Hematological changes associated with hemoplasma infection in cats in Rio de Janeiro, Brazil

Raimundo, Juliana Macedo; Guimarães, Andresa; Rodrigues, Raisa Braul; Botelho, Camila Flávia Magalhães; Peixoto, Maristela Peckel; Pires, Marcus Sandes; Machado, Carlos Henrique; Santos, Huarrisson Azevedo; Massard, Carlos Luiz; André, Marcos Rogério; Machado, Rosangela Zacarias; Baldani, Cristiane Divan

doi:10.1590/S1984-29612016086

Acessibilidade / Reportar erro

Brasil

Revista Brasileira de Parasitologia Veterinária

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Original Article • Rev. Bras. Parasitol. Vet. 25 (04) • Oct-Dec 2016 • https://doi.org/10.1590/S1984-29612016086 copy

Hematological changes associated with hemoplasma infection in cats in Rio de Janeiro, Brazil

Alterações hematológicas associadas à infecção por hemoplasmas em gatos do Rio de Janeiro, Brasil

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

This study aimed to detect Mycoplasma spp. in naturally infected cats from Rio de Janeiro and to evaluate hematological abnormalities and factors associated with this infection. Out of the 197 cats sampled, 11.2% presented structures compatible with hemoplasma organisms on blood smears. In contrast, 22.8% were positive for Mycoplasma spp. by means of 16S rRNA gene real-time polymerase chain reaction, which reflects the weak concordance between techniques. The infection rates, by means of 16S rRNA gene conventional polymerase chain reaction, was 4.6%, 4.6% and 11.7% for Mycoplasma haemofelis (Mhf), ‘Candidatus Mycoplasma turicensis’ (CMt) and ‘Candidatus Mycoplasma haemominutum’ (CMhm), respectively. Mhf and CMhm infections are more frequent in the summer (p>0.05). Presence of anemia (p < 0.02), lymphocytosis (p < 0.03), thrombocytopenia (p < 0.04) and activated monocytes (p < 0.04) was associated with Mhf infection. No hematological abnormality was associated with CMt or CMhm infection. Male cats were more prone to be infected by Mhf or CMhm (p < 0.01). Adult cats had more chance to be infected by CMhm. Three hemoplasma species occur in the metropolitan region of Rio de Janeiro and Mhf seems to be the most pathogenic of them. Anemia is the most important hematological abnormality.

Keywords:
Mycoplasma spp.; real-time PCR; hematology; associated factors

Real-time PCR Primer	Sequence (5’-3’)	Tm
Mycoplasma spp. Myco-F Myco-R	ACGAAAGTCTGATGGAGCAATA ACGCCCAATAAATCCGRATAAT	77.1
Conventional PCR Primers	Sequence (5’-3’)	bp
Mhf Hfelis-fl Hfelis-r3	GACT TTGGTTTCGGCCAAGG CGAAGTACTATCATAATTATCCCTC	393
CMhm Cali-F1 Cali-R1	GCATAATGTGTCGCAATC GTTTCAACTAGTACTTTCTCCC	192
CMt Mt-Fw Mt2-Rv	GTATCCTCCATCAGACAGAA CGCTCCATATTTAATTCCAA	488

Parameter	Result	*Mycoplasma haemofelis*				*‘Candidatus M. haemominutum’*				*‘Candidatus M. turicensis’*				Reference ^* * Jain (1993);
Parameter	Result	Mean	DP	EP	p-value	Mean	DP	EP	p-valor	Mean	DP	EP	p-value	Reference ^* * Jain (1993);
RBC (10⁶/µl)	Positive	4.4^a	2.7	0.9	0.005	6.7^a	2.2	0.5	0.669	6.3^a	1.8	0.6	0.318	5.0-10.0
RBC (10⁶/µl)	Negative	7.1^b	2.2	0.2	0.005	6.9^a	2.3	0.2	0.669	6.9^a	2.3	0.2	0.318	5.0-10.0
Hematocrit (%)	Positive	23.5^a	12.0	4.0	0.017	33.6^a	9.9	2.1	0.825	32.2^a	9.1	3.0	0.624	24-45
Hematocrit (%)	Negative	33.9^b	10.3	0.7	0.017	33.5^a	10.7	0.8	0.825	33.6^a	10.6	0.8	0.624	24-45
Hemoglobin (g/dl)	Positive	7.2^a	3.7	1.2	0.004	10.9^a	3.3	0.7	0.981	10.4^a	2.8	0.9	0.488	8.0-15.0
Hemoglobin (g/dl)	Negative	11.2^b	3.3	0.2	0.004	11.0^a	3.5	0.3	0.981	11.0^a	3.5	0.3	0.488	8.0-15.0
MCV (fL)	Positive	57.1^a	14.4	4.8	0.080	50.9^a	5.5	1.1	0.161	50.3^a	5.8	1.9	0.416	39-55
MCV (fL)	Negative	48.9^a	3.7	0.3	0.080	49.0^a	4.9	0.4	0.161	49.2^a	4.9	0.4	0.416	39-55
MCHC (%)	Positive	30.7^a	2.1	0.7	0.002	32.5^a	1.7	0.4	0.704	32.6^a	1.7	0.6	0.969	31-35
MCHC (%)	Negative	32.9^b	1.3	0.1	0.002	32.8^a	1.3	0.1	0.704	32.8^a	1.4	0.1	0.969	31-35
Platelet (10³/µl)	Positive	286^a	427	142	0.038	434^a	421	88	0.988	294^a	138	46	0.827	300-900
Platelet (10³/µl)	Negative	399^b	306	22	0.038	388^a	296	22	0.988	398^a	318	23	0.827	300-900
TPP (g/dl)	Positive	6.9^a	1.2	0.4	0.192	7.7^a	1.2	0.3	0.290	7.2^a	0.6	0.2	0.215	6-7.5^ Krimer (2011).
TPP (g/dl)	Negative	7.6^a	1.1	0.1	0.192	7.5^a	1.1	0.1	0.290	7.5^a	1.1	0.1	0.215	6-7.5^ Krimer (2011).
WBC (10³/µl)	Positive	21.81^a	10.66	3.55	0.267	18.13^a	13.90	2.90	0.619	15.41^a	7.04	2.35	0.540	5.5-19.5
WBC (10³/µl)	Negative	18.75^a	12.63	0.92	0.267	18.99^a	12.39	0.94	0.619	19.06^a	12.73	0.91	0.540	5.5-19.5
Band neutrophils (10³/µl)	Positive	1.09^a	1.21	0.40	0.092	0.58^a	0.98	0.20	0.257	0.53^a	0.81	0.27	0.548	0-3
Band neutrophils (10³/µl)	Negative	0.64^a	0.93	0.07	0.092	0.67^a	0.95	0.07	0.257	0.67^a	0.96	0.07	0.548	0-3
Segmented neutrophils (10³/µl)	Positive	10.59^a	5.87	1.96	0.711	11.85^a	10.58	2.21	0.567	9.09^a	4.83	1.61	0.315	2.5-12.5
Segmented neutrophils (10³/µl)	Negative	12.05^a	8.21	0.6	0.711	12.01^a	7.77	0.59	0.567	12.13^a	8.22	0.60	0.315	2.5-12.5
Lymphocytes (10³/µl)	Positive	7.21^a	5.05	1.68	0.029	4.00^a	2.67	0.56	0.739	4.06^a	2.42	0.81	0.720	1.5-7.0
Lymphocytes (10³/µl)	Negative	4.39^b	7.32	0.53	0.029	4.59^a	7.65	0.58	0.739	4.54^a	7.40	0.54	0.720	1.5-7.0
Monocytes (10³/µl)	Positive	1.73^a	2.38	0.79	0.132	0.85^a	0.61	0.13	0.904	0.94^a	0.73	0.24	0.747	0-0.85
Monocytes (10³/µl)	Negative	0.84^a	0.61	0.04	0.132	0.88^a	0.81	0.06	0.904	0.88^a	0.79	0.06	0.747	0-0.85
Eosinophils (10³/µl)	Positive	1.19^a	2.06	0.69	0.988	0.85^a	1.95	0.41	0.286	0.79^a	0.68	0.23	0.316	0-1.5
Eosinophils (10³/µl)	Negative	0.81^a	1.22	0.09	0.988	0.82^a	1.15	0.09	0.286	0.83^a	1.29	0.09	0.316	0-1.5
Basophils (10³/µl)	Positive	0.00^a	0.00	0.00	0.893	0.01^a	0.03	0.01	0.879	0.00^a	0.00	0.00	0.893	Raros
Basophils (10³/µl)	Negative	0.01^a	0.11	0.01	0.893	0.01^a	0.12	0.01	0.879	0.01^a	0.11	0.01	0.893	Raros

Hematological change		Mycoplasma haemofelis n(%)		p-value
Hematological change		Positive (n=9)	Negative (n=188)	p-value
Anemia (RBC Ht Hg)	Yes	6 (16.2)^a	31 (83.8)	0.0017
Anemia (RBC Ht Hg)	No	3 (1.9)^b	157 (98.1)
Thrombocytopenia	Yes	8 (7.8)^a	95 (92.2)	0.0365
Thrombocytopenia	No	1 (1.1)^b	93 (98.9)	0.0365
Lymphocytosis	Yes	4 (14.8)^a	23 (85.2)	0.0220
Lymphocytosis	No	5 (2.9)^b	165 (97.1)	0.0220
Monocytosis	Yes	5 (6.0)^a	79 (94.0)	0.5000
Monocytosis	No	4 (3.5)^a	109 (96.5)	0.5000
MAM	Yes No	5 (11.1)^a 4 (2.6)^b	40 (88.9) 148 (97.4)	0.0306

	Cats (n)	Positive cats n/(%)	p-valor	Odds Ratio	95% CI
*M. haemofelis*
Age ≤ 6 months > 6 months	29 168	0 (0.0)^a 9 (5.4)^a	0.3613	- -	-
Gender Female Male	108 89	0 (0.0)^a 9 (10.1)^b	0.0006	- -	-
Breed Mixed breed Pure breed Season Winter Spring Summer Fall	173 24 18 104 39 36	7 (4.0)^a 2 (8.3)^a 1 (5.6)^a 3 (2.9)^a 3 (7.7)^a 2 (5.6)^a	0.2997 0.4665 0.3451 0.6021	1 2.15 1.98 1 2.08 1.98	0.42-11.04 0.19-20.17 - 0.54-14.53 0.31-12.35
‘C.M. haemominutum’
Age ≤ 6 months > 6 months	29 168	1 (3.4)^a 22 (13.1)^a	0.2097	1 4.22	0.55-35.6
Gender Female Male	108 89	6 (5.6)^a 17 (19.1)^b	0.0065	1 4.01	1.51-10.68
Breed Mixed breed Pure breed Season Winter Spring Summer Fall	173 24 18 104 39 36	19 (11.0)^a 4 (16.7)^a 0 (0.0)^a 11 (10.6)^a 7 (17.9)^a 5 (13.9)^a	0.4930 0.2159 0.0850 0.1567	1 1.62 - 1 1.84 1.36	0.50-5.25 0.66-5.17 0.44-4.23
‘C. M. turicensis’
Age ≤ 6 months > 6 months	29 168	2 (6.9)^a 6 (4.2)^a	0.6192	1.70 1	0.34-8.64
Gender Female Male	108 89	3 (2.8)^a 6 (6.7)^a	0.3041	1 2.53	0.61-10.42
Breed Mixed breed Pure breed Season Winter Spring Summer Fall	173 24 18 104 39 36	8 (4.6)^a 1 (4.2)^a 1 (5.6)^a 5 (4.8)^a 2 (5.1)^a 1 (2.8)^a	1.0000 1.000 1.000 1.000	1.13 1 2.05 1.76 1.89 1	0.13-9.33 - 0.20-15.66 -

Colégio Brasileiro de Parasitologia Veterinária FCAV/UNESP - Departamento de Patologia Veterinária, Via de acesso Prof. Paulo Donato Castellane s/n, Zona Rural, , 14884-900 Jaboticabal - SP, Brasil, Fone: (16) 3209-7100 RAMAL 7934 - Jaboticabal - SP - Brazil
E-mail: cbpv_rbpv.fcav@unesp.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author: Cristiane Divan Baldani. Laboratório de Patologia Clínica Veterinária, Departamento de Medicina e Cirurgia Veterinária, Instituto de Veterinária, Universidade Federal Rural do Rio de Janeiro – UFRRJ, BR 465, Km 47, CEP 23890-000, Seropédica, RJ, Brasil. e-mail: crisbaldani@ufrrj.br