	50, 45	195-231	TrbL/VirB6 plasmid conjugal transfer protein [Neisseria wadsworthii]; ZP_08940344.1
GDUL01050680	OeUP-44	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCAGGTTCTGGCAAGGATTC R:TTCATCCCTTCTGCTGCTCT	(GCT)7	CDS	58, 53	149-155	protein MEI2-like 4 isoform X3 [Vitis vinifera]; XP_010657314.1
KU709832	OeUP-45	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. GGCCAATCAATGAACCAGCA R: AGGGCTTGATTCTAAGCTCA	(AAG)7	CDS	50, 45	145-168	flavonoid-related R2R3 MYB 4a repressor transcription factor [Vitis vinifera]; NP_001268129.1
GDUL01050819	OeUP-46	F: ^* * Primers elongated for the universal M13 (-21) sequence (5′-TGTAAAACGACGGCCAGT-3′) at the 5′ ends. TCTTCCTGGTATTTGTTTCGGT R: ACAAGAGTATATATGCCACACA	(AAT)7	CDS	58, 53	201-204	hypothetical protein [Methylococcaceae bacterium 73a]; WP_045223293.1

Locus	H_o	H_e	n	n_e	PIC	PI	p-value	F(null)
OeUP-01	0.833	0.811	6	5.29	0.764	0.132	0.5507^NS	-0.0235
OeUP-02	0.833	0.748	6	3.97	0.686	0.212	0.3597^NS	-0.0689
OeUP-03	0.958	0.563	3	2.29	0.454	0.494	0.0002^* ***** Statistically significant difference p < 0.001.	-0.2870
OeUP-04	0.875	0.824	7	5.68	0.780	0.120	0.4429^NS	-0.0376
OeUP-05	0.583	0.593	4	2.46	0.539	0.300	0.0515^NS	+0.0299
OeUP-06	0.958	0.785	6	4.65	0.730	0.169	0.2551^NS	-0.1171
OeUP-07	0.208	0.696	7	3.29	0.638	0.231	0.0000^* ***** Statistically significant difference p < 0.001.	+0.5433
OeUP-08	0.708	0.629	4	2.70	0.571	0.283	0.5822^NS	-0.0636
OeUP-09	0.958	0.792	5	4.81	0.740	0.157	0.2284^NS	-0.1079
OeUP-10	0.583	0.507	2	2.03	0.373	0.623	0.4516^NS	-0.0804
OeUP-11	0.875	0.717	7	3.53	0.654	0.233	0.3174^NS	-0.1197
OeUP-12	0.042	0.042	2	1.04	0.040	0.922	1.0000^NS	-0.0036
OeUP-13	0.667	0.637	3	2.75	0.553	0.353	0.5146^NS	-0.0270
OeUP-14	0.500	0.684	4	3.16	0.609	0.289	0.3739^NS	+0.1570
OeUP-15	0.208	0.407	3	1.69	0.354	0.495	0.0001^* ***** Statistically significant difference p < 0.001.	+0.3294
OeUP-16	0.958	0.792	6	4.81	0.741	0.152	0.7158^NS	-0.1096
OeUP-17	0.167	0.156	2	1.18	0.141	0.753	0.7025^NS	-0.0358
OeUP-18	0.875	0.737	4	3.80	0.668	0.238	0.4240^NS	-0.0977
OeUP-19	0.875	0.658	4	2.92	0.594	0.276	0.0819^NS	-0.1783
OeUP-20	0.875	0.738	6	3.82	0.673	0.226	0.1835^NS	-0.1068
OeUP-21	0.792	0.701	4	3.34	0.628	0.274	0.4591^NS	-0.0670
OeUP-22	1.000	0.869	8	7.63	0.833	0.076	0.3407^NS	-0.0823
OeUP-23	0.500	0.383	2	1.62	0.305	0.602	0.1205^NS	-0.1423
OeUP-24	0.958	0.780	6	4.55	0.731	0.155	0.0586^NS	-0.1223
OeUP-25	0.125	0.488	2	1.95	0.364	0.615	0.0001^* ***** Statistically significant difference p < 0.001.	+0.5856
OeUP-26	0.875	0.667	5	3.00	0.589	0.313	0.4038^NS	-0.1633
OeUP-27	0.958	0.664	5	2.98	0.585	0.318	0.0466^'^* * Statistically significant difference p < 0.05;	-0.2089
OeUP-28	0.333	0.489	5	1.96	0.433	0.409	0.0002^* ***** Statistically significant difference p < 0.001.	+0.1823
OeUP-29	0.917	0.660	4	2.94	0.577	0.334	0.0581^NS	-0.1840
OeUP-30	0.792	0.611	3	2.57	0.514	0.414	0.2565^NS	-0.1470
OeUP-31	0.417	0.391	4	1.64	0.355	0.464	0.9763^NS	-0.0349
OeUP-32	0.625	0.595	3	2.47	0.514	0.379	0.4851^NS	-0.0194
OeUP-33	0.167	0.515	4	2.06	0.458	0.386	0.0000^* ***** Statistically significant difference p < 0.001.	+0.4955
OeUP-34	0.958	0.860	8	7.14	0.823	0.083	0.0619^NS	-0.0692
OeUP-35	0.542	0.414	3	1.71	0.338	0.554	0.3892^NS	-0.1522
OeUP-36	0.292	0.263	3	1.36	0.239	0.606	0.8989^NS	-0.0723
OeUP-37	0.958	0.848	7	6.58	0.808	0.095	0.3292 ^NS	-0.0725
OeUP-38	0.667	0.639	5	2.77	0.553	0.359	0.0000^* ***** Statistically significant difference p < 0.001.	-0.0610
OeUP-39	0.833	0.735	6	3.77	0.669	0.230	0.1459^NS	-0.0780
OeUP-40	0.667	0.655	4	2.90	0.590	0.283	0.4966^NS	-0.0229
OeUP-41	0.292	0.510	2	2.04	0.375	0.625	0.0322^* * Statistically significant difference p < 0.05;	+0.2623
OeUP-42	0.542	0.576	6	2.36	0.528	0.299	0.5137^NS	+0.0596
OeUP-43	0.042	0.299	4	1.43	0.274	0.555	0.0000^* ***** Statistically significant difference p < 0.001.	+0.7658
OeUP-44	0.583	0.504	3	2.02	0.391	0.565	0.4816^NS	-0.0788
OeUP-45	0.875	0.730	6	3.70	0.671	0.213	0.5332^NS	-0.1208
OeUP-46	0.625	0.439	2	1.78	0.337	0.602	0.0324^* * Statistically significant difference p < 0.05;	-0.1850
Average	0.649	0.604	4.5	3.13	0.539	2.10 × 10^−24a	–	–

Escola Superior de Agricultura "Luiz de Queiroz" USP/ESALQ - Scientia Agricola, Av. Pádua Dias, 11, 13418-900 Piracicaba SP Brazil, Phone: +55 19 3429-4401 / 3429-4486 - Piracicaba - SP - Brazil
E-mail: scientia@usp.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author <dunja.bandelj@upr.si>