Clonal relation and antimicrobial resistance pattern of extended-spectrum β-lactamase- and AmpC β-lactamase-producing Enterobacter spp. isolated from different clinical samples in Tehran, Iran

Abstract

INTRODUCTION:

Here, we determined the genes encoding antibiotic resistance enzymes and virulence factors and evaluated the genetic relationship between Enterobacter spp. isolated from different clinical samples.

METHODS:

A total of 57 clinical isolates of Enterobacter spp. were tested for the production of extended-spectrum β-lactamases (ESBLs), carbapenemase, and AmpC using phenotypic and genotypic methods.

RESULTS:

The most common ESBLs and AmpC β-lactamases were bla _TEM (63.3%) and bla _EBC (57.7%), respectively. The most prevalent virulence gene was rpos (87.7%). The random amplified polymorphic DNA (RAPD) patterns of strains were genetically unrelated.

CONCLUSIONS:

RAPD polymerase chain reaction analysis revealed high genetic diversity among isolates.

Keywords:
Enterobacter; ESBL; AmpC; RAPD-PCR

Enterobacter species may cause severe nosocomial infections, including bloodstream, respiratory tract, and central nervous system infections as well as endocarditis^1,2. Nosocomial infections caused by these microorganisms have been associated with high rates of mortality and morbidity¹. Enterobacter cloacae and Enterobacter aerogenes are the most common species isolated from clinical samples³. Several virulence genes are involved in the pathogenesis of these microorganisms^4-7. Curli fimbria, encoded by csgBAC, is an important factor for cell adhesion, aggregation, and biofilm formation in many enterobacteria⁴. In addition, RpoS regulation is known to play an important role in multiple stress conditions such as acid, heat, and oxidative stress, starvation, high osmolarity, and near UV exposure⁵. Another important virulence factor is the type III secretion system encoded by FliI that delivers a variety of effectors directly into the cytosol of host as well as aerobactin, encoded by the iutA, described as a virulence factor related to iron acquisition from host-binding proteins^6,7. β-lactam antibiotics, especially third-generation cephalosporins and carbapenems, are used to treat infections cause by several species of Enterobacter^1-3. β-lactamase enzymes, including extended-spectrum β-lactamases (ESBLs) and AmpC, are involved in the mechanism underlying resistance to β-lactam antibiotics in Enterobacter spp^1-3. ESBLs are often encoded by genes located on large plasmids that also carry genes for resistance to other antimicrobial agents such as aminoglycosides and fluoroquinolones¹. ESBLs are capable of hydrolyzing penicillins, broad-spectrum cephalosporins, and aztreonam, but may not hydrolyze cephamycin, and are inhibited by clavulanic acid. AmpC β-lactamases are usually encoded on the bacterial chromosome and in some cases on the bacterial plasmid (plasmid-mediated AmpC)³. In Iran, ESBL production was recently reported in 44.28% of E. cloacae isolates¹. Despite the high incidence of Enterobacter spp. infection among Iranian patients, very little is known about the antibiotic resistance pattern, virulence factors, and molecular characteristics of Enterobacter spp. isolates. In the current study, the genes encoding antibiotic resistance enzymes and virulence factors were determined and the genetic relationship between Enterobacter spp. isolated from different clinical samples was evaluated.

Bacterial isolates

A total of 57 isolates of Enterobacter spp. were obtained from different patients admitted to three teaching hospitals of the Tehran University of Medical Sciences between September 2013 and April 2014. The isolates were collected from various clinical samples, including urine, wounds, tracheal aspirate, and blood. No duplicate isolates from the same patient and no environmental strains were included in this study. All isolates of Enterobacter spp. were identified by standard biochemical tests⁸.

Susceptibility testing

Antibiotic-containing discs (Mast, UK) were used to deter­mine the susceptibility of Enterobacter spp. using the disc diffusion method, as per the Clinical and Laboratory Standards Institute (CLSI) guidelines⁹. The antimicrobial agents used were as follows: aztreonam-amikacin (30µg), amoxicillin-clavulanic acid (20/10µg), cefpodoxime (10µg), cefotaxime (30µg), ceftazidime (30µg), imipenem (10µg), cefepime (30µg), gatifloxacin (5 mg), cefoxitin (30µg), gentamicin (30µg), ciprofloxacin (30µg), levofloxacin (5µg), ertapenem (10µg), and meropenem (10µg). Isolates that showed resistance to at least three classes of antibiotics were defined as multi-drug resistant (MDR) strains¹. ESBL-producing strains were detected using the combined double-disc test¹. In addition, organisms were screened for carbapenemase production with the modified Hodge test (MHT)⁹. The minimum inhibitory concentration (MIC) of imipenem was determined by the microbroth dilution method according to CLSI criteria⁹. AmpC overproduction was confirmed according to the method of Kalantar-Neystanaki et al¹⁰.

Detection of β-lactamases and virulence genes

Genomic DNA was extracted by the boiling method². The genes encoding ESBLs (bla _TEM, bla _SHV, bla _CTX-M, and bla _PER), AmpC (bla _ACC, bla _FOX, bla _MOX, bla _DHA, bla _CIT, and bla _EBC), and carbapenemase (bla _IMP, bla _VIM, bla _NDM, bla _KPC, bla _GIM, and bla _OXA-48) were targeted by polymerase chain reaction (PCR) using specific primers^10,11. The detection of seven different virulence genes (csgA, csgB, csgD, rpos, FliI, fepA, and iutA) was performed with PCR using the oligonucleotide primers listed in Table 1.

TABLE 1:
The oligonucleotide primers used in this study for the amplification of virulence genes.

Gene	Primer sequence (5′ to 3′)	Annealing temperature (°C)	Product size (bp)	Reference
csgA	F- TTCAAAGTGGCAGTTATTGCAG	56	276	[4]
	R- TTTTTGCAGCAGATCGATAGAA
csgD	F- GAAATTGCATAATATTCAACGTTC R- TTTGTTCAGGATCTCTTTTTCAC	54	385
csgB	F- TCCTGGGAAACGATGGACAA	54	193	this study
	R- TTACATTACTGGGAGCGCCT
fliI	F- ATACGGCGCAGTGCGTTAC	54	154	this study
	R- ACCAAAGAGAGGACACAATGC
rpoS	F- CACTTCACGCTGTTTGGCG	56	273	this study
	R- CGCGAGTTGTCCCATAAACTG
fepA	F- TCTTTT TTCACCGGCATGGA	57	572	this study
	R- CGTGCGGTGGTCAATATCT
iutA	F- TGAAACGTTCTCATCTTTGGGTT	56	1117	this study
	R- TCG AAGGTTTCATGGTCGGC

Random amplified polymorphic DNA-PCR

For molecular analysis of isolates, random amplified polymorphic DNA (RAPD)-PCR was performed as previously described¹². In brief, PCR protocol comprised a pre-denaturation step at 95 °C for 5 min, followed by 30 cycles of 60 s at 95 °C, 60 s at 33 °C, and 60 s at 72 °C. A final extension step was performed at 72 °C for 10 min. PCR products were separated by electrophoresis on 1% agarose gels with 0.5× Tris-borate-ethylenediaminetetraacetic acid (EDTA) buffer (TBE buffer). Gels were stained with ethidium bromide and the images were captured using a gel documentation system. Isolates that differed by more than two prominent bands were assigned to different types.

Of 57 isolates, 44 (77.1%) were E. cloacae and 13 (22.8%) were E. aerogenes. These were cultured from wounds (n = 26), urine (n = 15), blood (n = 8), and other sources (n = 8). Resistance to cefoxitin (84.3%), cefotaxime (49.1%), cefpodoxime (36.8%), and ceftazidime (36.8%) was more prevalent, but only eight (14.1%), seven (12.3%), and six (10.5%) isolates were resistant to imipenem, levofloxacin, and gatifloxacin, respectively. Microbroth dilution method showed that 20 (35.1%) strains were resistant to imipenem. Ten (17.5%) isolates were defined as MDR. The phenotypic test for ESBL, AmpC β-lactamase, and carbapenemase production showed that 30 isolates (22 E. cloacae and 8 E. aerogenes) produced ESBL, 21 isolates (16 E. cloacae and 5 E. aerogenes) produced AmpC β-lactamases, and 8 isolates (6 E. cloacae and 2 E. aerogenes) produced carbapenemases. The phenotypic and genotypic characteristics of ESBL and AmpC-producing isolates of E. cloacae and E. aerogenes are shown in Table 2 and Table 3, respectively. The genes encoding ESBL, bla _TEM, bla _CTX-M, and bla _SHV, were detected in 19 (63.3%), 19 (63.3%), and 8 (26.6%) isolates, respectively, making them the most prevalent ESBL genes in these isolates. We failed to detect bla _PER .

TABLE 2:
Characteristics of Enterobacter cloacae isolates.

Isolate ID	Date	Source	Resistance pattern	MDR	ESBL gene	MIC of IMI	AmpC gene	RAPD type
1	11/11/2013	Burn	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, AK, GM, CIP, LEV, GAT	+	blaTEM, blaCTX-M	1	bla EBC	D
2	11/11/2013	Burn	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM	−	blaTEM, blaCTX-M	2	bla EBC	E
3	11/25/2013	Burn	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM, CIP	+	blaTEM, blaSHV	2	bla EBC	F
4	12/21/2013	Eye	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM	−	bla TEM	4	blaACC, blaEBC	G
5	12/29/2013	Respiratory	CTX, CAZ, CPM, CPD, FOX, AUG, AK	−	bla TEM	4	blaACC, blaDHA	H
6	12/28/2011	Urine	CTX, CAZ, CPM, CPD, FOX, AUG, GM, CIP	+	blaTEM, blaCTX-M, blaSHV	0.25	blaDHA, blaEBC	B
7	12/28/2011	Wound	CTX, FOX, AUG	−	blaTEM, blaCTX-M	2	blaACC, blaEBC	C
8	1/12/2011	Wound	CTX, FOX, AUG	−	bla TEM	2	bla EBC	I
9	6/1/2012	Wound	CTX, CAZ, CPM, CPD, FOX, AUG, GM	−	blaTEM, blaCTX-M	2	bla EBC	C
10	12/13/2013	Wound	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM, CIP, LEV	+	blaTEM, blaCTX-M	4	blaEBC, blaCIT	J
11	12/13/2013	Urine	CTX, FOX, AUG	−	blaTEM, blaCTX-M	4	−	K
12	2/25/2014	Urine	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM	−	blaTEM, blaCTX-M	1	blaACC, blaEBC	L
13	3/11/2014	Burn	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, AK, GM, CIP, LEV, GAT	+	blaTEM, blaCTX-M	64	blaEBC, blaCIT	A
14	3/11/2014	Burn	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, AK, GM, CIP, LEV, GAT	+	blaTEM, blaCTX-M	64	bla EBC	A
15	4/22/2014	Urine	CTX, FOX, AUG	−	bla CTX-M	4	bla EBC	M
16	4/25/2014	Respiratory	CTX, CAZ, CPM, CPD, AUG, GM	−	−	4	bla EBC	B
17	4/29/2014	Respiratory	CTX, CAZ, CPM, CPD, FOX, AUG, AK, GM	−	blaTEM, blaCTX-M	4	bla EBC	N
18	5/5/2014	Blood	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, AK, GM, CIP, GAT	+	−	16	−	O
19	5/6/2014	Blood	CTX, CAZ, CPM, CPD, FOX, AUG, IMI	−	blaTEM, blaCTX-M, blaSHV	16	bla EBC	P
20	5/7/2014	Urine	FOX, AUG	−	bla TEM	2	−	Q
21	5/7/2014	Urine	FOX, AUG	−	−	8	bla EBC	R
22	5/15/2014	Wound	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, GM, CIP, LEV, GAT	+	bla SHV	4		S

• CTX: cefotaxime; CAZ: ceftazidime; CPM: cefepime; CPD: cefpodoxime; FOX: cefoxitin; AUG: amoxicillin-clavulanate; IMI: imipenem; MEM: meropenem; ETP: ertapenem; AK: amikacin; GM: gentamicin; CIP: ciprofloxacin; LEV: levofloxacin; GAT: gatifloxacin; MDR: multi-drug resistant; ESBL: extended-spectrum β-lactamase; MIC: minimum inhibitory concentration; RAPD: random amplified polymorphic DNA.

The gene for AmpC, bla _EBC, was detected in only 17 (57%) isolates. Another common AmpC-associated gene, bla _ACC, was detected in 5 (16.6%) isolates. The genes bla _CIT and bla _DHA were detected in only 2 (6.6%) and 2 (6.6%) of E. cloacae isolates, respectively. The genes bla _FOX and bla _MOX were not detected. In addition, we failed to detect carbapenemase genes. The most prevalent genes were rpos and fliI reported in 50 (87.7%) isolates, followed by csgB, csgD, csgA, iutA, and fepA observed in 40 (70.2%), 39 (68.4%), 34 (59.6%), 31 (54.4%), and 29 (50.9%) isolates, respectively. E. cloacae isolates were grouped into 21 RAPD types, which were designated as type A (two isolates) to S (one isolate each) (Table 2). E. aerogenes isolates were grouped into seven RAPD types, which were designated as type A (two isolates) to G (one isolate each) (Table 3). In the present study, the most prevalent species was E. cloacae (77.1%) and its predominance was similar to that reported by Khari et al. and Kanamori et al^2,3. In recent years, E. cloacae is the most common pathogen causing nosocomial infections¹. In this study, 84.3% of isolates were resistant to cefoxitin. High level resistance to cefoxitin has been previously reported by other investigators^2,3, suggesting that treatment with these drugs should be avoided in Enterobacter infections.

TABLE 3:
Characteristics of Enterobacter aerogenes isolates

Isolate ID	Date	Source	Resistance pattern	MDR	ESBL gene	MIC of IMI	AmpC gene	RAPD type
1	2/19/2012	Wound	CTX, AUG	−	bla TEM	2		B
2	2/6/2014	Blood	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, AK, CIP	+	blaTEM, blaCTX-M	4		C
3	2/25/2014	Urine	CTX, CAZ, ETP, GM, CIP	−	blaSHV, blaCTX-M	2		D
4	3/3/2014	Urine	CTX, CAZ, CPM, CPD	−	bla SHV, bla CTX-M	0.625		A
5	3/11/2014	Burn	CTX, CAZ, CPD, FOX, GM	−	bla CTX-M	0.5	bla EBC	E
6	4/22/2014	Respiratory	-	−	bla CTX-M	0.25	bla ACC	F
7	5/15/2014	Wound	CTX, CAZ, CPM, CPD, FOX, AUG, IMI, MEM, ETP, GM, CIP, LEV, GAT	+	bla SHV	0.625		A
8	5/25/2014	Urine	-	−	blaSHV , bla CTX-M	2		G

• CTX: cefotaxime; CAZ: ceftazidime; CPM: cefepime; CPD: cefpodoxime; FOX: cefoxitin; AUG: amoxicillin- clavulanate; IMI: imipenem; MEM: meropenem; ETP: ertapenem; AK: amikacin; GM: gentamicin; CIP: ciprofloxacin; LEV: levofloxacin; GAT: gatifloxacin; MDR: multi-drug resistant; ESBL: extended-spectrum β-lactamase; MIC: minimum inhibitory concentration; RAPD: random amplified polymorphic DNA.

Our study revealed that 35.1%, 12.3%, and 10.5% of isolates were resistant to imipenem, levofloxacin, and gatifloxacin, respectively. Previous reports from Iran have shown that the resistance rate of Enterobacter isolates to imipenem and gatifloxacin was 2% and 7%, respectively¹. Our results indicated the significant increase in the resistance to carbapenem and ciprofloxacin, which may be attributed to the inappropriate and widespread use of antibiotics¹. Of the 30 isolates that were recognized as phenotypically positive for ESBL production in this study, 27 were positive for ESBL genotypes. In the study conducted by Kanamori et al. from Japan, 22 of 364 Enterobacter spp. were identified phenotypically positive for ESBL production, but only 11 isolates harbored ESBL genes; ESBL genes were undetected in the remaining 11 isolates². Discrepancy between disc tests and PCR detection results may be associated with the lack of any standardized method for the detection of ESBLs in Enterobacter spp². In the present survey, 30 (52.6%) Enterobacter isolates were found to be ESBL producers. Kanamori et al. also reported that 6% Enterobacter spp. were ESBL producers². The high prevalence of ESBL-positive isolates in our study may be associated with the extensive use of third-generation cephalosporins for the treatment of Enterobacter infections. It should be noted that 10% (3/30) isolates were ESBL negative and eight isolates that were recognized phenotypically positive for carbapenemase failed to show any carbapenemase-related genes, suggestive of the involvement of other resistance mechanisms. In our study, 26.7% (8/30) of ESBL-positive isolates were MDR. Peymani et al. reported that all ESBL-positive Enterobacter isolates were MDR¹. In our study, bla _TEM and bla _CTX-M were the most common ESBL resistance genes, which were frequently reported in other countries². In the present study, bla _EBC (57.7%) was the most common type of AmpC β-lactamase, followed by bla _ACC (16.6%). Miró et al. reported that the CMY (78.3%) and DHA (19.5%) families were the most prevalent type of AmpC β-lactamase in 35 hospitals in Spain¹³. However, the prevalence of ESBL and AmpC-producing Enterobacter spp. varied among different studies, which may be associated with the differences in the geographical area, type of infection, and settings (hospital or community). Similar to previous reports, we observed the coexistence of ESBL-encoding genes in clinical isolates^1,2. Several virulence factors have been identified in the pathogenesis of Enterobacter spp^4-7. The majority of isolates (87.7%) carried rpos and fliI. The high frequency of these genes may indicate that these genes are essential for the development of disease. In contrast to the findings of our study, Krzyminska et al. observed that only 27% of isolates harbored fliI (TTSS gene)⁶. In the current study, the frequency of csgB, csgD, and csgA was 70.2%, 68.4%, and 59.6%, respectively, which is lower than that reported in the previous study by Akbari et al. These authors showed that csgD and csgA genes were present in 100% and 77.75% of isolates, respectively¹⁴. The genes iutA and fepA were found in 54.4% and 50.9% of isolates in our study. Mokracka et al. reported that 49% of E. cloacae strains produced aerobactin¹⁵. However, differences were observed in the frequency of virulence genes reported in different studies; this difference may be associated with the variation in the geographical area, clinical samples, and other factors. RAPD-PCR analysis revealed the significant genetic heterogeneity. In addition, molecular analysis demonstrated that more than 90% (28/30) of ESBL-producing isolates were clonally unrelated, indicating that the reported infections had no relation with clonal outbreak. In conclusion, bla _TEM, bla _CTX-M, and bla _EBC are the most common resistance gene types and more than 50% of isolates harbored virulence genes. RAPD-PCR analysis revealed high genetic diversity among isolates.

REFERENCES

• ¹
  Peymani A, Farivar TN, Sanikhani R, Javadi A, Najafipour R. Emergence of TEM, SHV, and CTX-M-extended spectrum beta-lactamases and class 1 integron among Enterobacter cloacae isolates collected from hospitals of Tehran and Qazvin, Iran. Microb Drug Resist. 2014;20(5):424-30.
• ²
  Kanamori H, Yano H, Hirakata Y, Hirotani A, Arai K, Endo S, et al. Molecular characteristics of extended-spectrum beta-lactamases and qnr determinants in Enterobacter species from Japan. PLoS One. 2012;7(6):e37967.
• ³
  Mohd Khari FI, Karunakaran R, Rosli R, Tee Tay S. Genotypic and phenotypic detection of ampC beta-lactamases in Enterobacter spp. isolated from a Teaching Hospital in Malaysia. PLoS One . 2016;11(3):e0150643.
• ⁴
  Kim SM, Lee HW, Choi YW, Kim SH, Lee JC, Lee YC, et al. Involvement of curli fimbriae in the biofilm formation of Enterobacter cloacae J Microbiol. 2012;50(1):175-8.
• ⁵
  Dong T, Schellhorn HE. Role of RpoS in virulence of pathogens. Infect Immun. 2010;78(3):887-97.
• ⁶
  Krzyminska S, Mokracka J, Koczura R, Kaznowski A. Cytotoxic activity of Enterobacter cloacae human isolates. FEMS Immunol Med Microbiol. 2009;56(3):248-52.
• ⁷
  Johnson JR, Moseley SL, Roberts PL, Stamm WE. Aerobactin and other virulence factor genes among strains of Escherichia coli causing urosepsis: association with patient characteristics. Infect Immun . 1988;56(2):405-12.
• ⁸
  Mahon CR, Lehman DC, Manuselis G. Textbook of Diagnostic Microbiology. 5^th edition. New York: Saunders; 2015. p: 429-30.
• ⁹
  Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. Document M02-A12, M07-A10, and M11-A8. Wayne, PA: CLSI; 2017.
• ¹⁰
  Neyestanaki DK, Mirsalehian A, Rezagholizadeh F, Jabalameli F, Taherikalani M, Emaneini M. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns. 2014;40(8):1556-61.
• ¹¹
  Perez-Perez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002;40(6):2153-62.
• ¹²
  Mahenthiralingam E, Campbell ME, Foster J, Lam JS, Speert DP. Random amplified polymorphic DNA typing of Pseudomonas aeruginosa isolates recovered from patients with cystic fibrosis. J Clin Microbiol . 1996;34(5):1129-35.
• ¹³
  Miro E, Aguero J, Larrosa MN, Fernandez A, Conejo MC, Bou G, et al. Prevalence and molecular epidemiology of acquired AmpC beta-lactamases and carbapenemases in Enterobacteriaceae isolates from 35 hospitals in Spain. Eur J Clin Microbiol Infect Dis . 2013;32(2):253-9.
• ¹⁴
  Akbari M, Bakhshi B, Najar Peerayeh S, Behmanesh M. Detection of Curli Biogenesis Genes Among Enterobacter cloacae Isolated From Blood Cultures. Int J Enteric Pathog. 2015;3(4):e28413.
• ¹⁵
  Mokracka J, Koczura R, Kaznowski A. Yersiniabactin and other siderophores produced by clinical isolates of Enterobacter spp. and Citrobacter spp. FEMS Immunol Med Microbiol . 2004;40(1):51-5.

• Financial support: This research has been supported by Tehran University of Medical Science of Health Services grant 25744/93-02-30.

Publication Dates

• Publication in this collection
  Jan-Feb 2018

History

• Received
  31 May 2017
• Accepted
  18 Sept 2017