Detection of virulence genes and antimicrobial susceptibility profile of Listeria monocytogenes isolates recovered from artisanal cheese produced in the Southern region of Brazil

Abstract

Listeria monocytogenes is an opportunistic pathogen that causes listeriosis, a foodborne disease with low incidence but with high mortality rate in humans. This microorganism has been recovered from several dairy products, especially those produced with raw milk. The objective of this work was to investigate the presence of virulence genes, and also to define the antimicrobial susceptibility profile of L. monocytogenes isolates recovered from serrano artisanal cheese produced in Southern region of Brazil. Nine strains of L. monocytogenes (serotypes 1/2b and 4b) were evaluated through PCR to detect the presence of the virulence genes hly, inlA, inlC, inlJ, actA, plcB and iap, while antimicrobial susceptibility profile was determined via disk diffusion method. All strains exhibited the presence of the genes hly and plcB, whereas the other genes (iap, actA, inlA, inlC and inlJ) were only detected in eight strains. We verified that all strains were resistant to at least one antimicrobial agent and three of them showed multidrug resistance. These findings demonstrated the serrano artisanal cheese offers risks to consumers’ health and point to a need of adaptations and monitoring of manufacturing process of this food, in order to prevent the dissemination of L. monocytogenes.

Key words
dairy products; multidrug resistance; raw milk; virulence genes

INTRODUCTION

Listeria monocytogenes is a pathogen that causes listeriosis, a serious foodborne disease that can be fatal. The overall mortality rate is estimated in 30%, especially in those with underlying diseases and/or immunosuppressed status, elderly and fetus or neonate (Drevets & Bronze 2008, Lecuit 2007). Listeria monocytogenes is a concern in the food industry, since it is found in various environments, and it grows under different conditions, such as low temperatures, high salt concentrations and wide pH range (from 4.5 to 9.0) (Guenther et al. 2009, Walker et al. 1990).

This microorganism has been recovered from several types of food, among which serrano artisanal cheese (Melo et al. 2013, Pontarolo et al. 2017), a product typically manufactured in the highland fields the South of Brazil with raw milk obtained from dairy cattle subjected to natural grazing-pasture management (Pereira et al. 2014). The raw milk contaminated by L. monocytogenes introduced into the food processing environment and used to manufacture unpasteurized cheese is a serious threat to human health, due to the specific abilities of this pathogen to resist numerous stresses (Kousta et al. 2010). For that reason, its control continues to be a challenge for food processing (Melo et al. 2015).

There are thirteen recognized serotypes of L. monocytogenes, which are distributed into four genetic lineages (Orsi et al. 2011), being more than 95% of human listeriosis commonly associated with isolates that belong to serotypes 4b, 1/2a and 1/2b (Doumith et al. 2004, Kasper et al. 2009). The pathogenicity of L. monocytogenes is determined by several virulence factors, such as: listeriolysin O (LLO), internalins, phospholipases, actin assembly-inducing protein (ActA), invasion-associated protein (p60) and regulatory system for gene expression of virulence (PrfA) (Liu 2006).

Listeria monocytogenes is usually susceptible to several antimicrobial agents. However, recent studies have shown an emergence of isolates recovered from food samples, which are resistant to antibiotics commonly used for human listeriosis therapy (Fallah et al. 2013, Kevenk & Gulel 2016, Noll et al. 2018, Tahoun et al. 2017). This fact is of great concern, since L. monocytogenes is able to develop resistance mechanisms or to acquire resistance through transmission of genetic material of other bacterial species at the food-processing environment (Allen et al. 2016, Bertsch et al. 2013, Toomey et al. 2009).

Therefore, the objective of the present study was to investigate the presence of virulence genes and to define the antimicrobial susceptibility profile of L. monocytogenes isolates obtained from serrano artisanal cheese samples manufactured in the South region of Brazil, Santa Catarina State.

MATERIALS AND METHODS

Bacterial isolates

A total of nine strains of Listeria monocytogenes, serotypes 1/2b (n=2) and 4b (n=7), recovered from serrano artisanal cheese were used in this study. Strains were isolated in previous investigations performed by Melo et al. (2013) and Pontarolo et al. (2017) at Centro de Diagnóstico Microbiológico Animal (CEDIMA) of Universidade do Estado de Santa Catarina (UDESC), in partnership with serrano artisanal cheese producers from Santa Catarina, southern region of Brazil. In these studies, a total of 170 cheeses were analyzed and L. monocytogenes was isolated in nine cheeses (5.29%).

Bacterial DNA extraction

Isolation of genomic DNA from recovered and quality control strains (L. moncytogenes ATCC EGD-e and E. coli ATCC 25922) was performed from the protocol described by Doyle & Doyle (1987) with some modifications. Bacterial strains were cultivated in Brain Heart Infusion (BHI) broth for 24 h at 37ºC. A total of 200µL of each inoculum was transferred to a sterile microtube. 500µL of chloroform: isoamyl alcohol (24:1) were added and this mixture was further incubated in a water-bath for 30 min at 56ºC. After that, microtubes were centrifuged for 10 min at 12,000 rpm. The retrieved supernatant was transferred to another sterile microtube and 600µL of 70% alcohol were added. This mixture was centrifuged for 20 min at 13,500 rpm. The supernatant was discarded by inversion, and pellet was allowed to air-dry. The dried pellet was resuspended with 200µL of sterile Milli-Q water.

Virulence genes detection

The presence of seven genes encoding virulence factors of L. monocytogenes were investigated in this study: internalin A (inlA), internalin C (inlC), internalin J (inlJ), actin assembly-inducing protein (actA), phospholipase C - PC-PLC (plcB), listeriolysin O, invasion-associated protein - p60 (iap). Multiplex PCR described by Liu et al. (2007) was used to investigate the presence of virulence genes inlA, inlC and inlJ, whereas an adaptation of Cao et al. (2018)’s protocol was carried out for the detection of the other genes (actA, plcB, hly and iap).

PCR reaction was carried out in 25 μL final volume of reaction mixture that contained PCR buffer (Tris-HCl - 20mM, KCl - 50mM), MgCl₂ (2mM), dNTP (200mM of each), Taq DNA polimerase (0.5U), primers (4 pmol of each) and bacterial DNA (2µl). Amplification was performed using a denaturation step of 94°C for 4 min, followed by 32 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 60 s. A final extension step at 72°C for 10 min was applied. Amplicons were electrophoresed (100V, 300mA) on 2% agarose gel for 1h. After that, we stained the agarose gel with GelRed^TM and amplified fragments were visualized on transilluminator (Kasvi, model K33-312, Brazil). The used primers are listed on Table I. All reagents were purchased from Invitrogen® (Carlsbad, USA) and reactions were carried out in Thermal Cycler Applied Biosystem (model MJ96, Thermo Fisher, USA). Quality control strains Listeria monocytogenes EGD-e and Escherichia coli ATCC 25922 were used as positive and negative controls, respectively.

Table I
List of primers used to detect virulence genes in Listeria monocytogenes isolates.

Gene	Oligonucleotide sequence (5’-3’)	Size of amplicon (bp)	Virulence factor	Described by:
inlA	F: ACGAGTAACGGGACAAATGC R: CCCGACAGTGGTGCTAGATT	800	Internalin A	Liu et al. (2007)
inlC	F: AATTCCCACAGGACACAACC R: CGGGAATGCAATTTTTCACTA	517	Internalin C
inlJ	F: TGTAACCCCGCTTACACAGTT R: AGCGGCTTGGCAGTCTAATA	238	Internalin J
actA	F: TGCATTACGATTAACCCCGACA R: AGGCTTTCAAGCTCACTATCCG	431	Actin assembly-inducing protein	Cao et al. (2018)
plcB	F: AGTGTTCTAGTCTTTCCGG R: ACCTGCCAAAGTTTGCTGT	792	Phospholipase C (PC-PLC)
hly	F: ACGCAGTAAATACATTAGTG R: AATAAACTTGACGGCCATAC	372	Listeriolysin O
iap	F: TTTGCTAAAGCGGGTATCTC R: AGCCGTGGATGTTATCGTAT	205	Invasion-associated protein (p60)

Determination of antimicrobial susceptibility profile

The antimicrobial susceptibility test of the strains was carried out according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) using disk diffusion method in Mueller-Hinton agar supplemented with 5% defibrinated horse blood and 20 mg/L β-NAD (EUCAST 2018). The strains were tested for their susceptibility to the following antimicrobial agents: benzylpenicillin (PEN, 1unit), ampicillin (AMP, 2µg), meropenem (MER, 10µg), erythromycin (ERI, 15µg) and trimethoprim/sulfamethoxazole (TMP/SMX 1.25 / 23.75 µg). Results of growth inhibition zone were interpreted according to current EUCAST (2018) guidelines established for L. monocytogenes. Besides that, ciprofloxacin (CIP, 5µg), levofloxacin (LVX, 5µg), gentamicin (GEN, 10µg), clindamycin (CLI, 2µg), tetracycline (TET, 30µg), chloramphenicol (CLO, 30µg) and rifampicin (RIF, 5µg) were also tested. However, interpretation of these results were performed based on the critical points recommended by EUCAST (2018) for Staphylococcus spp., since there are not established breakpoints of these antibiotics for L. monocytogenes. We used Streptococcus pneumoniae ATCC 49619 and Staphylococcus aureus ATCC 29213 as quality control strains to define antimicrobial susceptibility profile.

RESULTS AND DISCUSSION

A total of nine strains of L. monocytogenes recovered from artisanal cheese, classified as 1/2b (n=2) and 4b (n=7) serotypes, were analyzed for the presence of seven virulence genes. The low number of strains analyzed is a limitation of this study, since its occurrence in foods is rare. The genes hly and plcB were detected in all strains, whereas the others (iap, actA, inlA, inlC e inlJ) were found in eight strains (Table II). Coroneo et al. (2016) reported similar results in L. monocytogenes isolates from cheese in Italy, with variable rates of virulence gene detection. In addition, other studies also demonstrated similar finding in samples obtained from different types of food, raw milk, milking machine, worker’s hands and clinical specimens (Du et al. 2017, Su et al. 2016, Tahoun et al. 2017). However, studies based on several types of food have documented the presence of virulence genes in all examined L. monocytogenes isolates (Almeida et al. 2017, Iglesias et al. 2017, Jamali et al. 2013, Mammina et al. 2009, Oliveira et al. 2018).

Table II
Profile of virulence and antimicrobial susceptibility of Listeria monocytogenes isolates recovered from serrano artisanal cheese.

Isolates	Serotype	Virulence genes *							Antimicrobial resistance **
		hly	inlA	inlC	inlJ	actA	plcB	iap
Lm1	1/2b	+	-	-	-	-	+	-	TMP/SMX, CLI, RIF
Lm2	4b	+	+	+	+	+	+	+	TMP/SMX, CIP, CLI, RIF
Lm3	4b	+	+	+	+	+	+	+	TMP/SMX, CLI
Lm4	1/2b	+	+	+	+	+	+	+	CLI, LVX
Lm5	4b	+	+	+	+	+	+	+	TMP/SMX, RIF
Lm6	4b	+	+	+	+	+	+	+	TMP/SMX, CLI
Lm7	4b	+	+	+	+	+	+	+	CLI
Lm8	4b	+	+	+	+	+	+	+	CIP, CLI
Lm9	4b	+	+	+	+	+	+	+	ERI, TMP/SMX, CIP, CLI, LVX, TET, RIF

• * (+) = presence; (-) = absence. ** CIP – ciprofloxacin; CLI – clindamycin; ERI – erythromycin; LVX – levofloxacin; RIF – rifampicin; TET – tetracycline; TMP/SMX – trimethoprim/sulfamethoxazole.

It is known that some polymorphisms and punctual mutations, present in certain virulence genes, could contribute for attenuated-virulence from L. monocytogenes strains (Orsi et al. 2011, Van Stelten et al. 2010). Based on that, absence or presence of virulence factors could be a tool to assess not only the risks related with food product consumption, but also those associated with strain-specific virulence parameters of L. monocytogenes (Jacquet et al. 2004).

We findings that eight strains were positive for all virulence factors investigated (Table II). The pathogenicity of L. monocytogenes is defined by several virulence factors, in particular the family of internalins, bacterial surface proteins responsible for internalization (entry) of L. monocytogenes into cells (InlA, InlB) (Bonazzi et al. 2009, Hamon et al. 2006); and dissemination between cells (InlC) (Rajabian et al. 2009). Another crucial role is played by listeriolysin O (LLO), a protein responsible for survival and intracellular multiplication of this pathogen, since it allows bacterial phagosomal escape to the cytoplasm of infected host cells (Hamon et al. 2012, Ruan et al. 2016). Based on that, the L. monocytogenes replicates, but intracellular movement and cell-to-cell dissemination will only occur with help of ActA protein, which will induce polymerization of actin and, consequently, actin-filament formation inside of the host cells (Cameron et al. 1999, Kocks et al. 1995). In addition to these virulence factors, we should also mention the phospholipases C, such as PC-PLC (PlcB), that acts in synergy with LLO to amplify phagocytic vacuole’s lysis (Camilli et al. 1993, Gedde et al. 2000); and the protein (p60) encoded by the gene iap, which is necessary for a successful invasion (Camejo et al. 2011).

The presence of the virulence genes demonstrate the potential pathogenicity of these strains. This finding provides evidence of a serious health public issue, since these strains represent a potential threat (Listeriosis) to serrano artisanal cheese consumers, especially those from the risk groups (pregnant women, elderly and immunocompromised individuals).

Regarding antimicrobial susceptibility, L. monocytogenes isolates had their sensitivity to a panel of 12 antibiotics investigated. All strains were resistant to at least one antimicrobial agent, while three of them exhibited a multidrug resistance profile (resistance to three or more antimicrobial agent classes) (Table II). Our results are in line with previous studies that demonstrated isolation rates ranging from 21% to 88% of multidrug resistant L. monocytogenes recovered from different types of food, among them raw milk and raw dairy products (Fallah et al. 2013, Harakeh et al. 2009, Kevenk & Gulel 2016, Noll et al. 2018, Tahoun et al. 2017). L. monocyotogenes strains were more frequently resistant to clindamycin, trimethoprim/sulfamethoxazole, rifampicin and ciprofloxacin. On the other hand, all strains were susceptible to ampicillin, benzylpenicillin, meropenem, gentamicin and chloramphenicol (Table III). Similarly, Tahoun et al. (2017) evaluated patterns of antimicrobial resistance of L. monocytogenes isolates, recovered from raw milk, milking equipment, and hand swabs collected in Egyptian dairy farms. The authors observed a high resistance rate of these isolates to clindamycin and rifampicin. Furthermore, recent studies carried out worldwide (Brazil, China and Spain) detected high prevalence (ranging from 35 to 81%) of resistant L. monocytogenes isolates to clindamycin, which were recovered from different types of food (Du et al. 2017, Gómez et al. 2014, Oliveira et al. 2018). In relation to other agents, there are reports about high prevalence of L. monocytogenes isolates, recovered from different types of food, to sulfonamide in Brazil (Iglesias et al., 2017) and to ciprofloxacin in Egypt (El Banna et al. 2016) and China (Wang et al. 2013).

Table III
Antimicrobial susceptibility profile of L. monocytogenes isolates from serrano artisanal cheese.

Antimicrobial agents	No. of isolates (%)
	Resistant (R)	Susceptible (S)
Ampicillin (2µg)	-	9 (100)
Benzylpenicillin (1unit)	-	9 (100)
Meropenem (10µg)	-	9 (100)
Erythromycin (15µg)	1 (11.1)	8 (88.9)
Trimethoprim/sulfamethoxazole (1.25/23.75µg)	6 (66.7)	3 (33.3)
Ciprofloxacin (5µg)	3 (33.3)	6 (66.7)
Levofloxacin (5µg)	1 (11.1)	8 (88.9)
Gentamicin (10µg)	-	9 (100)
Clindamycin (2µg)	8 (88.9)	1 (11.1)
Tetracycline (30µg)	1 (11.1)	8 (88.9)
Chloramphenicol (30µg)	-	9 (100)
Rifampicin (5µg)	4 (44.5)	5 (55.5)

However, most of the resistance detected in the L. monocytogenes strains was against antimicrobials without breakpoints for this microorganism and the interpretation parameters used were the breakpoints for Staphylococcus spp.

Studies reported the ability to transfer antimicrobial resistance genes between L. monocytogenes and other microorganisms in food matrices such as milk and cheese (Bertsch at al. 2013, Toomey et al. 2009). This fact emphasizes a critical problem in the food industry, since L. monocytogenes strains endures in food processing plants persistently for years or even decades (Ferreira et al. 2014). Survival or growth of this microorganism on surfaces of difficult hygienization in the food processing environment could be related to this endurance, or also the repeatedly reintroduction of this pathogen from external to processing environment through raw material, equipment or production workers (Buchanan et al. 2017). Therefore, serrano artisanal cheese-processing plants require especial attention, since this cheese is a raw milk product and its production and storage (depends on maturation period) are commonly precarious, which means that do not follow the established hygienic-sanitary guidelines.

Contaminated environments can create optimal conditions for different types of bacteria to promote genetic material exchange, particularly for those products that require extended period of preparation and storage. Although resistance mechanisms for L. moncytogenes are still not well established, it is plausible that this microorganism acquires and disseminates mobile genetic elements that codify antimicrobial resistance genes derived from other pathogens in the food processing environment (Allen et al. 2016, Bertsch et al. 2013, Toomey et al. 2009).

CONCLUSIONS

In conclusion, our study clearly showed that L. monocytogenes isolates from serrano artisanal cheese revealed the presence of the major virulence factors involved in its pathogenicity. Besides that, antimicrobial susceptibility investigation exhibited a high index of resistance to multiple agents used for human listeriosis treatment. Consequently, it is important to develop strategies to face efficiently microbial safety challenges and to monitor strictly the raw milk cheese processing. By that, we will not only prevent dissemination of this microorganism, but we will also reassure that this product does not offer risks to consumers’ health.

ACKNOWLEDGMENTS

We thank the Fundação Oswaldo Cruz (Fiocruz) for providing the reference strains.

REFERENCES

• Allen KJ, Wallecka-Zacharska E, Chen JC, Katarzyna K, Devlieghere F, Meervenne EV, Osek J, Wieczorek K & Bania J. 2016. Listeria monocytogenes – An examination of food chain factors potentially contributing to antimicrobial resistance. Food Microbiol 54: 178-189.
• Almeida RM, Barbosa AV, Lisbôa RC, Santos AFM, Hofer E, Vallim DC & Hofer CB. 2017. Virulence genes and genetic relationship of L. monocytogenes isolated from human and food sources in Brazil. Braz J Infect Dis 21: 282-289.
• Bertsch D, Uruty UM, Anderegg J, Lacroix C & Meile L. 2013. Tn6198, a novel transposon containing the trimethoprim resistance gene dfrG embedded into a Tn916 element in Listeria monocytogenes. J Antimicrob Chemother 68: 986-991.
• Bonazzi M, Lecuit M & Cossart P. 2009. Listeria monocytogenes internalin and e-cadherin: from bench to bedside. Cold Spring Harb Perspect Biol 1: a003087.
• Buchanan RL, Gorris LGM, Hayman MM, Jackson TC & Whiting RC. 2017. A review of Listeria monocytogenes: An update on outbreaks, virulence, dose-response, ecology, and risk assessments. Food Control 75: 1-13.
• Camejo A, Carvalho F, Reia O, Leitão E, Sousa S & Cabanes D. 2011. The arsenal of virulence factors deployed by Listeria monocytogenes to promote its cell infection cycle. Virulence 2: 379-394.
• Cameron LA, Footer MJ, van Oudenaarden A & Theriot JA. 1999. Motility of ActA protein-coated microspheres driven by actin polymerization. Proc Natl Acad Sci 96: 4908-4913.
• Camilli A, Tilney LG & Portnoy DA. 1993. Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol Microbiol 8: 143-157.
• Cao X, Wang Y, Wang Y & Changyun Y. 2018. Isolation and characterization of Listeria monocytogenes from the black-headed gull feces in Kunming, China. J Infect Public Health 11: 59-63.
• Coroneo V, Carraro V, Aissani N, Sanna A, Ruggeri A, Succa S, Meloni B, Pinna A & Sanna C. 2016. Detection of virulence genes and growth potential in Listeria monocytogenes strains isolated from Ricotta Salata cheese. J Food Sci 8: 2016.
• Doumith M, Cazalet C, Simoes N, Frangeul L, Jacquet C, Kunst F, Martin P, Cossart P, Glaser P & Buchrieser C. 2004. New aspects regarding evolution and virulence of Listeria monocytogenes revealed by comparative genomics and DNA arrays. Infect Immun 72: 1072-1083.
• Doyle JJ & Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11-15.
• Drevets D & Bronze MS. 2008. Listeria monocytogenes: epidemiology, human disease, and mechanisms of brain invasion. FEMS Immunol Med Microbiol 53: 151-165.
• Du X, Zhang X, Wang X, Su Y, Li P & Wang S. 2017. Isolation and characterization of Listeria monocytogenes in chinese food obtained from the central area of China. Food Control 74:9-16.
• El Banna TE, Sonbol FI, Zaki ME & El-Sayyad HHI. 2016. Clinical and environmental prevalence and antibiotic susceptibility of Listeria monocytogenes in Dakahlea Governorate, Egypt. Clin Microbiol 5: 249.
• EUCAST. 2018. Breakpoint tables for interpretation of MICs and zone diameters. European Committee on Antimicrobial Susceptibility Testing. Version 8.0.
• Fallah AA, Saei-Dehkordi SS & Mahzounieh M. 2013. Occurrence and antibiotic resistance profiles of Listeria monocytogenes isolated from seafood products and market and processing environments in Iran. Food Control 34: 630-636.
• Ferreira V, Wiedmann M, Teixeira P & Stasiewicz MJ. 2014. Listeria monocytogenes persistence in food-associated environments: epidemiology, strain characteristics, and implications for public health. J Food Prot 77: 150-170.
• Gedde MM, Higgins DE, Tilney LG & Portnoy DA. 2000. Role of listeriolysin O in cell-to-cell spread of Listeria monocytogenes. Infect Immun 68: 999-1003.
• Gómez D, Azón E, Marco N, Carramiñana JJ, Rota C, Ariño A & Yangüela J. 2014. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment. Food Microbiol 42: 51-65.
• Guenther S, Huwyler D, Richard S & Loessner MJ. 2009. Virulent bacteriophage for efficient biocontrol of Listeria monocytogenes in ready-to-eat foods. Appl Environ Microbiol 75: 93-100.
• Hamon MA, Ribet D, Stavru F & Cossart P. 2012. Listeriolysin O: the swiss army knife of Listeria. Trends Microbiol 20: 360-368.
• Hamon M, Bierne H & Cossart P. 2006. Listeria monocytogenes: a multifaceted model. Nat Rev Microbiol 4: 423-434.
• Harakeh S, Saleh I, Zouhairi O, Baydoun E, Barbour E & Alwan N. 2009. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. Sci Total Environ 407: 4022-4027.
• Iglesias MA, Kroning IS, Decol LT, Franco BDGM & Silva WP. 2017. Occurrence and phenotypic and molecular characterization of Listeria monocytogenes and Salmonella spp. in slaughterhouses in southern Brazil. Food Res Int 100: 96-101.
• Jacquet C, Doumith M, Gordon JI, Martin PMV, Cossart P & Lecuit M. 2004. A Molecular marker for evaluating the pathogenic potential of foodborne Listeria monocytogenes. J Infect Dis 189: 2094-2100.
• Jamali H, Radmehr B & Thong KL. 2013. Prevalence, characterization, and antimicrobial resistance of Listeria species and Listeria monocytogenes isolates from raw milk in farm bulk tanks. Food Control 34: 121-125.
• Kasper S, Huhulescu S, Auer B, Heller I, Karner F, Würzner R, Wagner M & Allerberger F. 2009. Epidemiology of listeriosis in Austria. Wien Kiln Wochenschr 121: 113-119.
• Kevenk TO & Gulel GT. 2016. Prevalence, antimicrobial resistance and serotype distribution of Listeria monocytogenes isolated from raw milk and dairy products. J Food Saf 36: 11-18.
• Kocks C, Marchand JB, Gouin E, d’Hauteville H, Sansonetti PJ, Carlier MF & Cossart P. 1995. The unrelated surface proteins ActA of Listeria monocytogenes and IcsA of Shigella flexneri are sufficient to confer actin-based motility on Listeria innocua and Escherichia coli respectively. Mol Microbiol 18: 413-423.
• Kousta M, Mataragas M, Skandamis P & Drosinos DH. 2010. Prevalence and sources of cheese contamination with pathogens at farm and processing levels. Food Control 21: 805-815.
• LECUIT M. 2007. Human listeriosis and animal models. Microbes Infect 9: 1216-1225.
• LIU, D. 2006. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol 55: 645-659.
• Liu D, Lawrence ML, Austin FW & Ainsworth AJ. 2007. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. J Microbiol Methods 71: 133-140.
• Mammina C, Aleo A, Romani C, Pellissier N, Nicoletti P, Pelcile P, Natasi a & Pontello MM. 2009. Characterization of Listeria monocytogenes isolates from human listeriosis cases in Italy. J Clin Microbiol 47: 2925-2930.
• Melo FD, Dalmina KA, Pereira MN, Ramella MV, Neto AT, VaZ EK & Ferraz SM. 2013. Evaluation of the safety and quality of microbiological handmade cheese serrano and its relation to physical and chemical variables the period of maturity. Acta Sci Vet. 41: 1152.
• Melo J, Andrew PW & Faleiro ML. 2015. Listeria monocytogenes in cheese and the dairy environment remains a food safety challenge: The role of stress responses. Food Res Int 67: 75-90.
• Noll M, Kleta S & Dahouk SA. 2018. Antibiotic susceptibility of 259 Listeria monocytogenes strains isolated from food, food-processing plants and human samples in Germany. J Infect Public Health 11:572-577.
• Oliveira TS, Varjão LM, Silva LNN, Pereira RCB, Hofer E, Vallim DC & Almeida RCC. 2018. Listeria monocytogenes at chicken slaughterhouse: occurrence, genetic relationship among isolates and evaluation of antimicrobial susceptibility. Food Control 88: 131-138.
• Orsi RH, den Bakker HC & Wiedmann M. 2011. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol 301: 79-96.
• Pereira BP, Vieira TR, Valent JZ, Bruzza A, Wagner SA, Pinto AT & Schmidt V. 2014. Implications of the quality of the production process artisan cheese serrano. REGET 18: 116-126.
• Pontarolo GH, Melo FD, Martini CL, Wildemann P, Alessio DRM, Sfaciotte RAp, Neto AT, Vaz EK & Ferraz SM. 2017. Quality and safety of artisan cheese produced in the Serrana region of Santa Catarina. Semina: Ciênc Agrár 38: 739-748.
• Rajabian T, Gavicherla B, Heisig M, Müller-Altrock S, Goebel W, Gray-Owen SD & Ireton K. 2009. The bacterial virulence factor InlC perturbs apical cell junctions and promotes cell-to-cell spread of Listeria. Nat Cell Biol 11: 1212-1218.
• Ruan Y, Reselj S, Zavec AB, Anderluh G & Scheuring S. 2016. Listeriolysin O membrane damaging activity involves arc formation and lineaction - Implication for Listeria monocytogenes escape from phagocytic vacuole. PLoS Pathog 12: e1005597.
• Su X, Zhang J, Shi W, Yang X, Li Y, Pan H, Kuang D, Xu X, Shi X & Meng J. 2016. Molecular characterization and antimicrobial susceptibility of Listeria monocytogenes isolated from foods and humans. Food Control 70: 96-102.
• Tahoun ABMB, Abou Elez RMM, Abdelfatah EN, Elsohaby I, El-Gedawy AA & Elmoslemany AM. 2017. Listeria monocytogenes in raw milk, milking equipment and dairy workers: Molecular characterization and antimicrobial resistance patterns. J Glob Antimicrob Resist 10: 264-270.
• Toomey N, Monaghan A, Fanning S & Bolton DJ. 2009. Assessment of antimicrobial resistance transfer between lactic acid bacteria and potential foodborne pathogens using in vitro methods and mating in a food matrix. Foodborne Pathog Dis 6: 925-933.
• Van Stelten A, Simpson JM, Ward TJ & Nightingale KK. 2010. Revelation by single-nucleotide polymorphism genotyping that mutations leading to a premature stop codon in inlA are common among Listeria monocytogenes isolates from ready-to-eat foods but not human listeriosis cases. Appl Environ Microbiol 76: 2783-2790.
• Walker SJ, Archer P & Banks JG. 1990. Growth of Listeria monocytogenes at refrigeration temperatures. J Appl Bacteriol 68: 157-162.
• Wang X, Lü X, Yin L, Liu H, Zhang W, Si W, Yu S, Shao M & Liu S. 2013. Occurrence and antimicrobial susceptibility of Listeria monocytogenes isolates from retail raw foods. Food Control 32: 153-158.

Publication Dates

• Publication in this collection
  30 Apr 2021
• Date of issue
  2021

History

• Received
  19 Feb 2019
• Accepted
  13 May 2019