Contribution of DNA repair xeroderma pigmentosum group D genotypes to pancreatic cancer risk in the Chinese Han population

Yan, Dong; Liang, Xiao-Hui; Ding, Wei; Xu, Xin-Jian; Wang, Xi-Yan

doi:10.1590/1678-4685-GMB-2017-0033

Acessibilidade / Reportar erro

Brasil

Genetics and Molecular Biology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Human and Medical Genetics • Genet. Mol. Biol. 41 (1) • Jan-Mar 2018 • https://doi.org/10.1590/1678-4685-GMB-2017-0033 copy

Contribution of DNA repair xeroderma pigmentosum group D genotypes to pancreatic cancer risk in the Chinese Han population

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

This study aimed to determine the association between the polymorphisms and haplotypes in the xeroderma pigmentosum group D (XPD) gene and the risk of pancreatic cancer in the Chinese Han population. SNaPshot was used for genotyping six SNP sites of the XPD gene. Comparisons of the correlations between different genotypes in combination with smoking and the susceptibility to pancreatic cancer were performed. Individual pancreatic cancer risk in patients who carry mutant C alleles (AC, CC, and AC+CC) at rs13181 increased (p < 0.05). Taking non-smoking individuals who carry the AA genotype as a reference, and non-smoking individuals who carry mutant allele C (AC+CC), the risk of pancreatic cancer increased by 3.343 times in individuals who smoked ≥ 20 cigarettes daily, 3.309 times in individuals who smoked ≥ 14 packs per year, 5.011 times in individuals who smoked ≥ 24 packs per year, and 4.013 times in the individuals who smoked ≥ 37 packs per year (P < 0.05). In addition, haplotype analysis revealed that haplotype AGG, which comprised rs13181, rs3916874 and rs238415, was associated with a 1.401-fold increase in pancreatic cancer risk (p < 0.05). We conclude that the polymorphism of XPD Lys751Gln (rs13181) in combination with smoking contributes to increased risk of pancreatic cancer in the Chinese Han population. Haplotype AGG might be a susceptibility haplotype for pancreatic cancer.

Keywords:
Pancreatic neoplasm; human xeroderma pigmentosum group D; polymorphism; smoking

Locus	PCR primer of XPD gene 5’-3’	Sequences of single nucleotide primer extension 5’-3’
rs13181	F:AACCAGGGCCAGGCAAGACT	SF:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTCTGAGCAATCTGCTCTATCCTCT
	R:CCCCCTCTCCCTTTCCTCTGT
rs3916874	F:CTGCACAGGTGGCTGTGTGTTT	SF:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTGGCTCCACACTGTCTCTATTGTA
	R:GATTGGTGGAGGGGCTGACTGT
rs238415	F:GACATCGGCCTTGTGCTTCAAT	SF:TTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTGTGACCCAGTCCCCACAGC
	R:CCTTGACCCCCTACTTCACACC
rs50872	F:TTCCCATCTGCCAACACCTCAT	SF:CCTCCCCCTCATCCTTAGG
	R:GAGGGCTTCCTGGAGGACAAGA
rs50871	F:TTCCCATCTGCCAACACCTCAT	SR:TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTGAAGGATGATCCAGGTGAAAGA
	R:GAGGGCTTCCTGGAGGACAAGA
rs238406	F:GGACAAGAGTGCCAGGGGTCAG	SR:TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTCAGCCTGCCCCACTGCCG
	R:GGCGCAGTACCAGCATGACAC

Clinical characteristics (cases)	Patients group 226	Control group 263	χ² value	p
Age (years old)			0.146	0.986
≤ 49	32	39
50~59	40	49
60~69	76	87
≥ 70	78	88
Sex			1.335	0.248
Male	138	147
Female	88	116
Alcohol consumption			3.120	0.077
Yes	94	89
No	132	174
Diabetes history			1.672	0.196
Yes	51	47
No	175	216
BMI(kg/m²)			3.198	0.362
< 18.5	64	59
18.5~23.9	83	97
24~27.9	47	69
≥ 28	32	38
Family history of cancer			1.732	0.188
Yes	31	26
No	195	237

Smoking	Patients group (cases)	Control group (cases)	OR	95% CI		χ ²	p
Smoking	Patients group (cases)	Control group (cases)	OR	Lower limit	Upper limit	χ ²	p
Smoking
No	126	167	1.00
Yes	100	96	1.381	0.960	1.985	3.037	0.081
Amount of cigarettes a day
0 (no smoking)	126	167	1.00
≤ 9	15	16	1.243	0.592	2.608	0.331	0.565
10~19	27	31	1.154	0.656	2.032	0.248	0.619
≥ 20	58	49	1.569	1.005	2.448	3.960	0.047
Total (packs per year)
0 (no smoking)	126	167	1.00
< 14	16	37	0.573	0.305	1.077	3.046	0.081
14~23.9	36	27	1.767	1.020	3.063	4.180	0.041
24~36.9	28	20	1.856	1.000	3.445	3.914	0.048
≥ 37	20	12	2.209	1.041	4.686	4.432	0.035

SNP ID	Chromosome position	location	Base change	MAF		HWE p		p
SNP ID	Chromosome position	location	Base change	case	control	case	control	p
rs13181	45854919	Extron23	A/C	0.32301	0.24144	0.521	0.745	0.005
rs3916874	45856926	Intron17	G/C	0.13496	0.16160	0.662	0.355	0.244
rs238415	45857235	Intron17	C/G	0.35840	0.34791	0.189	0.113	0.732
rs50872	45862449	Intron12	C/T	0.15708	0.19962	0.999	0.607	0.084
rs50871	45862515	Intron12	T/G	0.29203	0.29658	0.974	0.588	0.877
rs238406	45868309	Extron6	C/A	0.32079	0.32889	0.162	0.251	0.787

SNP	Genotype	Case	Control	OR (95%CI)	p	OR (95%CI) ^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.	p ^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.
rs13181	AA	118	167	1.00(reference)
	AC	70	65	1.524(1.010~2.301)	0.044	1.535(1.015-2.320)	0.042
	CC	38	31	1.735(1.021~2.946)	0.040	1.707(1.003-2.903)	0.049
	AC+CC	108	96	1.592(1.108~2.287)	0.012	1.596(1.109-2.298)	0.012
rs3916874	GG	167	181	1.00(reference)
	GC	57	79	0.782(0.524-1.167)	0.228	0.778(0.520-1.165)	0.223
	CC	2	3	0.723(0.119-4.378)	0.723	0.782(0.127-4.826)	0.791
	GC+CC	59	82	0.780(0.525-1.158)	0.217	0.781(0.524-1.163)	0.223
rs238415	CC	102	123	1.00(reference)
	CG	86	97	1.069(0.723-1.581)	0.738	1.504(1.017-2.224)	0.056
	GG	38	43	1.066(0.640-1.773)	0.807	1.303(0.772-2.198)	0.322
	CG+GG	124	140	1.068(0.748-1.526)	0.718	1.444(1.004-2.076)	0.051
rs50872	CC	161	172	1.00(reference)
	CT	59	77	0.819(0.548-1.223)	0.328	0.823(0.550-1.232)	0.344
	TT	6	14	0.458(0.172-1.220)	0.110	0.677(0.414-1.105)	0.118
	CT+TT	65	91	0.763(0.520-1.120)	0.167	0.766(0.521-1.126)	0.175
rs50871	TT	112	135	1.00(reference)
	TG	96	100	1.157(0.795-1.685)	0.446	1.139(0.781-1.661)	0.500
	GG	18	28	0.775(0.407-1.474)	0.436	0.904(0.653-1.251)	0.542
	TG+GG	114	128	1.074(0.752-1.532)	0.696	1.065(0.745-1.522)	0.731
rs238406	CC	113	128	1.00(reference)
	CA	81	97	0.946(0.641-1.395)	0.779	0.934(0.630-1.384)	0.733
	AA	32	38	0.954(0.559-1.627)	0.812	0.979(0.568-1.689)	0.940
	CA+AA	113	135	0.948(0.664-1.353)	0.769	0.945(0.660-1.354)	0.759

Haplotype	Case (%)	Control (%)	OR (95%CI)	p
AGG	0.479	0.402	1.401(1.065~1.844)	0.016
AGC	0.261	0.304	0.824(0.610~1.114)	0.209
ACC	0.140	0.165	0.838(0.574~1.222)	0.357
CGC	0.103	0.125	0.816(0.532~1.251)	0.350

Genotype	Cigarettes a day	Patients group (cases)	Control group (cases)	OR (95%CI)^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.	p ^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.
AA	0 (no smoking)	64	99	1.000
	≤ 9	6	11	0.855(0.305~2.413)	0.738
	10~19	14	19	1.126(0.539~2.463)	0.729
	≥ 20	34	38	1.371(0.783~2.418)	0.266
AC + CC	0 (no smoking)	62	68	1.384(0.896~2.259)	0.150
	≤ 9	9	5	2.772(0.904~8.695)	0.071
	10~19	13	12	1.656(0.732~3.923)	0.237
	≥ 20	24	11	3.343(1.567~7.472)	0.002

Genotype	Total cigarettes (packs per year)	Patients group (cases)	Control group (cases)	OR (95%CI)^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.	p ^† † P-value was calculated by unconditional logistic regression analysis adjusted for age and sex.
AA	0 (no smoking)	64	99	1.000
	<14	6	23	0.392(0.147~1.062)	0.061
	14~23.9	21	20	1.620(0.809~3.178)	0.171
	24~36.9	15	16	1.424(0.665~3.122)	0.352
	≥ 37	12	9	2.071(0.867~5.181)	0.124
AC + CC	0 (no smoking)	62	68	1.431(0.987~2.256)	0.152
	<14	10	14	1.116(0.506~2.729)	0.857
	14~23.9	15	7	3.309(1.286~8.547)	0.015
	24~36.9	13	4	5.011(1.549~16.181)	0.010
	≥ 37	8	3	4.013(1.007~15.974)	0.032

Sociedade Brasileira de Genética Rua Cap. Adelmio Norberto da Silva, 736, 14025-670 Ribeirão Preto SP Brazil, Tel.: (55 16) 3911-4130 / Fax.: (55 16) 3621-3552 - Ribeirão Preto - SP - Brazil
E-mail: editor@gmb.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Send correspondence to Xi-Yan Wang. Department of Xinjiang Research Institute of Cancer Prevention and Control, Affiliated Tumor Hospital of Xinjiang Medical University, No. 789 of Suzhou East Street, New Urban District, Urumqi 830011, Xinjiang, China. E-mail: wangxy25641@sina.com