Ilex paraguariensis extract prevents body weight gain in rats fed a high-fat diet

ABSTRACT

Studies have shown that drinks containing Ilex paraguariensis extract can promote many benefits in animals and in humans. The present study aimed to evaluate in vivo effects of Ilex paraguariensis extract on metabolic profile, obesity prevention and expression of genes related with adipogenesis and lipogenesis in Wistar female rats fed a high-fat diet. For this experiment 32 Wistar female rats with normal weight were used and randomly separated into four groups: diet (standard or high-fat) and treatment (water or Ilex paraguariensis extract) for 34 days. The rats receiving Ilex paraguariensis extract had lower body weight compared to the control group in both diets. Likewise, there was a reduction in triglycerides in the groups fed high-fat diet and treated with Ilex paraguariensis extract. The creatinine levels were lower in the groups treated with Ilex paraguariensis and in high-fat diet. It was observed an increased liver gene expression for Fas and Scd1 in the group treated with hyperlipid diet + Ilex paraguariensis. It can be concluded that Ilex paraguariensis extract decreased body weight gain in both control and high-fat diets, reduced plasma triglycerides and creatinine levels and increased liver expression of genes related to lipogenesis.

Keywords:
obesity; triglycerides; glucose levels; genes

1 Introduction

Ilex paraguariensis A. St. Hil. belongs to the Aquifoliaceae family and is a native species from the subtropical and temperate regions of South America. This herb is used regularly in beverages prepared by infusion such as teas, and is a natural product, recognized for having anti-inflammatory and diuretic properties (Przygodda et al., 2010). Likewise, the extract from Ilex paraguariensis contain different bioactive constituents, and several in vitro studies have shown the important role of polyphenols on the antioxidant activity, suggesting the potential use for the development of natural products aiming to protect biological systems against oxidative stress-mediated damages. Furthermore, others have shown anti-diabetic and antiobesity effects of the extract (Kang et al., 2012).

Obesity is an increasing problem worldwide, resulting in significant morbidity and mortality, as well as a reduced quality of life (Hurt et al., 2010). The unbalance on ingestion of food and loss of energy by exercise causes obesity and visceral adiposity, promoting complications to the personal health such as atherosclerosis, hepatic steatosis, and type 2 diabetes (Berg & Scherer, 2005). Furthermore, the ingestion of a high-fat meal leads to shifts in particle size, numbers, and plasma levels of very low density lipoprotein (VLDL), low density lipoprotein (LDL), and high density lipoprotein (HDL) (ALNohair, 2014). The potential of a diet or food to increase serum concentrations of cholesterol, especially LDL cholesterol, and promote atherosclerosis is directly related to its cholesterol, saturated fat and trans fat content (Mente et al., 2009). Also, it was reported that consumption of high-fat diets is associated with a reduction of serum paraoxonase 1 (Pon1) activity (Garcia et al., 2016).

The enzyme Pon1 is a natural antioxidant, and has a primary role in protecting HDL and LDL from lipid peroxidation (Ng et al., 2008). Pon1 is synthesized in the liver and secreted into the bloodstream bound to HDL (She et al., 2012). In addition to Pon1, apolipoprotein A1 (Apoa1) has a specific role in fat metabolism (Jaichander et al., 2008), and is a structural protein in HDL, being the main protein component of HDL (Rader, 2002). Apoa1 is responsible for the activation of lecithin cholesterol acyltransferase (LCAT), stimulating cholesterol flow and the binding of HDL to its receptors (Kontush et al., 2013). In addition to Pon1 and Apoa1, other genes are involved in lipid metabolism. Fatty acid synthase (Fas) is the key enzyme required for de novo synthesis of fatty acids (Wajant, 2012). Stearoyl coenzyme A desaturase-1 (Scd1) is an enzyme that appears to represent a pivotal control point in lipid homeostasis. Scd1 catalyzes a rate-limiting step in the biosynthesis of monounsaturated fats, which are required for triacylglycerol synthesis and very low density lipoprotein production. In absence of Scd1, hepatic lipid storage and very low-density lipoprotein production are impaired, and as default, fatty acids are oxidized (Wajant, 2012). The peroxisome proliferator-activated receptor co-activator-1 (Pgc1) is a transcriptional protein co-activator (Handschin, 2010). Pgc1 was initially characterized in adipose tissue and it is now known that this molecule plays an important role in oxidative metabolism, in mitochondrial biogenesis and hepatic gluconeogenesis. Based on this, evaluation o liver expression of these genes represents an important hallmark of the effect of the high-fat diets.

Thus, to evaluate the efficacy of potential compounds in the prevention and treatment of obesity, several animal models have been used (Kang et al., 2012). It has been reported that rodents fed with a high-fat diet are a good model of obesity, where the dietary environment is a major contributor (Bullo et al., 2007). Based on these evidences, this study aimed to evaluate the effects of Ilex paraguariensis extract on metabolic profile, body weight gain and liver gene expression related with adipogenesis and lipogenesis of Wistar female rats fed to a high-fat diet.

2 Materials and methods

2.1 Experimental conditions and monitoring

The experimental protocol was approved by the Animal Welfare Commission from the Federal University of Pelotas (Rio Grande do Sul State, Brazil), under the number 1641, and all procedures were conducted according to the guidelines of laboratory animal use in research. For this study 32 female Wistar rats (Rattus Novergicus), 60 days old were used. The rats were kept in groups of four at polypropylene boxes in ventilated cabinets, with controlled temperature and relative humidity conditions (23 °C ± 1 °C and 65-75%), and exposed to a 12 hour light/dark cycle. After five days of adaptation, the rats were randomly divided into four groups (n= 8 rats per group), as follows: standard diet (4% fat) + water ad libitum (SW); standard diet (4% fat) + Ilex paraguariensis extract ad libitum (SIP); high-fat diet (25% fat, 1% cholesterol and 0.1% cholic acid) + water ad libitum (HFW); high-fat diet (25% fat, 1% cholesterol and 0.1% cholic acid) + Ilex paraguariensis extract ad libitum (HFIP). The standard (4% fat content) and high-fat diets (25% fat content, 1% cholesterol and 0.1% cholic acid) were prepared in the laboratory, as recommended by the American Institute of Nutrition - AIN93- M for rodents (Reeves et al., 1993) (Table 1). The same brand and batch of Ilex paraguariensis was used throughout the experiment period, guaranteeing product homogeneity. The Ilex paraguariensis extract was prepared in a 10% concentration and 70 °C temperature, resembling conditions of the human ingestion. The infusion of the extract was performed for 20 minutes and after it was sieved.

Table 1
Diet composition according to AIN93-M (Reeves et al., 1993).

	Standard Diet	High-fat Diet
	g.kg -1	g.kg -1
Maize starch	466	256
Casein	140	140
Saccharose	100	100
Dextrinated starch	155	155
Soy oil	40	40
Fiber	50	50
Minerals	35	35
Vitamins	10	10
L-cistina	1.8	1.8
β-Colina	2.5	2.5
Tetra Butilh	0.008	0.008
Lard	----	120
Overall	1000	1000

The body weight was measured weekly using an electronic scale (JH2102/Bioprecisa, Curitiba, Brazil) and food intake was monitored daily during the 34 days of the study. Rats were euthanized at day 34, after a 12 hours fasting, following the ethical principles in animal experimentation used by the Brazilian College of Animal Experimentation.

2.2 Sample collection and biochemistry analysis

Blood was collected and centrifuged at 1000rpm for 10 minutes (Centrifuge 5415, Eppendorf, Westbury, New York, USA). The serum was transferred to a microtube and frozen at -20 °C until analysis.

The determination of total cholesterol, HDL, triglycerides and glucose levels in serum were performed using commercial kits (Triglycerides Liquiform and Glucose Liquiform, respectively, Labtest^®, Minas Gerais, Brazil). Samples reading were performed in a spectrophotometer (Ultraspec 2000, Pharmacia Biotech) at 500 nm. The results from total cholesterol, HDL cholesterol, triglycerides and glucose levels were expressed in mg/dL. The intra assay coefficients of variation found between 11.4% and 17.0%.

The Pon1 activity was measured by its arylesterase activity as previously established (She et al., 2012). The arylesterase activity was measured by the phenol formation rate through monitoring the increase in absorbance at 270 nm and 25 °C. The working reagent consisted of 20 mM Tris/HCl, pH 8.0, containing 1mM of CaCl₂ and 4 mM phenylacetate as substrate. The samples were diluted 1:3 in a 20 mM Tris/HCl buffer and were added to the working reagent and the change in absorbance recorded for 60 sec. The activity the Pon1 was expressed in U/L, based on the phenol extinction coefficient. The intra assay coefficients of variation found were 14.7%.

The determination of the concentration of transaminases glutamic-oxaloacetic transaminase (GOT) and glutamic-pyruvic transaminase (GPT) in the serum was performed by colorimetric method using a commercial kit (Doles®, Goiânia - GO, Brazil) and readings obtained spectrophotometrically at 505 nm and the results expressed as IU/L.

The determination of creatinine concentrations in serum were performed using commercial kits (Creatinine K®, Labtest Diagnostica SA, Lagoa Santa, Brazil) based on the Jaffé reaction. For the measurements, 50 uL of serum sample was mixed with 50 uL of alkaline picrate. Subsequently, the reading was held in spectrophotometer at 520 nm after 0 and 60 seconds. The results were expressed in mg/dL.

2.3 Gene expression

To determine gene expression, samples of liver were collected and immediately frozen in liquid nitrogen and stored at -80^oC. The samples were homogenized with Qiazol (Qiagen, Valencia, USA), and total RNA was isolated and purified following the Qiazol protocol. The quality of RNA was assessed by electrophoresis in agarose gel. The reverse transcription reactions were performed using 1 µg of RNA with a reverse transcription kit containing RNase inhibitor (Applied Biosystems, Foster City, USA) in a volume of 10 µL. Real-time PCR was performed to assess the expression of the target genes Apoa1, Pon1, Scd1, Foxo, Fasn and Pgc1 and the internal control Actb (Table 2).

Table 2
Primers used in the analysis of gene expression by real-time PCR.

Primers	Gene	Sequence (5’-3’)	Length (pb)
Actb (forward)	β-actin	TCACCACCACAGCCGAGAGA	72
Actb (reverse)		CGAAATCCAGTGCGACGTAGC
Pon1 (forward)	Pon1	CAAGAACCATCGGTCTTCCT	197
Actb (reverse)		CAGGCTTACTGGGATCGAAA
Apoa1 (forward)	Apoa1	CAAGAACCATCGGTCTTCCT	828
Apoa1 (reverse)		CAGGCTTACTGGGATCGAAA
Scd1 (forward)	Scd1	CACATCAACTTCACCACGTTCTTC	74
Scd1 (reverse)		GAAACTTTCTTCCGGTCGTAAGC
Foxo3 (forward)	Foxo3	TCCCAGATCTACGAGTGGATGG	42
Foxo3 (reverse)		CCTTCATTCTGAACGCGCAT
Fasn (forward)	FAS	CTGGACTCGCTCATGGGTG	111
Fasn (reverse)		CATTTCCTGAAGTTTCCGCAG
Pgc1 (forward)	PGC1	CCGAGAATTCATGGAGCAAT	114
Pgc1 (reverse)		TTTCTGTGGGTTTGGTGTGA

PCR reactions were performed in duplicate in a volume of 12 µL using SYBR Green Mastermix (Applied Biosystems) and the fluorescence was quantified in the Eco Real Time (Illumina, San Diego, California, USA). For each test, 40 cycles were carried out and a dissociation curve was included at the end of the reaction in order to verify the amplification of a single PCR product. Data is reported as folds over the minimum according to Masternak et al. (2005). Each assay plate included a negative control with water.

2.4 Statistical analysis

Data was analyzed using two-way analysis of variance (Two-way ANOVA) and Tukey's test at 5% significance level for comparison of means, using Graphpad Prism 5.0 (GraphPad, La Jolla, CA, USA). The effects of the diet, supplementation with Ilex paraguaiensis extract and their interaction were tested. When the interaction was significant individual groups were compared by t-test.

3 Results

The results from feed intake indicate that the groups fed high-fat diet had lower intake (p < 0.01, Table 3) when compared to the standard diet groups, although there was no effect of Ilex paraguariensis extract supplementation nor interaction between the diet and treatment (p > 0.05, Table 3). Despite no difference in feed intake when submitted to the same diet, rats supplemented with Ilex paraguariensis extract presented smaller weight gain (p < 0.01). No effect of diet or interaction between Ilex paraguariensis extract and diet was observed (p > 0.05, Table 3).

Table 3
Analysis of food intake and average weight of female rats in control (SW and HFW) and Ilex paraguaiensis extract groups (SIP and HFIP). The values were expressed as mean (M) ± standard error (SE).

	Feed intake (g)	Total caloric intake	Starting weight (g)	Final weight (g)	Weight gain (g)
Groups	----- M ± SE -----	----- Kcal -----	----- M ± SE -----
SW*	22.31 ± 0.39a**	3624.8	194.89 ± 0.43	233.38 ± 0.21	38.49 ± 0.23a**
SIP	21.85 ± 0.27a	3624.8	191.25 ± 0.36	222.58 ± 0.26	31.33 ± 0.31 b
HFW	19.36 ± 0.34b	3907.1	192.28 ± 0.54	238.94 ± 0.78	46.66 ± 3.03a
HFIP	19.85 ± 0.24b	3907.1	192.37 ± 0.41	225.41 ± 0.62	33.04 ± 0.45 b
CV(%)	11.12	-----	12.35	11.97	11.20

• ^*
  SW: standard diet (4% fat) + water ad libitum; SIP: standard diet (4% fat) + Ilex paraguariensis extract ad libitum; HFW: high-fat diet (25% fat content, 1% cholesterol and 0.1% cholic acid) + water ad libitum; HFIP: high-fat diet (25% fat content, 1% cholesterol and 0.1% cholic acid) + Ilex paraguariensis extract ad libitum; CV: coefficient variation;
• ^**
  Average values ​​followed by the same letter in the column show no significant statistical difference between them with the Tukey test at 1% probability of error (p < 0.01).

Ilex paraguariensis extract supplementation was effective to reduce plasma triglycerides on groups submitted to both diets (standard or high-fat diet) (p < 0.05, Table 4). The analysis from total cholesterol, HDL cholesterol and glucose concentration indicates no significant changes induced by diet, Ilex paraguariensis or its interaction (p > 0.01, Table 4). Likewise, Pon1 activity was not affected by diet, Ilex paraguariensis or its interaction (p > 0.05, Table 4).

Table 4
Analysis of total cholesterol, HDL cholesterol, triglycerides levels, blood glucose and Pon1 activity of female rats in the control and treatment groups. The values were expressed as mean (M) ± standard error (SE).

Treatment	Total cholesterol	HDL cholesterol	Triglyceride	Glucose	Pon1
	----- mg/dL -----				----- U/L -----
SW*	73.45 ± 04.90 ns**	53.58 ± 07.05 ns	117.76 ± 05.72 a***	464.76 ± 37.19 ns	134.10 ± 10.73 ns
SIP	81.74 ± 08.73 ns	60.68 ± 05.67 ns	92.55 ± 02.31 ab	399.29 ± 25.69 ns	151.95 ±10.62 ns
HFW	80.99 ± 07.23 ns	60.19 ± 06.90 ns	89.50 ± 03.18 ab	370.72 ± 16.48 ns	125.30 ±13,81 ns
HFIP	78.80 ± 11.32 ns	51.39 ± 04.01 ns	64.10 ± 01.80 b	390.72 ± 35.12 ns	132.10 ±10.19 ns
CV(%)	11.35	16.78	11.55	16.99	14.71

• ^*
  SW: control diet (4% fat) + water ad libitum; SIP: control diet (4% fat) + Ilex paraguariensis extract ad libitum; HFW: fat diet (25% fat content, 1% cholesterol and 0.1% cholic acid) + water ad libtum; HFIP: fat diet (25% fat content, 1% cholesterol and 0.1% cholic acid) + Ilex paraguariensis extract ad libitum; CV: coefficient variation;
• ^**
  not significant;
• ^***
  Average values ​​followed by the same letter show no significant statistical difference between them with the Tukey test at 1% probability of error (p < 0.01).

There was no difference in transaminase enzymes GOT (Figure 1A) and GPT (Figure 1B) activity between groups (p > 0.05), indicating no change in liver function for groups treated with Ilex paraguariensis extract.

Figure 1
Analysis of the GOT (A) and GPT (B) enzymes, and creatinine (C) determined by colorimetric method. Results were expressed in mean ± standard error. SW: standard diet + water; SIP: standard diet + Ilex paraguariensis extract; HFW: hyperlipidic diet + water; HFIP: hyperlipidic diet + Ilex paraguariensis extract.

Creatinine levels (Figure 1C) were lower in the group treated with standard diet + Ilex paraguariensis extract when compared to the standard diet + water group (p < 0.01). When only the rats fed the high-fat diet were analyzed, no difference (p>0.05) was observed between the groups treated with water or Ilex paraguariensis extract.

Regarding liver gene expression, Apoa1 (Figure 2A), Pon1 (Figure 2B), Foxo3 (Figure 2E) and Pgc1 (Figure 2F) expression were not different between groups. However, Fasn (Figure 2C) and Scd1 (Figure 2D) were higher (p < 0.01) in the high-fat + Ilex paraguariensis group.

Figure 2
Ilex paraguariensis extract intake effect of gene expression of Apoa1 (A), Pon1 (B), Fas (C), Sdc1 (D), Foxo3a (E), Pgc1 (F), in the liver of female rats supplemented with standard and high-fat diet. SW: standard diet + water; SIP: standard diet + Ilex paraguariensis extract; HFW: hyperlipidic diet + water; HFIP: hyperlipidic diet + Ilex paraguariensis extract.

4 Discussion

We observed lower food intake in the high-fat compared to the standard groups. Kojima & Kangawa, (2005) reported that consumption of the high-fat diet induced a satiating effect, which is reflected in the reduced levels of the appetite-stimulating peptide ghrelin. Thomàs-Moyà et al. (2007) reported that rats feed with high-fat diet reduced their food intake, thus maintaining their energy intake and their body weight closer to those of the control rats. However, a marked increment of adipose depots was observed, which was greater in males than females (Thomàs-Moyà et al., 2007). The reduced intake in rats fed a high-fat diet is well known, and Hariri et al. (2010) found similar results regarding food intake, when feeding a high-fat diet to rats for a period of 26 days, in order to analyze the effect of diet as a facilitator to excessive weight gain.

Body weight gain was lower in rats supplemented with Ilex paraguariensis extract. Similar data was observed by Pang et al. (2008), indicating that dietary supplementation with Ilex paraguariensis extract administered to obese rats induced by high-fat diet was able to significantly reduce body weight gain, plasma triacylglycerides, glucose,, along with reduction on anti-inflammatory markers (Luz et al., 2016), and antidepressant-like effects (Reis et al., 2014). According to Hetzler et al. (1990) the amount of caffeine present in Ilex paraguariensis could be responsible for the significant decrease in the amount of epididymal and abdominal fat. The caffeine has been shown to be able to cross the blood brain barrier and to increase the circulating concentrations of catecholamine (epinephrine) in humans, which is known to increase thermogenesis and lipolysis (Silva et al., 2011). In studies with mice fed a high-fat diet, Ilex paraguariensis has been suggested to promote satiety through several mechanisms, including induction and/or enhancement of intestinal glucagon-like peptide-1 (GLP-1), modulation of serum leptin levels and a possible direct central satiety-stimulatory effect (Resende et al., 2012). Data obtained from experiments conducted in diet-induced obesity models have shown that Ilex paraguariensis suppresses body weight gain and visceral fat accumulation and decreases serum levels of cholesterol, triglycerides, LDL cholesterol, glucose, insulin, pancreatic lipase and leptin (Gambero & Ribeiro, 2015). Therefore, our study further support the idea that Ilex paraguariensis extract treatment is able to reduce body weight gain in rats fed a high-fat diet.

We also observed that serum triglycerides were lower for rats fed high-fat diet and receiving Ilex paraguariensis extract than rats fed high-fat diet and receiving only water. Silva et al. (2011) reported, for rats that consumed the extract of gross mate, an increase in triglyceride levels of 21.4% compared to the control group. Increased triglyceride levels may be related to the lipolytic effect, resulting in increased mobilization of fatty acids from adipose tissue or intramuscular fat depots. However, Paganini-Stein et al. (2005) found in their study that animals treated with Ilex paraguariensis had a decrease in triglyceride levels compared to controls animals, in agreement with our current findings. Another study with mice treated with high-fat diet and Ilex paraguariensis also showed that Ilex paraguariensis reduced plasma triglycerides (Kang et al., 2012). Therefore, in addition to reducing body weight gain, Ilex paraguariensis results in decreased triglycerides levels which can be beneficial in the prevention of heart diseases.

The present study indicated that total cholesterol, HDL and Pon1 activity were not affected by diet, Ilex paraguariensis extract or its interaction. Recently, Bravo et al. (2014) studying the effect of Ilex paraguariensis on serum lipids and antioxidant status of normocholesterolemic and hypercholesterolemic rats demonstrated that in the normocholesterolemic rats, the Ilex paraguariensis had no effect on serum lipids or antioxidant status. Despite that in the hypercholesterolemic rats, Ilex paraguariensis treatment also had no effect on HDL-c or protein carbonyls, it showed a marked hypolipidemic action, decreasing triglycerides, total cholesterol and LDL-c, and serum malonaldehyde levels. These parameters had been increased after consumption of a high cholesterol diet, pointing out that the potential benefic effect of Ilex paraguariensis on risk factors for cardiovascular diseases seems to be restricted to already hyperlipidemic animals. Paganini-Stein et al. (2005) were the first to report a significant reduction in serum total cholesterol and triglycerides of cholesterol-fed rats after administration of Ilex paraguariensis aqueous extract. Thomàs-Moyà et al. (2007) also reported that Ilex paraguariensis extract decreased the VLDL-LDL fraction in obese rats. A probable mechanism for the LDL-C lowering ability of Ilex paraguariensis is the blocking of cholesterol absorption in the small intestine and/or the inhibition of cholesterol synthesis in the liver, which can be attributed to the presence of saponins, phenolic compounds, flavonoids, and/or caffeine in the mate infusion (Morais et al., 2009).

The present study also analyzed the GOT and GPT enzymes, which were not different among groups. These enzymes have been investigated in order to verify possible liver damages induced by the high-fat diet. They are found within cells in the liver, but when there is some abnormal liver function, lead to an increase in these enzymes, which are released into the blood stream. Usually this increase is asymptomatic and transient, but some diseases caused by elevations of GOT and GPT levels are acute hepatitis A or B, fatty liver, obesity and hepatitis C (Russo & Jacobson, 2012). Despite that, creatinine was lower in the groups treated with Ilex paraguariensis. Creatinine has been used as a parameter for the initial evaluation of renal function in daily clinical practice. However, inferring that normal creatinine values ​​always indicate normal kidney function can lead to significant errors, since early changes in glomerular filtration rate can be “hidden” in normal's creatinine values (Pinto et al., 2004). Therefore, higher creatinine level can reveal that renal function is disturbed, indicating that Ilex paraguariensis can be beneficial for kidney function.

The effects of Ilex paraguariensis extract on the gene expression of antioxidant/inflammatory markers have been studied in animal models (Matsumoto et al., 2009; Arçari et al., 2011). The analysis of liver tissue expression of Pon1 and Apoa1, indicated no difference between diets and treatments. Similar results were demonstrated by Boaventura et al. (2012) in humans, indicating that there was no change in Pon1 activity after a prolonged ingestion (90 days) of Ilex paraguariensis tea. However, Menini et al. (2007) reported increases in serum Pon1 activity after ingesting 500 mL of Ilex paraguariensis infusion in healthy individuals. Bastos & Gugliucci (2009) demonstrated that the chlorogenic acid, the main phenolic constituent of the Ilex paraguariensis, can preserve Pon1 against oxidative degradation in vitro. Results found by Morais et al. (2009) in humans corroborate with the data in this study, and also did not observe significant increases in Apoa1 expression, suggesting that this can be due to the decreased HDL catabolism. The Apoa1 is indicative of the amount of HDL in plasma or new HDL particles forming the potential to exert its function in reverse cholesterol transport to the liver. When there is an increase in Apoa1, it is suggested that there is an increase in hepatic production of nascent HDL particles (Lyssenko et al., 2013).

Diet-induced obesity is largely caused by disorders of fat metabolism, resulting in a massive accumulation of fat in various tissues. Lipid and energy metabolism are regulated by a complex network of signaling processes, therefore we investigated the mRNA expression of key genes regulating lipid metabolism such as Scd1 and Fasn (Yang et al., 2012). Fasn, which encodes a rate limiting enzyme in fatty acid biosynthesis to produce palmitic acid; Scd1, which converts stearic acid to oleic acid, and glycerol-3-phosphate acyltransferase, which encodes the first committed enzyme in triglyceride and phospholipid synthesis (Horton et al., 2002). The mRNA expression levels of genes encoding lipogenic proteins such as Scd1 and Fas increased in rats receiving Ilex paraguaiensis and high-fat diet, can be suggest a rapid effect of the high-fat diet on lipogenesis. Expression of Foxo gene, which regulates gluconeogenesis, and Pgc1 gene, a coactivator essential for coordinating gluconeogenesis and fatty acid oxidation, were not different among groups in this study. Additionally, Pon1 and Apoa1 gene expression were also not different, confirming the observations that serum levels of Pon1 were not changed as well as of HDL.

5 Conclusion

In summary, the data presented here indicates that the use of Ilex paraguariensis extract prevents body weight gain, while improving the lipid parameters in rats fed a high-fat diet. In addition, Ilex paraguariensis modulates the expression of genes related in adipogenesis and lipogenesis in the obese state. Thus, the results from this study indicated that Ilex paraguariensis extract might be helpful in the treatment against obesity and its comorbidities.

Acknowledgements

This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001. Authors thank also the financial support of the Brazilian agencies: Conselho Nacional de Desenvolvimento Científico e Tecnológico – Brasil (CNPq) and Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul – Brasil (FAPERGS).

• Practical Application: Control of obesity by the consumption of the extract of the Ilex paraguariensis.

References

• ALNohair, S. (2014). Obesity in gulf countries. International Journal of Health Sciences, 8(1), 79-83. http://dx.doi.org/10.12816/0006074 PMid:24899882.
  » http://dx.doi.org/10.12816/0006074
• Arçari, D. P., Bartchewsky, W. Jr., Santos, T. W., Oliveira, K. A., Oliveira, C. C., Gotardo, É. M., Pedrazzoli, J. Jr., Gambero, A., Ferraz, F. C., Carvalho, P. O., & Ribeiro, M. L. (2011). Anti-inflammatory effects of yerba maté extract (Ilex paraguariensis) ameliorate insulin resistance in mice with high fat diet-induced obesity. Molecular and Cellular Endocrinology, 335(2), 110-115. http://dx.doi.org/10.1016/j.mce.2011.01.003 PMid:21238540.
  » http://dx.doi.org/10.1016/j.mce.2011.01.003
• Bastos, D. H., & Gugliucci, A. (2009). Chlorogenic acid protects paraoxonase 1 activity in high density lipoprotein from inactivation caused by physiological concentrations of hypochlorite. Fitoterapia, 80(2), 138-142. http://dx.doi.org/10.1016/j.fitote.2009.01.001 PMid:19248222.
  » http://dx.doi.org/10.1016/j.fitote.2009.01.001
• Berg, A. H., & Scherer, P. E. (2005). Adipose tissue, inflammation, and cardiovascular disease. Circulation Research, 96(9), 939-949. http://dx.doi.org/10.1161/01.RES.0000163635.62927.34 PMid:15890981.
  » http://dx.doi.org/10.1161/01.RES.0000163635.62927.34
• Boaventura, B. C. B., Di Pietro, P. F., Stefanuto, A., Klein, G. A., Morais, E. C., Andrade, F., Wazlawik, E., & Silva, E. L. (2012). Association of mate tea (Ilex paraguariensis) intake and dietary intervention and effects on oxidative stress biomarkers of dyslipidemic subjects. Nutrition (Burbank, Los Angeles County, Calif.), 28(6), 657-664. http://dx.doi.org/10.1016/j.nut.2011.10.017 PMid:22578980.
  » http://dx.doi.org/10.1016/j.nut.2011.10.017
• Bravo, L., Mateos, R., Sarriá, B., Baeza, G., Lecumberri, E., Ramos, S., & Goya, L. (2014). Hypocholesterolaemic and antioxidant effects of yerba mate (Ilex paraguariensis) in high-cholesterol fed rats. Fitoterapia, 92, 219-229. http://dx.doi.org/10.1016/j.fitote.2013.11.007 PMid:24291756.
  » http://dx.doi.org/10.1016/j.fitote.2013.11.007
• Bullo, M., Casas-Agustench, P., Amigo-Correig, P., Aranceta, J., & Salas-Salvado, J. (2007). Inflammation, obesity and comorbidities: the role of diet. Public Health Nutrition, 10(10A), 1164-1172. http://dx.doi.org/10.1017/S1368980007000663 PMid:17903326.
  » http://dx.doi.org/10.1017/S1368980007000663
• Gambero, A., & Ribeiro, M. L. (2015). The positive effects of yerba mate (Ilex paraguariensis) in obesity. Nutrients, 7(2), 730-750. http://dx.doi.org/10.3390/nu7020730 PMid:25621503.
  » http://dx.doi.org/10.3390/nu7020730
• Garcia, D. N., Prietsch, L. A., Rincón, J. A., Moreira, I. L., Valle, S. C., Barros, C. C., Helbig, E., Corrêa, M. N., & Schneider, A. (2016). Differential effects of a high-fat diet on serum lipid parameters and ovarian gene expression in young and aged female mice. Zygote (Cambridge, England), 24(5), 676-683. http://dx.doi.org/10.1017/S0967199415000684 PMid:26883034.
  » http://dx.doi.org/10.1017/S0967199415000684
• Handschin, C. (2010). Regulation of skeletal muscle cell plasticity by the peroxisome proliferator-activated receptor coactivator 1. Journal of Receptors and Signal Transduction, 30(6), 376-384. http://dx.doi.org/10.3109/10799891003641074 PMid:20178454.
  » http://dx.doi.org/10.3109/10799891003641074
• Hariri, N., Gougeon, R., & Thibault, L. (2010). A highly saturated fat-rich diet is more obesogenic than diets with lower saturated fat content. Nutrition Research (New York, N.Y.), 30(9), 632-643. http://dx.doi.org/10.1016/j.nutres.2010.09.003 PMid:20934605.
  » http://dx.doi.org/10.1016/j.nutres.2010.09.003
• Hetzler, R. K., Knowlton, R. T., Somani, S. M., Brown, D. D., & Perkins, R. M. 3rd (1990). Effect of paraxanthine on FFA mobilization after intravenous caffeine administration in humans. Journal of Applied Physiology, 68(1), 44-47. http://dx.doi.org/10.1152/jappl.1990.68.1.44 PMid:2312486.
  » http://dx.doi.org/10.1152/jappl.1990.68.1.44
• Horton, J. D., Goldstein, J. L., & Brown, M. S. (2002). SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. The Journal of Clinical Investigation, 109(9), 1125-1131. http://dx.doi.org/10.1172/JCI0215593 PMid:11994399.
  » http://dx.doi.org/10.1172/JCI0215593
• Hurt, R. T., Kulisek, C., Buchanan, L. A., & McClave, S. A. (2010). The obesity epidemic: challenges, health initiatives, and implications for gastroenterologists. Journal of Gastroenterology and Hepatology, 6(12), 780-792. PMid:21301632.
• Jaichander, P., Selvarajan, K., Garelnabi, M., & Parthasarathy, S. (2008). Induction of paraoxonase 1 and apolipoprotein A-I gene expression by aspirin. Journal of Lipid Research, 49(10), 2142-2148. http://dx.doi.org/10.1194/jlr.M800082-JLR200 PMid:18519978.
  » http://dx.doi.org/10.1194/jlr.M800082-JLR200
• Kang, Y.-R., Lee, H.-Y., Kim, J.-H., Moon, D.-I., Seo, M.-Y., Park, S.-H., Choi, K.-H., Kim, C.-R., Kim, S.-H., Oh, J.-H., Cho, S.-W., Kim, S.-Y., Kim, M.-G., Chae, S.-W., Kim, O., & Oh, H.-G. (2012). Anti-obesity and anti-diabetic effects of yerba mate (Ilex paraguariensis) in C57BL/6J mice fed a high-fat diet. Laboratory Animal Research, 28(1), 23-29. http://dx.doi.org/10.5625/lar.2012.28.1.23 PMid:22474471.
  » http://dx.doi.org/10.5625/lar.2012.28.1.23
• Kojima, M., & Kangawa, K. (2005). Ghrelin: structure and function. Physiological Reviews, 85(2), 495-522. http://dx.doi.org/10.1152/physrev.00012.2004 PMid:15788704.
  » http://dx.doi.org/10.1152/physrev.00012.2004
• Kontush, A., Lhomme, M., & Chapman, M. J. (2013). Unraveling the complexities of the HDL lipidome. Journal of Lipid Research, 54(11), 2950-2963. http://dx.doi.org/10.1194/jlr.R036095
  » http://dx.doi.org/10.1194/jlr.R036095
• Luz, A. B. G., Silva, C. H. B., Nascimento, M. V. P. S., Facchin, B. M. C., Baratto, B., Fröde, T. S., Reginatto, F. H., & Dalmarco, E. M. (2016). The anti-inflammatory effect of Ilex paraguariensis A. St. Hil (Mate) in a murine model of pleurisy. International Immunopharmacology, 36, 165-172. http://dx.doi.org/10.1016/j.intimp.2016.04.027 PMid:27155392.
  » http://dx.doi.org/10.1016/j.intimp.2016.04.027
• Lyssenko, N. N., Nickel, M., Tang, C., & Phillips, M. C. (2013). Factors controlling nascent high-density lipoprotein particle heterogeneity: ATP-binding cassette transporter A1 activity and cell lipid and apolipoprotein AI availability. The FASEB Journal, 27(7), 2880-2892. http://dx.doi.org/10.1096/fj.12-216564 PMid:23543682.
  » http://dx.doi.org/10.1096/fj.12-216564
• Masternak, M. M., Al-Regaiey, K. A., Del-Rosario-Lim, M. M., Bonkowski, M. S., Panici, J. A., Przybylski, G. K., & Bartke, A. (2005). Caloric restriction results in decreased expression of peroxisome proliferator-activated receptor super family in muscle of normal and long-lived growth hormone receptor/binding protein knockout mice. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 60(10), 1238-1245. http://dx.doi.org/10.1093/gerona/60.10.1238 PMid:16282554.
  » http://dx.doi.org/10.1093/gerona/60.10.1238
• Matsumoto, R. L., Bastos, D. H., Mendonça, S., Nunes, V. S., Bartchewsky, W., Ribeiro, M. L., & Carvalho, P. O. (2009). Effects of mate tea (Ilex paraguariensis) ingestion on mRNA expression of antioxidant enzymes, lipid peroxidation, and total antioxidant status in healthy young women. Journal of Agricultural and Food Chemistry, 57(5), 1775-1780. http://dx.doi.org/10.1021/jf803096g PMid:19219987.
  » http://dx.doi.org/10.1021/jf803096g
• Menini, T., Heck, C., Schulze, J., Mejia, E., & Gugliucci, A. (2007). Protective action of Ilex paraguariensis extract against free radical inactivation of paraoxonase-1 in high-density lipoprotein. Planta Medica, 73(11), 1141-1147. http://dx.doi.org/10.1055/s-2007-981585 PMid:17823869.
  » http://dx.doi.org/10.1055/s-2007-981585
• Mente, A., Koning, L., Shannon, H. S., & Anand, S. S. (2009). A systematic review of the evidence supporting a causal link between dietary factors and coronary heart disease. Archives of Internal Medicine, 169(7), 659-669. http://dx.doi.org/10.1001/archinternmed.2009.38 PMid:19364995.
  » http://dx.doi.org/10.1001/archinternmed.2009.38
• Morais, E. C., Stefanuto, A., Klein, G. A., Boaventura, B. C. B., Andrade, F., Wazlawik, E., Pietro, P. F., Maraschin, M., & Silva, E. L. (2009). Consumption of yerba mate (Ilex paraguariensis) improves serum lipid parameters in healthy dyslipidemic subjects and provides an additional LDL-cholesterol reduction in individuals on statin therapy. Journal of Agricultural and Food Chemistry, 57(18), 8316-8324. http://dx.doi.org/10.1021/jf901660g PMid:19694438.
  » http://dx.doi.org/10.1021/jf901660g
• Ng, D. S., Chu, T., Esposito, B., Hui, P., Connelly, P. W., & Gross, P. L. (2008). Paraoxonase-1 deficiency in mice predisposes to vascular inflammation, oxidative stress, and thrombogenicity in the absence of hyperlipidemia. Cardiovascular Pathology, 17(4), 226-232. http://dx.doi.org/10.1016/j.carpath.2007.10.001 PMid:18402813.
  » http://dx.doi.org/10.1016/j.carpath.2007.10.001
• Paganini-Stein, F. L., Schmidt, B., Furlong, E. B., Souza-Soares, L. A., Soares, M. C., Vaz, M. R., & Muccillo-Baish, A. L. (2005). Vascular responses to extractable of Ilex paraguariensis in rats fed standard and high-cholesterol diets. Biological Research for Nursing, 7(2), 146-156. http://dx.doi.org/10.1177/1099800405280521 PMid:16267376.
  » http://dx.doi.org/10.1177/1099800405280521
• Pang, J., Choi, Y., & Park, T. (2008). Ilex paraguariensis extract ameliorates obesity induced by high fat diet: role of AMPK in the visceral adipose tissue. Archives of Biochemistry and Biophysics, 476(2), 178-185. http://dx.doi.org/10.1016/j.abb.2008.02.019 PMid:18314006.
  » http://dx.doi.org/10.1016/j.abb.2008.02.019
• Pinto, P. S., Silva, F. J., & Munch, E. C. S. M. (2004). Inadequabilidade da creatinina sérica na identificação precoce da disfunção renal. Jornal Brasileiro de Neurologia, 26, 196-201.
• Przygodda, F., Martins, Z. N., Castaldelli, A. P. A., Minella, T. V., Vieira, L. P., Cantelli, K., Fronza, J., & Padoin, M. J. (2010). Effect of erva-mate (Ilex paraguariensis A. St.-Hil., Aquifoliaceae) on serum cholesterol, triacylglycerides and glucose in Wistar rats fed a diet supplemented with fat and sugar. Brazilian. Journal of Pharmacognsosy, 20(6), 956-961. http://dx.doi.org/10.1590/S0102-695X2010005000045
  » http://dx.doi.org/10.1590/S0102-695X2010005000045
• Rader, D. J. (2002). High-density lipoproteins and atherosclerosis. The American Journal of Cardiology, 90(8A), 62-70. http://dx.doi.org/10.1016/S0002-9149(02)02635-8 PMid:12419482.
  » http://dx.doi.org/10.1016/S0002-9149(02)02635-8
• Reeves, P. G., Nielsen, F. H., & Fahey, G. C. Jr. (1993). AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. Journal of Nutrition, 123(11), 1939-1951. http://dx.doi.org/10.1093/jn/123.11.1939.
  » http://dx.doi.org/» 10.1093/jn/123.11.1939
• Reis, E. M., Schreiner, F. W. No., Cattani, V. B., Peroza, L. R., Busanello, A., Leal, C. Q., Boligon, A. A., Lehmen, T. F., Libardoni, M., Athayde, M. L., & Fachinetto, R. (2014). Antidepressant-Like Effect of Ilex paraguariensis in Rats. BioMed Research International, 1, 1-9. http://dx.doi.org/10.1155/2014/958209 PMid:24895633.
  » http://dx.doi.org/10.1155/2014/958209
• Resende, P. E., Verza, S. G., Kaiser, S., Gomes, L. F., Kucharski, L. C., & Ortega, G. G. (2012). The activity of mate saponins (Ilex paraguariensis) in intra-abdominal and epididymal fat, and glucose oxidation in male Wistar rat. Journal of Ethnopharmacology, 144(3), 735-740. http://dx.doi.org/10.1016/j.jep.2012.10.023 PMid:23088849.
  » http://dx.doi.org/10.1016/j.jep.2012.10.023
• Russo, M. W., & Jacobson, I. M. (2012). How to use statins in patients with chronic liver disease. Journal of Medicinal Chemistry, 71(1), 58-62. PMid:14740969.
• She, Z. G., Chen, H. Z., Yan, Y., Li, H., & Liu, D. P. (2012). The human paraoxonase gene cluster as a target in the treatment of atherosclerosis. Antioxidants & Redox Signalling, 16(6), 597-632. http://dx.doi.org/10.1089/ars.2010.3774 PMid:21867409.
  » http://dx.doi.org/10.1089/ars.2010.3774
• Silva, R. D., Bueno, A. L. S., Gallon, C. W., Gomes, L. F., Kaiser, S., Pavei, C., Ortega, G. G., Kucharski, L. C., & Jahn, M. P. (2011). The effect of aqueous extract of gross and commercial yerba mate (Ilex paraguariensis) on intra-abdominal and epididymal fat and glucose levels in male Wistar rats. Fitoterapia, 82(6), 818-826. http://dx.doi.org/10.1016/j.fitote.2011.04.011 PMid:21600272.
  » http://dx.doi.org/10.1016/j.fitote.2011.04.011
• Thomàs-Moyà, E., Gianotti, M., Proenza, A. M., & Lladó, I. (2007). Paraoxonase 1 response to a high-fat diet: gender differences in the factors involved. Journal of Molecular Medicine (Berlin, Germany), 13(3-4), 203-209. PMid:17592556.
• Wajant, H. (2012). The Fas signaling pathway: more than a paradigm. Science, 296(5573), 1635-1636. http://dx.doi.org/10.1126/science.1071553 PMid:12040174.
  » http://dx.doi.org/10.1126/science.1071553
• Yang, Z. H., Miyahara, H., Takeo, J., & Katayama, M. (2012). Diet high in fat and sucrose induces rapid onset of obesity-related metabolic syndrome partly through rapid response of genes involved in lipogenesis, insulin signalling and inflammation in mice. Diabetology & Metabolic Syndrome, 4(1), 1-10. http://dx.doi.org/10.1186/1758-5996-4-32 PMid:22762794.
  » http://dx.doi.org/10.1186/1758-5996-4-32

Publication Dates

• Publication in this collection
  27 June 2019
• Date of issue
  Jul-Sep 2019

History

• Received
  02 Dec 2017
• Accepted
  03 Jan 2019