Fatty Acid Incorporation in the Muscle, Oxidative Markers, Lipid Peroxidation and PPAR-α and SREBP-2 Expression of Zebrafish Fed Linseed Oil and Clove Leaf Essential Oil

Abstract

The objective of this study is to assess, in zebrafish, the effects of combining linseed oil (LO) and clove leaf essential oil (CLEO) on the incorporation of fatty acids in the muscle, oxidative markers, lipid peroxidation and expression of the PPAR-α (Peroxisome Proliferator-Activated Receptor-α) and the SREBP-2 (Sterol Regulatory Element Binding Protein-2) genes. Six diets were prepared, containing combinations of LO (3, 6 and 9%) and CLEO (0.5 and 1%): 3% LO + 0.5% CLEO; 3% LO + 1% CLEO; 6% LO + 0.5% CLEO; 6% LO + 1% CLEO; 9% LO + 0.5% CLEO; 9% LO + 1% CLEO. Results showed increase in the incorporation of n-3 fatty acids in the muscle concomitantly with the addition of LO and CLEO. The activities of superoxide dismutase and catalase were reduced and the glutathione content had increased. Lipid peroxidation was lower in the treatment with 1% CLEO, regardless of LO content. The expression of the PPAR-α and the SREBP-2 genes was higher in animals fed 9% LO + 0.5% CLEO. Therefore, for a greater incorporation and protection against the oxidative damages of n-3 fatty acids, a combined use of 9% LO with 0.5% CLEO is recommended for zebrafish.

Key words
Antioxidant; α-linolenic acid; Danio rerio; eugenol; vegetable oil

INTRODUCTION

Linseed oil stands out from other vegetable oils for being one of the richest sources of α-linolenic acid, a precursor to eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), which are physiologically important, with known immune functions (Nayak et al. 2017, Popa et al. 2012).

However, for a greater incorporation of these fatty acids in the muscle tissue, an antioxidant protection is required, as excessive amounts in the diet can increase the rate of lipid unsaturation in the tissues of fish and make them prone to attacks by free radicals (ROS), generated as by-products of normal cellular oxygen metabolism or by external tensions (Kiron et al. 1995). These ROS, such as hydrogen peroxide, superoxide and hydroxyl, can attack the phospholipid membrane of cells, react with cellular proteins and nucleic acids and damage these cells, causing immunosuppression (Sotoudeh et al. 2015).

The organism, to protect cells from damage, has developed protective mechanisms against the action of antioxidant enzymes, such as catalase (CAT), glutathione-peroxidase (GPx), glutathione S-transferase (GST), glutathione reductase (GR) and superoxide dismutase (SOD) (Halliwell & Gutteridge 2007). When the ROS production rate is greater than the elimination capacity of the defense system, an exogenous antioxidant becomes necessary, which may come from diets. In this regard, clove oil presents the greatest antioxidant capacity among commonly marketed essential oils (Teixeira et al. 2013).

The main component of clove leaf oil is eugenol, to which many antioxidant properties are attributed. Gülçin et al. (2012) showed that clove oil inhibited 97.3% of lipid peroxidation in linoleic acid emulsion at a concentration of 15 μg/mL. The protective effect of 0.5% clove oil in the diet was reported in rohu carp fingerlings (Labeo rohita) through a reduction in SOD activity and in lipid peroxidation levels (Asimi & Sahu 2016).

In the present study, zebrafish was used to assess the effects of combining linseed oil as a source of α-linolenic acid, and clover leaf essential oil as a natural antioxidant, on the incorporation of fatty acids in the muscle, oxidative markers, lipid peroxidation, and expression of the PPAR-α and SREBP-2 genes.

MATERIALS AND METHODS

The experiment was run in the Ornamental Fish Laboratory of the PeixeGEN Research Center – Management, Enhancement and Molecular Genetics in Freshwater Fish Farming, at the State University of Maringá [Universidade Estadual de Maringá] – UEM. This project was approved by the Ethics Committee on Animal Use (CEUA) of said university, under protocol No. 8851180216.

Preparation of experimental diets and food management

Six experimental diets were prepared in accordance with the nutritional recommendations proposed by Siccardi et al. (2009), containing the following levels of inclusion for linseed oil (LO) and clove leaf essential oil (CLEO): Diet 1: 3% LO + 0.5% CLEO; Diet 2: 3% LO + 1% CLEO; Diet 3: 6% LO + 0.5% CLEO; Diet 4: 6% LO + 1% CLEO; Diet 5: 9% LO + 0.5% CLEO; Diet 6: 9% LO + 1% CLEO.

The experimental design was completely randomized with three repetitions and six treatments. Diet composition and fatty acid profile are displayed in Tables I and II, and determined in accordance with the AOAC (2005) and Figueiredo et al. (2016).

Table I
Percentage composition of the experimental diets.

Ingredients		Experimental diets
	Diet 1	Diet 2	Diet 3	Diet 4	Diet 5	Diet 6	Diet 7
Soy protein isolate	50.90	50.90	50.90	50.90	50.90	50.90	50.90
Corn	20.00	20.00	20.00	20.00	20.00	20.00	20.00
Corn gluten	7.06	7.06	7.06	7.06	7.06	7.06	7.06
Corn oil	10.00	6.50	6.00	3.50	3.00	0.50	0.00
LO	0.00	3.00	3.00	6.00	6.00	9.00	9.00
CLEO	0.00	0.50	1.00	0.50	1.00	0.50	1.00
Broken rice	5.00	5.00	5.00	5.00	5.00	5.00	5.00
Dicalcium phosphate	3.63	3.63	3.63	3.63	3.63	3.63	3.63
Lysine	1.14	1.14	1.14	1.14	1.14	1.14	1.14
1Mineral and vitamin supplement	1.00	1.00	1.00	1.00	1.00	1.00	1.00
DL-Methionine	0.43	0.43	0.43	0.43	0.43	0.43	0.43
Calcitic limestone	0.41	0.41	0.41	0.41	0.41	0.41	0.41
Common salt	0.30	0.30	0.30	0.30	0.30	0.30	0.30
L-Tryptophan	0.09	0.09	0.09	0.09	0.09	0.09	0.09
Centesimal composition
Crude protein	51.82	51.26	51.15	50.97	51.06	50.85	51.47
Energy (kj/g)	17.16	17.28	17.57	17.23	17.41	17.68	17.13
Ethereal extract	11.26	11.09	11.52	11.63	11.06	11.81	11.32
Calcium	1.10	1.26	1.03	1.16	1.15	1.32	1.01
Total phosphorus	1.33	1.14	1.29	1.22	1.17	1.55	1.10

• ¹Guaranteed levels per kilo of product: vit. A - 500,000 IU; vit. D3 - 200,000 IU; vit. E - 5,000 mg; vit. K3 - 1,000 mg; vit. B1 - 1,500 mg; vit. B2 - 1,500 mg; vit. B6 - 1,500 mg; vit. B12 - 4,000 mg; Folic acid - 500 mg; calcium pantothenate - 4,000 mg; biotin - 50 mg; inositol - 10,000; nicotinamide - 7,000; choline - 40,000 mg; cobalt - 10 mg; copper - 500 mg; iron - 5,000 mg; iodine - 50 mg; manganese - 1,500 mg; selenium - 10 mg; zinc - 5,000 mg.

Table II
Fatty acid profile of the experimental diets (% of total fatty acids).

Fatty acids	Experimental diets
	Diet 1	Diet 2	Diet 3	Diet 4	Diet 5	Diet 6	Diet 7
16:00	11.56	10.81	11.01	9.29	9.80	7.95	8.57
18:00	4.87	5.51	5.14	5.08	5.46	5.40	5.45
20:00	0.54	0.54	0.46	0.42	0.43	0.44	0.38
22:00	0.63	0.59	0.51	0.44	0.45	0.43	0.31
24:00	0.26	0.26	0.28	0.22	0.22	0.23	0.24
18:1n-9	28.31	31.11	26.40	29.78	31.06	31.36	27.95
18:1n-7	1.49	1.42	1.05	1.15	1.13	1.12	0.69
20:1n-9	0.33	0.34	0.24	0.27	0.29	0.28	0.20
18:2n-6	46.58	37.69	36.67	30.17	29.44	27.80	19.44
18:3n-3	5.43	11.71	12.89	23.17	21.69	24.99	27.65
1∑Sat	17.85	17.72	17.40	15.46	16.37	14.45	14.95
2∑Mon	30.13	32.87	27.69	31.21	32.48	32.76	28.83
3∑Pol	52.01	49.41	49.55	53.34	51.13	52.79	47.09
n6/n3	8.57	3.22	2.85	1.30	1.36	1.11	0.70

• ¹Sum of saturated fatty acids; ²Sum of monosaturated fatty acids, and ³Sum of polyunsaturated acids.

Corn oil was used to keep the diets isoenergetic. The ingredients were ground in a hammer mill with a sieve measuring 0.3 mm in diameter. The feed was processed in an extruded manner (Ex-Micro® extruder with 1.0 mm in diameter). The fish were fed four times a day (8:00, 11:00, 14:00 and 17:00) until apparent satiety.

Fish and experimental conditions

This experiment used 360 male zebrafish (D. rerio) aged 50 days after hatching, with an average weight of 0.29 ± 0.04 g and average total length of 30.67 ± 0.71 mm. The animals were distributed in 18 glass tanks with a useful volume of 50 liters (20 animals per tank), individually equipped with an internal filter, a 50 w thermostat and constant aeration by means of a central air blower.

The values for average water temperature, pH and dissolved oxygen were 26.23 ± 0.54 °C, 7.3 ± 0.01, and 6.6 ± 0.32 mg/L, which are within the comfortable range for the species (Westerfield 2007). At the end of the experiment (55 days), the fish were euthanized (methanesulfonate (MS-222, tricaine), at 250 mg/L for 10 minutes) to have their weight (g) and length (mm) taken. The animals were then dissected to have their livers removed, which were used to analyze gene expression (five livers from each experimental unit) and antioxidant markers and lipid peroxidation (five livers from each experimental unit). The samples were immediately stored in liquid nitrogen, then transferred to a freezer at -80 °C.

Determination of fatty acids and muscle in the zebrafish

The incorporation of fatty acids in the muscle was determined in accordance with Figueiredo et al. (2016).

Assessment of antioxidant activity and lipid peroxidation

Zebrafish were euthanized and the livers were removed immediately and freeze-clamped in liquid nitrogen. Tissue samples were homogenized in a van Potter homogenizer with 10 volumes of icecold 0.1M potassium phosphate buffer (pH 7.4). The protein content in the total homogenate was determined as described by Lowry et al. (1951).

Lipid peroxidation was evaluated in liver homogenates by thiobarbituric acid reactive substances (TBARS), predominantly malondialdehyde (MDA) (Ohkawa et al. 1979). An aliquot of liver homogenate (50 mg protein) was added to 4 ml of a solution containing 0.4% SDS, 7.5% acetic acid and 0.25% TBA. After 1 h incubation at 95 °C, the MDA-TBA complex was extracted with 1 mL n-butanol/pyridine 15:1 (v/v) and the absorbance was determined at 532 nm. The amount of lipoperoxides was calculated from the standard curve prepared with 1,1’,3,3’-tetraethoxypropane, and the values were expressed as nmol MDA/mg protein (ε = 1.56 × 10⁵ M−¹ × cm−¹).

The GSH content was measured in liver homogenates using o-phthalaldehyde (OPT) (Hissin & Hilf 1976). The samples were added to a medium containing 0.1 M phosphate buffer and 5.0 mM EDTA (pH 8.0). The reaction was started by adding 100 µL of OPT solution (1 mg/mL, in methanol). The fluorescent product GSH-OPT was measured fluorometrically (350 nm excitation and 420 nm emission) after an incubation period of 15 min at room temperature. The results were expressed as µg GSH/mg protein.

The antioxidant enzymatic activities were assessed in the homogenate supernatant. Superoxide dismutase (SOD) activity was estimated by its capacity to inhibit pyrogallol autoxidation in alkaline medium at 420 nm (Marklund & Marklund 1974). The amount sufficient to inhibit the enzyme reaction by 50% (IC₅₀) was defined as 1 unit of SOD, and the results were expressed as U SOD/mg protein. Catalase (CAT) activity was estimated by measuring the change in absorbance at 240 nm using H₂O₂ as substrate and expressed as H₂O₂ consumed/min × mg protein (ε = 33.33 M−¹ × cm−¹) (Aebi 1984). Glutathione peroxidase (GPx) activity was estimated by measuring the change in absorbance at 340 nm due to NADPH consumption in the presence of H₂O₂, GSH and glutathione reductase and expressed as nmol of NADPH oxidized/min × mg protein (ε = 6220 M−¹ × cm−¹) (Paglia & Valentine 1967).

Gene expression analysis

Total RNA was extracted using the Trizol® reagent (Invitrogen, Carlsbad CA, USA), in accordance with the manufacturer’s standards. To assess total RNA concentration, the samples were measured with the aid of a PICODROP® spectrophotometer (PicodropLimited, Hinxton, United Kingdom). RNA integrity was evaluated in 1% agarose gel stained with SYBR Safe™ DNA Gel Stain (Invitrogen, Carlsbad CA, USA) and visualized in a transilluminator with ultraviolet light.

The RNA samples were treated with DNase I (Invitrogen, Carlsbad, CA, USA) for removal of possible residues of genomic DNA, in accordance with the manufacturer’s recommendations. Complementary DNA was made using the SuperScrippt TM III First-StrandSyntesisSuper Mix kit (Invitrogen, Carlsbad CA, USA), in accordance with the manufacturer’s standards. In a sterile and RNA-free tube, 6 μl of total RNA, 1 μL of oligo (dT) (50 μ Moligo (dT) 20, and 1 μL of annealing buffer were added. The reaction was incubated for 5 minutes at 65 ºC, then put on ice for 1 minute. Afterwards, 10 μL of 2x First-StrandReaction Mix solution and 2 μL of a solution containing the SuperScript III reverse transcriptase enzyme and RNAse inhibitor were added. The solution was incubated for 50 minutes at 50 ºC and, then, for 5 minutes at 85 ºC, being immediately put on ice. The samples were stored at -20 ºC until the moment of use.

For real-time PCR (qRT-PCR) to be assessed, the primers of the SREBP-2 (Sterol regulatory element-binding protein 2) and the PPAR-α (Peroxisome proliferator-activated receptor-α) genes were designed in accordance with the sequences and uploaded to www.ncbi.nlm.nih.gov for zebrafish (D. rerio) via www.idtdna.com (Table III). For endogenous control, the ß-actin gene was used.

Table III
Primers used in this study.

Primer	Sequence	Amplicon (pb)	Access number
SREBP-2	F:GATGCTGGTATTGGTGGTTTATG R:AGTGTCTGTGTGTGAGAGATTG	149	NM_001089466.1
PPAR-α	F:GAACCGAAACAAGTGCCAATAC R:GGATCTCTGCCTTCAACCTTAG	122	NM_001102567.1
β-actin	F: CAAACGAACGACCAACCTAAAC R:TACCTCCCTTTGCCAGTTTC	108	NM_131031.1

For the qRT-PCR reactions, a SYBR® GREEN PCR Master Mix fluorescent dye (AppliedBiosystems USA) was used, in accordance with the manufacturer’s recommendations. All analyses were carried out in a volume of 25 µL and in duplicates. The reactions were conducted in strips in a StepOne Plus device. Primer and cDNA concentrations were determined through efficiency tests, using three primer concentrations (100, 200 and 400 nM) and four cDNA concentrations (10, 100, 200 and 400 ng). The 2-ΔCT method was used for relative quantification analyses, with data being expressed in arbitrary unit (AU).

Statistical analysis

The results were expressed as mean ± sd. The data were analyzed on Statistical Analysis Software 9.3 (SAS 2011) and subjected to factorial analysis of variance to allow determining the interaction between the LO and CLEO factors (LOxCLEO) or the LO and CLEO isolated factors. The data were also checked for homogeneity of variances and normality by Levene’s test and the Kolmogorov-Smirnov test, respectively. The results were compared through Tukey’s test, and P values ​​<0.05 were considered significant.

RESULTS

Incorporation of Fatty Acids in Zebrafish Muscle

Table IV shows the isolated effects of fatty acids analyzed in the muscle of zebrafish. Saturated fatty acids did not differ between treatments (P>0.05). The monounsaturated, arachidonic (ARA, 20:4n-6) and n-6 ​​acids showed isolated effect for the LO factor (P<0.05) (Table IV), with the content of monosaturated fatty acid increasing with ascending LO levels, whereas ARA and n-6 ​​content reduced. For the n-6/n-3 ratio, there was isolated effect for the LO and CLEO factors (P <0.05), indicating a decrease in their results.

Table IV
Isolated effect on the fatty acid profile (% of the total) in the muscle of zebrafish (Danio rerio) fed diets containing linseed oil (LO) and clove leaf essential oil (CLEO).

Components	Fatty acid
	1∑Sat	2∑Mono	3ARA	n-6	n-6/n-3
Effects
LO	0.293	0.018	<0.001	<0.001	<0.001*
CLEO	0.104	0.338	0.550	0.729	<0.001*
LOxCLEO	0.534	0.06	0.229	0.167	0.289
Factors
LO
3%	27.74±1.39	36.39±1.28 b	2.35±0.20 a	27.71±1.03 a	3.37±0.13 a
6%	27.61±1.31	38.31±1.54 a	1.72±0.24 b	22.46±0.61 b	1.93±0.09 b
9%	26.94±1.18	39.26±1.37 a	1.43±0.13 c	18.64±0.65 c	1.21±0.05 c
CLEO
0.5%	28.12±0.99	38.28±1.05	1.86±0.47	22.75±3.22	2.29±0.33 a
1%	26.74±0.81	37.72±1.11	1.80±0.42	22.93±4.58	2.05±0.30 b

• ¹ΣSat: Sum of saturated fatty acids. ²ΣMon: Sum of monounsaturated fatty acids. ³Arachidonic acid (20:4n-6). Data are presented as mean ± standard deviation. *Values followed by different letters in the column are statistically different (P<0.05).

Table V shows the interaction effects (P<0.05), with linoleic acid (18:2n-6) eicosadienoic acid (20:2n-6) and dihomo-gamma-linolenic acid (20:3n-6) presenting a reduction in their content with increasing LO and CLEO levels in the diet, whereas the 9% LO% + 1% CLEO diet resulted in lower means.

Table V
Effect of the experimental diets on the profile of fatty acids (% of the total) in the zebrafish muscle (Danio rerio) fed a diet containing linseed oil (LO) and clove leaf essential oil (CLEO).

Components	Fatty acid composition
	18:2n-6	20:2n-6	20:3n-6	18:3n-3	20:5n-3	22:6n-3	n-3
Effects
LO	<0.001	<0.001	<0.001	<0.001	<0.001	0.005	<0.001
CLEO	0.09	<0.001	<0.001	<0.001	<0.001	0.014	<0.001
LOxCLEO	<0.001	<0.001	<0.001	<0.001	<0.008	0.013	<0.014
Outcome
3%LO+0.5%CLEO	22.30±0.51 a	0.29±<0.01 a	1.52±0.07 a	4.10±0.06 e	0.31±0.05 e	3.04±0.56 b	7.45±0.67 e
3%LO+1%CLEO	21.97±2.06 a	0.20±0.02 bc	1.38±0.11 c	5.20±0.11 d	0.42±0.02 d	3.31±0.09 b	8.94±0.21 d
6%LO+0.5%CLEO	19.13±0.76 b	0.22±<0.01 c	1.23±0.03 af	11.42±0.31e	0.58±0.03 c	3.66±0.29 b	11.42±0.31 c
6%LO+1%CLEO	19.35±0.14 b	0.21±<0.01 c	1.14±0.07df	7.17±0.58 c	0.60±0.02 bc	3.53±0.09 b	11.83±0.08 c
9%LO+0.5%CLEO	15.32±0.20 c	0.21±0.01 bc	1.30±0.06 b	9.96±0.43 b	0.69±0.06 b	3.33±0.18 ab	13.97±0.67 b
9%LO+1%CLEO	15.56±0.55 c	0.18±<0.01 c	0.87±0.02 e	11.17±0.61 a	0.87±0.02 a	4.31±0.01 a	16.35±0.59 a

• Data are presented as mean ± standard deviation. Values followed by different letters in the column are significantly different (P<0.05).

The amount of α-linolenic acid (ALA, 18:3n-3), eicosapentaenoic acid (EPA, 20:5n-3) and docosaexanoic acid (DHA, 22:6n-3) increased concomitantly with the combined levels of inclusion of LO and CLEO (P <0.05). Consequently, the increase in n-3 in the zebrafish muscle occurred together with the addition of LO and CLEO, and higher means were found in the diet with greater inclusion levels of both oils used (9% LO + 1% CLEO) (Table V).

Assessment of antioxidant activity and peroxidation level

SOD activity showed isolated effect for both factors (P <0.05), while CAT showed isolated effect only for LO (P<0.05). Both SOD and CAT showed a decrease in their activity. TBARS showed isolated effect for CLEO (P<0.05), with decreased concentration as a function of CLEO levels. GSH content showed interaction effect (P <0.05), and a reduction was found in their content with 0.5% CLEO associated with 6 and 9% LO in the diets (Table VI).

Table VI
Antioxidant and lipid peroxidation markers (TBARS) assessed in zebrafish (Danio rerio) fed experimental diets containing linseed oil (LO) and clove leaf essential oil (CLEO).

Components	Antioxidant markers
	1SOD	2CAT	3TBARS	4GSH
Effect
LO	0.004	0.021	0.446	0.370
CLEO	<.001	0.228	0.043	<.001
LOxCLEO	0.089	0.936	0.803	0.034
Outcome
LO
3%	1.13±0.32 a	3.47±0.99 a	2.16±0.61	-
6%	0.92±0.47 ab	3.59±1.11 a	1.79±0.55	-
9%	0.64±0.25 b	1.90±1.42 b	1.90±0.27	-
CLEO (%)
0.5%	1.51±0.33 a	3.21±1.34	2.26±0.51 a	-
1.0%	0.63±0.28 b	2.88±1.02	1.89±0.63 b	-
LO+CLEO
3%LO+0.5%CLEO	-	-	-	2.88+011 c
3%LO+1%CLEO	-	-	-	3.22+0.31 abc
6%LO+0.5%CLEO	-	-	-	2.53+0.14 c
6%LO+ 1%CLEO	-	-	-	3.94+0.34 ab
9%LO+0.5%CLEO	-	-	-	2.47+0.35 c
9%LO+1%CLEO	-	-	-	4.46+0.31 a

• ¹Superoxide dismutase (U of SOD mg^-1). ²Catalase (ε, 33.33 M^-1 × cm^-1). ³Tiobarbituric acid reactive substances (MDA mg^-1 of protein). ⁴Glutathione (μg GSH mg-1). Data are presented as mean ± standard deviation. Values followed by different letters in the column are statistically different (P<0.05).

Gene expression analysis

The assessed genes showed interaction effect between factors (P<0.05) (Table VII), with PPAR-α and SREBP-2 presenting similar behaviors, and with the groups of fish fed diet containing 9 and 0.5% LO and CLEO showing means higher than those of the other treatments.

Table VII
Expression of the PPAR-α and SREBP-2 genes assessed in zebrafish (Danio rerio) fed experimental diets containing linseed oil (LO) and clove leaf essential oil (CLEO).

Components	Genes
	1PPAR-α	2SREBP-2
Effect
LO	0.089	<0.001
CLEO	0.151	<0.001
LOxCLEO	0.010	<0.001
Outcome
3%LO+0.5%CLEO	0.13±0.01 b	0.11±0.01 b
3%LO+1%CLEO	0.61±0.27 ab	0.20±0.13 b
6%LO+0.5%CLEO	0.32±0.24 ab	0.19±0.18 b
6%LO+ 1%CLEO	0.21±0.01 b	0.50±0.01 b
9%LO+0.5%CLEO	1.12±0.27 a	2.89±0.17 a
9%LO+1%CLEO	0.18 ±0.10 b	0.24±0.14 b

• ¹Peroxisome proliferator-activated receptor alpha (PPAR-α). ²Sterol regulatory element-binding proteins 2 (SREBP-2). Data are presented as mean ± standard deviation. Values followed by different uppercase letters in the column are statistically different (P<0.05).

DISCUSSION

The profile of the fatty acids in the zebrafish muscle was clearly affected by the lipid composition of the experimental diets. This observation is consistent with the general concept that the composition of fatty acids in fish tissue is largely a reflection of diets (Benítez-Dorta et al. 2013, Sotoudeh et al. 2015).

The increased content of monounsaturated fatty acids can be explained by the increase in the diet, considering that LO is usually composed of about 18% of oleic acid (Ganorkar & Jain 2013), in addition to corn oil contributing to keeping the levels of the monounsaturated acids, though at low LO replacement rates. In a study conducted by Araújo et al. (2016), the inclusion of 9% LO and corn oil in diets for zebrafish did not cause significant differences (P >0.05) in the composition of monounsaturated acid in the carcasses of the animals.

The muscular content of linoleic acid (18:2n-6) decreased in response to the lipid composition of the diets and as a precursor to the n-6 series; consequently, there was a decrease in the eicosadienoic (20:2n-6), linolenic dihomo-gamma (20:3n-6) and arachidonic (ARA, 20:4n-6) acids. The inclusion of increasing levels of LO and, therefore, gradual amounts of α-linolenic acid (18:3n-3) in the diet resulted in an increase in 18:3n-3 in the muscle and its long-chain counterparts, eicosapentaenoic acid (EPA, 20:5n-3) and docosahexanoic (DHA, 20:4n-3).

In a study carried out by Tocher et al. (2001), a diet formulated to supply 1% of α-linolenic and linoleic acid for zebrafish and tilapia, the same pattern was observed for desaturation and elongation of fatty acids. In general, freshwater fish have the ability to elongate and desaturate n-3 and n-6 fatty acids (C18) for their respective long-chain counterparts (C20 and C22); however, accumulation in the tissue depends on the quantity supplied in the food (Liu et al. 2013, Qiu et al. 2017).

Unlike DHA, there was low accumulation of EPA in the zebrafish muscle. Fatty acids, regardless of chain size or number of unsaturations, are important sources of energy, but DHA tends to be preserved in the phospholipid bilayer of membranes, playing structural and functional roles (Tocher 2010). The present study, based on the results found, supports the hypothesis that EPA is probably directed to meet different metabolic needs, such as conversion to DHA, synthesis of eicosanoids and energy production through β-oxidation, causing its reduction in tissues (Glencross et al. 2014, Rosenlund et al. 2016, Thomassen et al. 2012).

The CLEO supplied in the diet contributed to a greater retention of fatty acids, playing its role as an antioxidant for having mainly eugenol (81 to 86%) in its chemical composition, in addition to β-karyophylene (17.4%) and α-humulene (2.1%), protecting them against the action of free radicals and improving the assimilation of these lipids (Jirovetz et al. 2006, Sohilait 2015). It was proven in the study by Sotoudeh et al. (2015) that antioxidants from diets can lead to this result; in common trout (Salmo trutta caspius), for instance, α-tocopherol promoted the protection of EPA and DHA against oxidation in the cell membrane, enabling greater incorporation.

In general, wild freshwater fish are characterized by a 5 to 6:1 ratio of n-6/n-3 (Dabrowski & Portela 2006). As in the present study, Tonial et al. (2009) also found a reduction in the n-6/n-3 ratio (1:1) for Nile tilapia fed a diet containing 7% linseed oil compared to the group fed 7% soybean oil, in addition to a significant difference (P <0.05) in growth improvement. Research aimed at lowering this ratio to increase the nutritional value of food, without harming health and, consequently, to improve the productive performance of animals, is important for aquaculture.

TBARS level is used to measure the extent of lipid peroxidation (Bartoskova et al. 2014). In the present study, CLEO was responsible for reducing lipid peroxidation. This result can be explained by the presence of eugenol, the active ingredient of CLEO and a phenolic compound that acts as an antioxidant, sequestering hydroxyl (OH•) reactive species, and responsible for causing the oxidation of polyunsaturated fatty acids and, consequently, inhibiting the chain reaction (Pereira & Maia, 2007, Lima & Bezerra 2012).

Moreover, a decrease in the enzymatic activities of SOD, CAT and GSH confirms the antioxidant property of CLEO, reducing the substrate of action of these enzymes, which, consequently led to a decrease in their activities (Elia et al. 2006, Hou et al. 2015). This result is confirmed in a study carried out with Rhamdia quelen fish (Azambuja et al. 2011), mice (Sheweita et al. 2016) and Macrobrachium rosenbergii shrimp (Cagol et al. 2020), in which the use of essential oils with antioxidant properties reduced the action of these enzymes.

Polyunsaturated fatty acids, especially those of the n-3 series, are natural PPAR-α activators (Michalik et al. 2006, Kamalam et al. 2013). As expected, this study found an increase in PPAR-α expression in the zebrafish liver; this happened as a consequence of diets containing increasing amounts of α-linolenic acid, and of a better protection against lipid peroxidation at the level of 0.5% CLEO.

The result of this study corroborates the assay carried out by Li et al. (2015) to assess the effects of n-3 series fatty acids on lipid metabolism in grass carp (Ctenopharyn godonidellus), which reports increased PPAR-α expression in the liver and muscle of fish fed a diet containing a greater quantity of alpha-linolenic acid, EPA and DHA. Jin et al. (2017) also confirmed an increase in PPAR-α when the dietary content of n-3 rose from 0.23% to 1.29% in diets for juvenile snapper (Acanthopagrus schlegelii). In rainbow trout (Oncorhynchus mykiss), there was greater activation in fish fed LO in their diet compared to soybean oil and fish oil, which have a lower amount of alpha-linolenic acid (Dong et al. 2017).

PPAR-α is known to play a critical role in regulating lipid homeostasis (Yessoufou et al. 2009), activating lipid catabolism by regulating the expression of target genes that encode enzymes involved in peroxisomal and mitochondrial β-oxidation (Walczak & Tontonoz 2002, Lu et al. 2014). A higher PPAR-α expression is also associated with decreased lipid deposition in the hepatocyte (Yoon 2009). In the research by Lu et al. (2014), carried out with Wuchang bream (Megalobrama amblycephala), a reduction in PPAR-α led to an accumulation of fat in the hepatocyte, followed by nuclear atrophy, characterizing steatosis, with the fish showing reduced growth as well. The opposite result has been reported in fish with greater PPAR-α expression and greater β-oxidation.

As for SREBP-2, its main function is to control cholesterol biosynthesis (Fonseca-Alaniz et al. 2006). In particular, SREBP-2 is a transcription factor that resides in the endoplasmic reticulum, which has an activity dependent on cholesterol and, therefore, is deeply involved in the regulation of the expression of genes related to its metabolism (Sato 2010). The increase in SREBP-2 expression in the present study can be explained by the fact that vegetable oils and diets have a cholesterol deficiency (Phillips et al. 2002). In addition, other sterols such as sitosterol, stigmasterol, campesterol and brassicasterol are present in said oils, which can inhibit the absorption of cholesterol and are unlikely to be absorbed by fish (Ostlund 2004, Tocher et al. 2008).

In a study conducted by Castro et al. (2016), they observed that cholesterol concentration was lower in fish fed vegetable oil compared to the group treated with fish oil. Leaver et al. (2008) assessed the replacement of fish oil with vegetable oils (canola, soy and linseed) in diets for salmon (Salmo salar). Their findings indicate an increase in SREBP-2 expression in all diets with vegetable oil, being therefore an important regulator of cholesterol levels.

CONCLUSION

There was a greater incorporation of n-3 fatty acids, as well as reduced lipid peroxidation and antioxidant activity. The expression analysis pointed to an increase in β-oxidation, which is directly related to a reduction in liver fat accumulation and a decrease in cholesterol synthesis. Therefore, a combination of 9% linseed oil with 0.5% clove leaf essential oil is recommended.

REFERENCES

• AEBI H. 1984. Catalase in vitro. Methods Enzymol 105: 121-126.
• AOAC - Association of Official Analytical Chemists. 2005. Official methods of analysis of AOAC International. 18. Ed. Washington, D.C., USA: AOAC International, 3172 p.
• ARAÚJO FG, COSTA DV, MACHADO MRF, PAULINO RR, OKAMURA D & RPPSA PV. 2016. Dietary oils influence ovary and carcass composition and embryonic developmentof zebrafish. Aquacult Nutr 23: 651-661.
• ARAÚJO KJ & SCHMITTGEN TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Meth 22: 402-408.
• ASIMI OA & SAHU NP. 2016. Effect of antioxidant rich spices, clove and cardamom extracts on the metabolic enzyme activity of Labeo rohita. J Fisheries Livest Prod 4: 1-6.
• AZAMBUJA CR, MATTIAZZI J, RIFFEL ANK, FINAMOR IA, GARCIA LO, HELDWEIN CG, HEINZMANN BM, BALDISSEROTTO B, PAVANATO MA & LLESUY SF. 2011. Effect of the essential oil of Lippia alba on oxidative stress parameters in silver catfish (Rhamdia quelen) subjected to transport. Aquacul 319: 156-161.
• BARTOSKOVA M, DOBSIKOVA R, STANCOVA V, PANA O, ZIVNA D, PLHALOVA L, BLAHOVA J & MARSALEK P. 2014. Norfloxacin-toxicity for zebrafish (Danio rerio) focusedon oxidative stress parameters. Biomed Res Int 2014: 1-6.
• BENÍTEZ-DORTA V, CABALLERO MJ, IZQUIERDO M, MANCHADO M, INFANTE C, ZAMORANO MJ & MONTERO D. 2013. Total substitution of fish oil by vegetable oils in Senegalese sole (Solea senegalensis) diets: effects on fish performance, biochemical composition, and expression of some glucocorticoid receptor-related genes. Fish Physiol Biochem 39: 35-349.
• CAGOL L, BALDISSEROTTO B, BECKER AG, SOUZA CF, HEINZMANN, BM. CARON BO, LEONE FA, SANTOS LD & BALLESTER EL. 2020. Essential oil of Lippia alba in the diet of Macrobrachium rosenbergii: Effects on antioxidant enzymes and growth parameters. Aquac Res 51: 2243-2251.
• CASTRO C, CORRAZE G, FIRMINO-DIÓGENES A, LARROQUET L, PANSERAT, S & OLIVA-TELES A. 2016. Regulation of glucose and lipid metabolism by dietary carbohydrate levels and lipid sources in gilthead sea bream juveniles. Br J Nutr 116: 19-34.
• DABROWSKI K & PORTELA MC. 2006. Feeding plasticity and nutritional physiology in tropical fishes, In: The Physiologyof Tropical Fishes. London: Elsevier Academic, p. 155-224.
• DONG X, TAN P, CAI Z, XU H, LI J, REN W, XU H, ZUO R, ZHOU J & MAI K & AI Q. 2017. Regulation of FADS2 transcription by SREBP-1 and PPAR-α influences LC-PUFA biosynthesis in fish. Scient Reports 7: 1-11.
• ELIA AC, ANASTASI V & DÖRR AJM. 2006. Hepatic antioxidant enzymes and total glutathione of Cyprinus carpio exposed to three disinfectants, chlorine dioxide, sodium hypochlorite and peracetic acid for superficial water potabilization. Chemos 64: 1633-1641.
• FIGUEIREDO I, CLAUS T, JUNIOR OOS, ALMEIDA VC, MAGON T & VISENTAINER JV. 2016. Fast derivatization of fatty acids in different meat samples for gas chromatography analysis. J Chromatogr A 1456: 235-241.
• FONSECA-ALANIZ MH, TAKADA J, ALONSO-VALE MIC & LIMA FB. 2006. O tecido adiposo como centro regulador do metabolismo. Arq Bras Endocrinol Metab 50: 1-14.
• GANORKAR PM & JAIN RK. 2013. Flaxseed – a nutritional punch. Inte Food Research 20: 519-525.
• GLENCROSS BD, TOCHER DR, MATTHEW C & BELL JC. 2014. Interactions between dietary docosahexaenoic acid and other long-chain polyunsaturated fatty acids on performance and fatty acid retention in post-smolt Atlantic salmon (Salmo salar). Fish Physiol Biochem 40: 1213-1227.
• GÜLÇIN I, ELMASTAŞ M & ABOUL-ENEIN HY. 2012. Antioxidant activity of clove oil – A powerful antioxidant source. Arabian J Chem 5: 489-499.
• HALLIWELL B & GUTTERIDGE JMC. 2007. Free Radicals in Biology and Medicine. 4th ed., Oxford: University Press, 851 p.
• HISSIN PJ & HILF R. 1976. A fluorometric method for determination of oxidized and reduced glutathione in tissues. Anal Biochem 74: 214-226.
• HOU J, LI L, XUE T, LONG M, SU Y & WU N. 2015. Hepatic positive and negative antioxidant responses in zebrafish after intraperitoneal administration of toxic microcystin-LR. Chemosp 120: 729-736.
• JIN M, LU V, YAN Y, LI Y, QIU H, SUN P, MA HNM, DING LY & CHOU QC. 2017. Regulation of growth, antioxidant capacity, fatty acid profiles, hematological characteristics and expression of lipid related genes by different dietary n-3 highly unsaturated fatty acids in juvenile black seabream (Acanthopagrus schlegelii). Aquacult 471: 55-65.
• JIROVETZ L, BUCHBAUER G, STOILOVA I, STOYANOVA A, KRASTANOV A & SCHMIDT E. 2006. Chemical composition and antioxidant properties of clove leaf essential oil. J Agric Food Chem 54: 6303-6307.
• KAMALAM BS, MEDELE F, LARROQUET L, CORRAZE G & PANSERAT S. 2013. Metabolism and fatty acid profile in fat and lean rainbow trout lines fed with vegetable oil: effect of carbohydrates. PLoS ONE 8: 1-16.
• KIRON V, FUKUDA H, TOSHIO T & WATANABE T. 1995. Essential fatty acid nutrition and defence mechanisms in rainbow trout Oncorhynchus mykiss. Comp Biochem Physiol Part A Physiol 111: 361-367.
• LEAVER MJ, VILLENEUVE LA, OBACH A, JENSEN L, BRON J, TOCHER DR & TAGGART JB. 2008. Functional genomics reveals increases in cholesterol biosynthetic genes and highly unsaturated fatty acid biosynthesis after dietary substitution of fish oil with vegetable oils in Atlantic salmon (Salmo salar). Genom 9: 1-15.
• LI C, LIU P, JI H, HUANG J & ZHANG W. 2015. Dietary n-3 highly unsaturated fatty acids affect the biological and serum biochemical parameters, tissue fatty acid profile, antioxidation status and expression of lipid-metabolism-related genes in grass carp, Ctenopharyngodon idellus. Aquacult Nutr 21: 373-383.
• LIMA FO & BEZERRA AS. 2012. Flavonoides e radicais livres. Discip Sci 13: 111-124.
• LIU L, SU J, LIANG XF & LUO Y. 2013. Growth performance, body lipid, brood amount, and rearing environment response to supplemental neutral phytase in zebrafish (Danio rerio) diet. Zebrafi 10: 433-438.
• LOWRY OH, ROSEBROUGH NJ, FARR AL & RANDALL RJ. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem 193: 265-275.
• LU K, XU W, WANG L, ZHANG D, ZHANG C & LIU W. 2014. Hepatic β-oxidation and regulation of carnitine palmitoyltransferase (cpt) i in blunt snout bream Megalobrama amblycephala fed a high fat diet. PLoS ONE 9: 1-12.
• MARKLUND S & MARKLUND G. 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 16: 469-474.
• MICHALIK L ET AL. 2006. International union of pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacolog Revi 58: 726-741.
• NAYAK M, PRADHAN A, SAMANTA M & GIRI SS. 2017. Dietary fish oil replacement by linseed oil: Effect on growth, nutrient utilization, tissue fatty acid composition and desaturase gene expression in silver barb (Puntius gonionotus) fingerlings. Comp Biochem Part A Physiol 205: 1-12.
• OHKAWA H, OHISHI N & YAGI K. 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95: 351-358.
• OSTLUND RE. 2004. Phytosterols and cholesterol metabolism. Curr Opi Lipidol 15: 37-41.
• PAGLIA DE & VALENTINE WN. 1967. Studies on the Quantitative and Qualitative Characterization of Erythrocyte Glutathione Peroxidase. J Laboratory and Clinical Medi 70: 158-169.
• PEREIRA CAM & MAIA JF. 2007. Estudo da atividade antioxidante do extrato e do óleo essencial obtidos das folhas de alfavaca (Ocimum gratissimum L.). Ciênc Tecnol Aliment 27: 624-632.
• PHILLIPS KM, RUGGIO D, TOIVO J, SSIGERWANK MA & SIMPKINS H. 2002. Free and esterified sterol composition of edible oils and fats. J Food Composit Anal 15: 123-142.
• POPA VM, GRUIA A, RABA DN, DUMBRAVA D, MOLDOVAN C, BORDEAN D & MATEESCU C. 2012. Fatty acids composition and oil characteristics of linseed (Linum Usitatissimum L.) from Romania. J Agr Proces and Tech 18: 136-140.
• QIU H, JIN M, LI Y, LU Y, HOU Y & ZHOU Q. 2017. Dietary lipid sources influence fatty acid composition in tissue of large yellow croaker (Larmichthys crocea) by regulating triacylglycerol synthesis and catabolism at the transcriptional level. PLoS ONE 12: 1-19.
• ROSENLUND G, TORSTENSEN BE, STUBHAUG I. USMAN N & SISSENER N. 2016. Atlantic salmon require long-chain n-3 fatty acids for optimal growth throughout the seawater period. J Nutr Scienc 5: 1-13.
• SAS INSTITUTE INC. 2011. SAS/STAT® 9.3 Procedures Guide : Statistical Procedures. Cary, NC: SAS Institute Inc.
• SATO R. 2010. Sterol metabolism and SREBP activation. Arch Biochem Biophys 501: 177-181.
• SHEWEITA SA, EL-HOSSEINY LS & NASHASHIBI MA. 2016. Protective effects of essential oils as natural antioxidants against hepatotoxicity induced by cyclophosphamide in mice. PLoS ONE 11: 1-17.
• SICCARDI AJ, GARRIS HW, JONES WT, MOSELEY DB, D’ABRAMO LR & WATTS SA. 2009. Growth and survival of zebrafish (Danio rerio) fed different commercial and laboratory diets. Zebrafis 6: 275-280.
• SOHILAIT HJ. 2015. Chemical composition of the essential oils in Eugenia caryophylata, Thunb from Amboina Island. Scie J Chemis 3: 95-99.
• SOTOUDEH E, KENARI AA, KHODABANDEH S & KHAJEH K. 2015. Combination effects of dietary EPA and DHA plus alpha-tocopherol: effects on performance and physiological status of Caspian brown trout (Salmon trutacaspius) fry. Aquacult Nutr 2: 1101-1115.
• TEIXEIRA B, MARQUES A, RAMOS C, NENG NR, NOGUEIRA JMF, SARAIVA JÁ & NUNES ML. 2013. Chemical composition and antibacterial and antioxidant properties of commercial essential oils. Indust Crops and Prod 43: 587-595.
• THOMASSEN MS, REIN D, BERGE GM, OSTBYE T & RUYTER B. 2012. High dietary EPA does not inhibit Δ5 and Δ6 desaturases in Atlantic salmon (Salmo salar L.) fed rapeseed oil diets. Aquacult 360: 78-85.
• TOCHER DR. 2010. Fatty acid requirements in ontogeny of marine and freswater. Aquacul Res 41: 717-732.
• TOCHER DR, AGABA M, HASTINGS N, BELL JG, DICK JR & TEALE AJ. 2001. Nutritional regulation of hepatocyte fatty acid desaturation and polyunsaturated fatty acid composition in zebrafish (Danio rerio) and tilapia (Oreochromis niloticus). Fish Physil Biochem 29: 309-320.
• TOCHER DR, BENDIKEN EA, CAMPBELL PJ & BELL JG. 2008. The role of phospholipids in nutrition and metabolism of teleost fish. Aquacult 280: 21-34.
• TONIAL IB, STEVANATO FB, MATSUSHITA M, SOUZA NS, FURUYA WM & VISENTAINER JV. 2009. Optimization of flaxseed oil feeding time length in adult Nile tilapia (Oreochromis niloticus) as a function of muscle omega-3 fatty acids composition. Aquacul Nutr 15: 564-568.
• WALCZAK R & TONTONOZ P. 2002. PPARadigms and PPARadoxes: expanding roles for PPARγ in the control of lipid metabolism. J Lipid Res 43: 177-186.
• WESTERFIELD M. 2007. The Zebrafish Book, A Guide for the laboratory use of zebrafish (Danio Rerio), 5end ed, Oregon: Eugene, 385 p.
• YESSOUFOU A, ATÈGBO JM, ATTAKPA E, HICHAMI A, MOUTAIROU K, DRAMANE KL & KHAN N. 2009. Peroxisome proliferator-activated receptor-alpha modulates insulin gene transcription factors and inflammation in adipose tissues in mice. Mol Cell Biochem 323: 101-111.
• YOON M. 2009. The role of PPARalpha in lipid metabolism and obesity: focusing on the effects of estrogen on PPARalpha actions. Pharmacol Res 60: 151-159.

Publication Dates

• Publication in this collection
  13 June 2022
• Date of issue
  2022

History

• Received
  15 Feb 2021
• Accepted
  07 Dec 2021