Gene expression during the germination of coffee seed

Germination of the coffee (Coffea arabica L.) seed is the result of events that occur simultaneously in the embryo and endosperm. To understand the molecular mechanisms responsible for these events, we undertook a transcriptome analysis of embryo, micropylar and lateral endosperms from 10-day-imbibed seeds. The sequencing yielded contigs coding for 16,813 proteins. From those, 14,005 (~ 83%) were highly similar to at least one protein sequence in the nr database. 162 genes were significantly expressed in the embryo, 36 in the micropylar endosperm and 72 in the lateral endosperm. The tissue specificity analysis of the significantly expressed genes showed that the embryo had the highest proportion of specific genes (113/162, ~70%), while 11 were expressed in the micropylar and lateral endosperms. In the embryo, genes were mainly associated with abiotic stress, cell growth, and intercellular communication. In the micropylar and lateral endosperms, they were associated with abiotic stress and cell wall degradation. The accuracy of RNA-seq data was confirmed by RT-qPCR. This work adds new information about the molecular mechanism involved in coffee seed germination.

Index terms:
RNA-seq; embryo; micropylar endosperm; lateral endosperm; Coffea arabica

Authorship

Edvaldo Aparecido Amaral da Silva ^**Corresponding author: <amaral.silva@unesp.br>

Departamento de Produção e Melhoramento Vegetal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista, 18610-307 - Botucatu, SP, Brasil.Universidade Estadual PaulistaBrazilBotucatu, SP, BrazilDepartamento de Produção e Melhoramento Vegetal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista, 18610-307 - Botucatu, SP, Brasil.

Marcio Luis Acencio

Department of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, 8905N-7491 - Trondheim, Norway.Norwegian University of Science and TechnologyNorwayTrondheim, NorwayDepartment of Cancer Research and Molecular Medicine, Norwegian University of Science and Technology, 8905N-7491 - Trondheim, Norway.

Luiz Augusto Bovolenta

Departamento de Física e Biofísica, Instituto de Biociências de Botucatu, Universidade Estadual Paulista, 18618-970 - Botucatu, SP, Brasil.Universidade Estadual PaulistaBrazilBotucatu, SP, BrazilDepartamento de Física e Biofísica, Instituto de Biociências de Botucatu, Universidade Estadual Paulista, 18618-970 - Botucatu, SP, Brasil.

Ney Lemke

Alessandro de Mello Varani

Departamento de Tecnologia, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, 14884-900 - Jaboticabal, SP, Brasil.Universidade Estadual PaulistaBrazilJaboticabal, SP, BrazilDepartamento de Tecnologia, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, 14884-900 - Jaboticabal, SP, Brasil.

http://orcid.org/0000-0002-8876-3269

Juliana Pereira Bravo

http://orcid.org/0000-0002-5418-2423

Andrea Akemi Hoshino-Bezerra

http://orcid.org/0000-0002-6029-1925

Eliana Gertrudes Macedo Lemos

*Corresponding author: <amaral.silva@unesp.br>

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (6)
Tables (2)

Thumbnail

Figure 1
A. Coffee seed with indication of the micropylar (ME) and lateral endosperms (LE). B. Embryo, with indication of the cotyledons (C), axis (H) and radicle (R). C. Germinated seed (radicle protrusion).

Thumbnail

Figure 2
Relative expression of genes identified by RNA-seq in the embryo and the micropylar and lateral endosperms of coffee seeds. A. Indole-3 acetic acid-induced protein 4. B. Indole-3 acetic acid-induced protein 9. C. α-tubulin. D. Actin 7. E. Glyceraldehyde3-phosphate. F. Fructose-bisphosphate-aldolase. (G). Heat Shock Protein (Hsp40). H. Catalase 3. I. Endo-β-mannanase. J. β-mannosidase. Error bars indicate standard deviation.

Thumbnail

Figure 3
GO terms significantly enriched in the most abundant genes (hiClu) from the embryo. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Thumbnail

Figure 4
GO terms significantly enriched in the most abundant genes (hiClu) from the micropylar endosperm. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Thumbnail

Figure 5
GO terms significantly enriched in the most abundant genes (hiClu) from the lateral endosperm. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Thumbnail

Figure 6
Venn diagram of hiClu genes in the samples. The embryo showed the highest number and proportion of specific genes (113/192, ~59%). The micropylar and lateral endosperm had 11 (~6%) hiClu genes expressed, and eighteen genes (~9%) were expressed in all three tissues.

Thumbnail

Table 1
Primers sequences of genes from embryo and micropylar and lateral endosperms of coffee seed used to perform RT-qPCR to validate the RNA-seq data.

Thumbnail

Table 2
Genes specifically expressed in the embryo and micropylar and lateral endosperms of coffee seeds during germination.

Figure 1 A. Coffee seed with indication of the micropylar (ME) and lateral endosperms (LE). B. Embryo, with indication of the cotyledons (C), axis (H) and radicle (R). C. Germinated seed (radicle protrusion).

Figure 2 Relative expression of genes identified by RNA-seq in the embryo and the micropylar and lateral endosperms of coffee seeds. A. Indole-3 acetic acid-induced protein 4. B. Indole-3 acetic acid-induced protein 9. C. α-tubulin. D. Actin 7. E. Glyceraldehyde3-phosphate. F. Fructose-bisphosphate-aldolase. (G). Heat Shock Protein (Hsp40). H. Catalase 3. I. Endo-β-mannanase. J. β-mannosidase. Error bars indicate standard deviation.

Figure 3 GO terms significantly enriched in the most abundant genes (hiClu) from the embryo. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Figure 4 GO terms significantly enriched in the most abundant genes (hiClu) from the micropylar endosperm. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Figure 5 GO terms significantly enriched in the most abundant genes (hiClu) from the lateral endosperm. We carried out a log-transformation so that the smallest p-values are paired with the highest values. The terms with the larger bars are those with the lowest p-values and, consequently, they are the most significantly enriched terms. Bars marked with asterisks indicate GO terms uniquely enriched in this tissue.

Figure 6 Venn diagram of hiClu genes in the samples. The embryo showed the highest number and proportion of specific genes (113/192, ~59%). The micropylar and lateral endosperm had 11 (~6%) hiClu genes expressed, and eighteen genes (~9%) were expressed in all three tissues.

Table 1 Primers sequences of genes from embryo and micropylar and lateral endosperms of coffee seed used to perform RT-qPCR to validate the RNA-seq data.

Gene ID	Gene name	Primer Forward (5’-3’)	Primer Reverse (5’-3’)
2890	Indole-3-acetic acid induced protein 4	AACTAGTCACCGTTGCTTCAT	ATTACACCTTAGGCTTCATGGA
8606	Indole-3-acetic acid induced protein 9	ATTGTCTGAGTGTTCATCGGT	GGCAAAGTTCTGAATCCCTC
3078	α-Tubulin	AGAGGGCATTATACAGTCGG	CCAATCCAGAACCAGTACCA
898	Actin 7	TGCCATCAAGAATCACCCTG	TGACTCACACCATCTCCAGA
396	Glyceraldehyde 3-phosfate dehydrogenase	TTTGGAATCAGGAATCCCGAA	AGCCTTGTCCTTGTCTGTAAA
475	Fructose bisphosfate aldolase	TTGTGGATGTGTTGAAGGAGG	TCTCACCATTAGTGCCAGGA
698	Heat Shock Protein Hsp40	TGCCATCAAGAATCACCCTG	CCACCCATTCCTTCCTTCAAT
1023	Catalase 3	AAGGTACGATCCTGTTCGTC	GTTGCTTGAAGTTGTTCTCCTT
104	Endo-β-mannanase	AGGATTTGTTAGGACTCAGGG	GACACTTTATGCCTCTCGCTA
3111	β-mannosidase	GACGAGTACCACAGATACAAGA	TTCCAATTTACTTTCCCAGTTCC

Table 2 Genes specifically expressed in the embryo and micropylar and lateral endosperms of coffee seeds during germination.

Gene ID	Gene name	Gene ID	Gene name
Specifically expressed in embryos
2	60S ribosomal protein l31-like	2280	60S ribosomal protein l30
20	Adenosylhomocysteinase	2281	Polyadenylate-binding protein 2-like
80	60S ribosomal protein l28-1-like isoform 1	2300	Methionine aminopeptidase 2b
85	Polyadenylate-binding protein 2-like	2360	60S ribosomal protein l5-like
137	Eukaryotic initiation factor 4a-2-like	2397	Pectin methylesterase
174	S-adenosylmethionine synthase 1-like isoform 1	2432	Pyrophosphate--fructose 6-phosphate 1-phosphotransferase subunit alpha-like
205	Elongation factor 2-like	2575	40S ribosomal protein
229	Elongation factor 1-	2649	Heat shock protein 70
232	Bag family molecular chaperone regulator 7-like	2660	Serine arginine rich splicing isoform 1
345	Small nuclear ribonucleoprotein sm d3-like	2702	60S ribosomal protein l15-like
369	Ubiquitin-like protein	2743	Glucose-1-phosphate adenylyltransferase large subunit 1-like
371	Polyadenylate-binding protein 2-like	2890	Indole-3-acetic acid induced protein 4
453	Desacetoxyvindoline 4-	2947	RNA-binding protein 39-like
502	60S acidic ribosomal protein p0	2996	Pollen-specific protein c13-like
535	Burp domain protein	3038	60S ribosomal protein l23a-like
565	60S ribosomal protein l3-like	3078	Α-tubulin
568	40S ribosomal protein s5	3267	Ubiquitin-like partial
604	Probable phosphatidylinositol 4-kinase type 2-beta at1g26270-like	3296	Cysteine protease 1 precursor
610	40S ribosomal protein sa-like	3323	Alba DNA RNA-binding protein
639	Ubiquitin-like protein	3510	Vesicle-associated membrane protein 726-like
673	60S ribosomal protein l21	3542	Elongation factor 1-delta-like
690	U1 small nuclear ribonucleoprotein 70 kda-like	3726	40S ribosomal protein S9-2-like
691	Polyadenylate-binding protein rbp47-like	4054	Cathepsin b-like
784	Atp binding	4096	40S ribosomal protein
820	Hydroxyproline-rich glycoprotein	4131	Tonoplast intrinsic protein
826	Calreticulin	4445	40S ribosomal protein S15-like isoform 1
903	60S ribosomal protein l10a-1-like	4522	Pyruvate cytosolic isozyme-like
914	Nep1-interacting protein 2-like	4734	Actin-depolymerizing factor 2-like
949	Signal recognition particle 68 kda	4778	40S ribosomal protein s5-1-like
976	Calmodulin	4863	60S ribosomal protein l44-like
995	Dehydrin	4941	Gtp-binding protein sar1a-like
1015	Elongation factor 1- partial	5256	Polyadenylate-binding protein rbp45-like
1131	Enolase	5513	Serine mitochondrial-like
1151	Cbs domain protein	5840	Mlp-like protein 423-like
1176	Heat shock	6138	60s ribosomal protein l27a-3-like
1217	40S ribosomal protein s8	6674	Transcription factor bhlh63-like
1252	Pyruvate cytosolic isozyme-like	7048	Oleosin kda-like
1312	40S ribosomal protein S13-like	7450	Burp domain-containing protein
1319	Ac012654_15est gb	7525	Cation exchanger 1
1346	40S ribosomal protein S23-like	7549	Serine acetyltransferase 5-like
1427	40S ribosomal protein S11	7583	60S ribosomal protein l18a-like
1434	Cyclin-dependent kinase g-2-like	7823	P-loop containing nucleoside triphosphate hydrolases superfamily protein
1528	Pointed first leaf	7912	Dehydrin-like protein
1562	40S ribosomal protein S4-like	8033	60S ribosomal protein l34-like
1578	Carrier protein mitochondrial-like	8579	Pyrophosphate--fructose 6-phosphate 1-phosphotransferase subunit alpha-like
1596	Protein-protein interaction regulator family	8606	Indole-3-acetic acid induced protein 9
1693	Inositol transporter 1	8891	Galactose oxidase kelch repeat superfamily protein isoform partial
1711	Probable aquaporin pip-type 7a-like	10672	Chaperone protein dnaj 20
1726	Protein disulfide-isomerase-like	10711	Rop4 small gtp binding protein
1787	Heat shock protein 90	12711	Ent-kaurene oxidase
1819	Aspartate aminotransferase	14259	Ferritin 2
1834	Ubiquitin-conjugating enzyme e2 7-like	14595	Serine carboxypeptidase-like 18-like
1945	RNA-binding protein 39-like	14935	40S ribosomal protein S14
2037	Ubiquitin-like partial	16395	Osmotin-like protein
2038	Ubiquitin-like partial	19893	Thaumation-like
2074	Hyaluronan mrna binding family isoform 1	42855	Protodermal factor
2266	Tubulin alpha chain-like
Expressed in micropylar and lateral endosperms
29	BURP domain-containing protein	292	Thaumation-like protein
32	Nonspecific lipid-transfer protein	376	Glutathione s-transferase t1-like
70	β-glucosidase 44-like	1238	MLP-like protein 28
104	Endo-β-mannanase	1318	Dormancy auxin associated protein
110	Cysteine proteinase inhibitor	3111	β-mannosidase
273	Cysteine proteinase
Expressed in embryo, micropylar and lateral endosperms
156	Protein translation factor sui1 homolog isoform 1	636	Thiazole biosynthetic enzyme
158	Elongation factor-1 alpha	698	Heat Shock Protein Hsp40
374	Catalase	765	Ascorbate peroxidase
396	Glyceraldehyde 3-Phosfate dehydrogenase	898	Actin 7
408	Ubiquitin-conjugating enzyme	1022	Catalase
423	Translationally controlled tumor protein	1379	High mobility group b3 protein
475	Fructose bisphosfate aldolase	2508	Mlp-like protein 423-like
516	Polyadenylate-binding protein-interacting p 2	2709	Catalase
608	Ubiquitin-conjugating enzyme e2 10-like	2780	Non-symbiotic hemoglobin class 1

How to cite

copy

ABRATES - Associação Brasileira de Tecnologia de Sementes Av. Juscelino Kubitschek, 1400 - 3° Andar, sala 31 - Centro,, CEP 86020-000 Londrina/PR - Londrina - PR - Brazil
E-mail: jss@abrates.org.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Gene expression during the germination of coffee seed

PlumX

Mensagem

[1] *Corresponding author: <amaral.silva@unesp.br>