Milk-deteriorating exoenzymes from <i>Pseudomonas fluorescens</i> 041 isolated from refrigerated raw milk

Martins, Maurilio L.; Pinto, Uelinton M.; Riedel, Katharina; Vanetti, Maria C.D.

doi:10.1590/S1517-838246120130859

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Microbiology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Food Microbiology • Braz. J. Microbiol. 46 (1) • Jan-Mar 2015 • https://doi.org/10.1590/S1517-838246120130859 copy

Milk-deteriorating exoenzymes from Pseudomonas fluorescens 041 isolated from refrigerated raw milk

Authorship SCIMAGO INSTITUTIONS RANKINGS

The practice of refrigerating raw milk at the farm has provided a selective advantage for psychrotrophic bacteria that produce heat-stable proteases and lipases causing severe quality problems to the dairy industry. In this work, a protease (AprX) and a lipase (LipM) produced by Pseudomonas fluorescens 041, a highly proteolytic and lipolytic strain isolated from raw milk obtained from a Brazilian farm, have been purified and characterized. Both enzymes were purified as recombinant proteins from Escherichia coli. The AprX metalloprotease exhibited activity in a broad temperature range, including refrigeration, with a maximum activity at 37 °C. It was active in a pH range of 4.0 to 9.0. This protease had maximum activity with the substrates casein and gelatin in the presence of Ca⁺². The LipM lipase had a maximum activity at 25 °C and a broad pH optimum ranging from 7.0 to 10. It exhibited the highest activity, in the presence of Ca⁺², on substrates with long-chain fatty acid residues. These results confirm the spoilage potential of strain 041 in milk due to, at least in part, these two enzymes. The work highlights the importance of studies of this kind with strains isolated in Brazil, which has a recent history on the implementation of the cold chain at the dairy farm.

raw milk; food deterioration; Pseudomonas fluorescens ; extracellular protease; extracellular lipase

Strain or plasmid	Description	Reference or source
Strains
E. coli XL1-Blue	Cloning and subcloning host supE44, hsdR17, endA1, recA1, gyrA96, thi1, relA1, lac-F[proAB+, lacIq, lacZ-M15, Tn10 (tetF)]	Bullock et al., 1987Bullock WO, Fernandez JM, Short, JM (1987) XL-1 Blue: a high efficiency plasmid transforming recA Escherichia coli strain with β-galactosidase selection. Bio Techniques 5:376–377.
P. fluorescens07A	Wild type	*Martins et al., 2005*Martins ML et al. (2005) Detection of the apr gene in proteolytic psychrotrophic bacteria isolated from refrigerated raw milk. Int J Food Microbiol 102:203–211.
P. fluorescens041	Wild type	*Martins et al., 2005*Martins ML et al. (2005) Detection of the apr gene in proteolytic psychrotrophic bacteria isolated from refrigerated raw milk. Int J Food Microbiol 102:203–211.
Plasmids
pCR2.1-TOPO	Cloning vector, lacZα fragment containing MCS, f1 origin, ColE1, Km^r Ap^r	Invitrogen
pQE30-Xa	Vector for the insertion of a Factor Xa Protease recognition site C-terminal of the 6xHis tag, T5 promoter, lac operator, ribosome binding site, ATG start codon, His tag sequence, multiple cloning sites, stop codons in all three reading frames, Col E1 origin of replication, Ap^r	Qiagen
pQE30-Xa-aprX041	1.43 kb fragment containing aprX from P. fluorescens041 in pQE30-Xa, Ap^r	This study
pQE30-Xa-lipM041	1.42 kb fragment containing lipM from P. fluorescens041 in pQE30-Xa, Ap^r	This study

Primer	Sequence (5′-3′)	Aplication
Apr-F	TTATGTCAAAAGTAAAAGAC	Amplification of aprX gene
Apr-R	TCAGGCTACGATGTCACTG	Amplification of aprX gene
APRX-F	ATTGGATCCAAAGCTATTGTATCTGCCGCG	Amplification of aprX gene and preparation for cloning in pQE-30Xa
APRX-R	ATTGAGCTCTCAGGCTACGATGTCACTGGC	Amplification of aprX gene and preparation for cloning in pQE-30Xa
Lip-F	ATGGGTRTSTTYGACTATAAAAACC	Amplification of lipM gene
Lip-R	TTAACCGATCACAATCCCCTCC	Amplification of lipM gene
LIPM-F	ATTGGATCCAACCTCGGTACCGAGGACTC	Amplification of lipM gene and preparation for cloning in pQE-30Xa
LIPM-R	ATTGAGCTCTTAACCGATCACAATCCCCTCCC	Amplification of lipM gene and preparation for cloning in pQE-30Xa

Metal ion	Relative activity (%)

	Alkaline metalloprotease^a a A reaction mixture containing 250 μL of 2% (w/v) azocasein in 50 mM Tris/HCl (pH 8.0), 75 μL of AprX, and 1 mM of each metal ion was incubated at 37 °C for 12 h. The remaining activity was then measured, as described in the text. Results show the mean value (n = 3) plus or minus the standard deviation.	Lipase^b b A reaction mixture containing 1 mL of substrate (one volume of 0.3% (w/v) p-nitrophenyl palmitate in isopropanol and nine volumes 0.2% (w/v) sodium desoxycholate and 0.1% (w/v) gummi arabicum in 50 mM sodium phosphate buffer, pH 8.0), 50 μL of LipM, and 1 mM of each metal ions was incubated at 25 °C for 20 min. The remaining activity was then measured, as described in the text. Results show the mean value (n = 3) plus or minus the standard deviation.
None	100 ± 2	100 ± 2
Mn²⁺	73 ± 1	61 ± 1
Co²⁺	48 ± 3	59 ± 8
Zn²⁺	86 ± 3	49 ± 0
Fe²⁺	90 ± 5	48 ± 3
Fe³⁺	102 ± 1	65 ± 2
Mg²⁺	100 ± 1	50 ± 3

Compound	Relative activity (%)^c c Results show the mean value (n = 3) plus or minus the standard deviation.
Inhibitor^a a A reaction mixture containing 250 μL of 2% (w/v) azocasein in 50 mM Tris/HCl (pH 8.0), 75 μL of AprX, and 1 mM of each inhibitor was incubated at 37 °C for 12 h. The remaining activity was then measured, as described in the text.
None	100 ± 1
PMSF	95 ± 2
EDTA	51 ± 3
Pefabloc SC	89 ± 1
Denaturing and reducing agent^b b A reaction mixture containing 250 μL of 2% (w/v) azocasein in 50 mM Tris/HCl (pH 8.0), 75 μL of AprX, and 2% (w/v) SDS, 4 M urea, 0.1% (w/v) DTT, or 0.1% (v/v) β-mercaptoethanol in 50 mM Tris/HCl (pH 8.0) was incubated at 37 °C for 12 h. The remaining activity was then measured, as described in the text.
None	100 ± 2
SDS	6 ± 1
Urea	38 ± 5
DTT	24 ± 3
β-mercaptoethanol	44 ± 2

Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
E-mail: bjm@sbmicrobiologia.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] Send correspondence to M.C.D. Vanetti. Departamento de Microbiologia, Universidade Federal de Viçosa, 36570-000 Viçosa, MG, Brazil. E-mail: mvanetti@ufv.br.