N-Methyl-(2S,4R)-trans-4-hydroxy-L-proline isolated Sideroxylon obtusifolium attenuates TPA-induced irritant contact dermatitis in mice

Abstract

Dermatitis is defined as a set of inflammatory diseases that affect the skin, with varied causes. Among the different types of dermatitis, contact dermatitis is the most prevalent. Although the current therapy is often effective, it is associated with adverse effects and the possibility of drug tolerance. N-Methyl-(2S, 4R)-trans-4-hydroxy-L-proline is a L-proline amino acid derivative found in the leaves of Sideroxylon obtusifolium, a species traditionally used to treat inflammatory diseases. The aim of this study was to investigate the topical anti-inflammatory effect of N-methyl-(2S, 4R)-trans-4-hydroxy-L-proline (NMP) in 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced irritant contact dermatitis in mice. Topically administered NMP, at doses of 0.03 − 0.50 mg/ear, reduced TPA-induced ear edema and neutrophil migration, as evidenced by low tissue myeloperoxidase activity and verified by histological examination. In addition, NMP (0.06 mg/ear) reduced tissue levels of pro-inflammatory cytokines (TNF-α, IL-6, IL-1β, INF-γ and MCP-1) and of the anti-inflammatory cytokine IL-10, and reduced gene expression of TNF-α, IL-6 and IL-1β increased by TPA. The data suggest that N-methyl-(2S, 4R)-trans-4-hydroxy-L-proline acts as a topical anti-inflammatory agent that decreases the expression of inflammatory cytokines, making it useful for the treatment of skin inflammation. Further investigations are necessary for its development as a therapeutic agent.

Key words
Anti-inflammatory effect; N-methyl-(2S; 4R)-trans-4-hydroxy-L-proline; Sideroxylon obtusifolium; TPA

INTRODUCTION

The skin acts as the body’s first line of defense against harmful chemical, physical and biological agents, and also plays a role in thermoregulation, water loss control, and tactile sensitivity (Egawa & Kabashima 2016). Pathological processes of the skin with exacerbated inflammatory character, such as psoriasis, allergic contact dermatitis (ACD) and irritant contact dermatitis (ICD), occur with relevant frequency and have become more frequent in recent years (Johnson-Huang et al. 2009, Nguyen & Soulika 2019, Nguyen & Yiannias 2019).

It is estimated that the worldwide prevalence of contact dermatitis ranges from 12.5 to 40.6%, according to geographic location. In addition, because it is commonly related to occupational skin diseases, ICD has high prevalence especially among individuals of working age (Warshaw et al. 2017, Nguyen & Yiannias 2019).

Treatment of these dermatoses includes the use of emollients to improve barrier function, treatment with topical corticosteroids and UV-light, or application of systemic retinoids in severe cases (Lee et al. 2019, Mostosi & Simonart 2016, Mandlik & Mandlik 2021). The topical use of corticosteroids is the standard treatment of ICD, but its chronic use is associated with skin atrophy, telangiectasia, dryness and changes in the healing process (Chatzidionysiou et al. 2017, Wollenberg et al. 2018, Howell et al. 2020). Therefore, there is a need for safer and more effective therapies with fewer side effects compared to the drugs already in use (Wittmann et al. 2014). In this context, natural products are a promising source to develop innovative drugs (Calixto 2019, Khalifa et al. 2019, Atanasov et al. 2021).

Sideroxylon obtusifolium is a medicinal tree species common to Brazilian territory, popularly known as “quixaba”, “saputiaba” or “rompe-gibão” (Lorenzi & Matos 2002, Delfino et al. 2005). In folk medicine, extracts of the bark and leaves of S. obtusifolium are used to treat gastrointestinal diseases, chronic inflammation, diabetes and pain (Agra et al. 2007, Albuquerque & Oliveira 2007, Beltrão et al. 2008, Santos et al. 2009, Araújo-Neto et al. 2010).

Extracts and fractions enriched in N-methyl-(2S,4R)-trans-4-hydroxy-L-proline (NMP), a constituent of S. obtusifolium leaves, have demonstrated biological activities as antioxidants (Aquino et al. 2020) and systemic anti-inflammatories (Aquino et al. 2017, 2019, 2020). NMP is a derivative of L-proline, an amino acid commonly used as a dietary supplement to stimulate collagen synthesis in the body (Vitagliano et al. 2001).

Aquino et al. (2016) showed that topical administration of the methanolic extract of S. obtusifolium had an anti-edematogenic effect in Croton-oil and phenolic-induced ear edema in mice, demonstrating for the first time its topical anti-inflammatory potential, but not elucidating the mechanisms involved in its effect. Thus, this study aimed to evaluate the topical anti-inflammatory potential of NMP, the main constituent of the methanol extract of leaves of S. obtusifolium, against TPA-induced topical irritant contact dermatitis in mice and to investigate its underlying mechanisms.

MATERIALS AND METHODS

Plant material

The leaves of S. obtusifolium were collected in the Mauriti region (Ceará, Brazil). Voucher specimens were identified and deposited in the Caririense Dárdano de Andrade-Lima Herbarium of Regional University of Cariri (URCA) under Exsiccate no. 10.648. This study was registered with the National System for the Management of Genetic Heritage and Associated Traditional Knowledge (SisGen) under number A5305D6.

Isolation and characterization of N-methyl-(2S,4R)-trans-4-hydroxy-L-proline

The N-methyl-(2S,4R)-trans-4-hydroxy-L-proline (NMP) (Figure 1) was isolated and characterized as the major constituent of the methanolic fraction of S. obtusifolium leaves, as previously reported by Aquino et al. (2017).

Figure 1
Chemical structure of the N-methyl-(2S, 4R)-trans-4-hydroxy-L-proline (NMP).

Briefly, the leaves of S. obtusifolium were previously dried, ground, and packed in cotton bags, which were then boiled in distilled water (100 g dry leaves/500 ml distilled water; 15 min; 2x). The obtained decoction was then freeze-dried and subjected to Soxhlet extraction with methanol (MeOH). The obtained MeOH solution was evaporated by rotation, and aliquots were dissolved in distilled water and chromatographed with a Phenomenex column in a Strata® reverse-phase solid-phase extraction chromatography. The aqueous fractions were pooled after thin-layer chromatography analysis and later lyophilized. A total of 1.7 g (1.7% yield) of the material identified as the compound N-methyl-(2S, 4R)-trans-4-hydroxy-L-proline (C₆H₁₁NO₃; 145.16 g/mol) was obtained. The final structure, including absolute stereochemistry, was determined based on the negative specific rotation of the compound, based on resonance (NMR), stereochemistry by NOESY spectrum analysis, and by comparison with data available in the literature.

Animals

Male Swiss mice (Mus musculus), 25-30 g, from Federal University of Ceará were used. The animals were kept in polypropylene cages, 8 animals per cage, at an average temperature of 24 ± 2 °C in a light-dark cycle of 12/12 hours, with standard feed (Purina Chow®) and drinking water ad libitum. After the experimental procedures, animals were euthanized with an overdose of sodium thiopental (100 mg/kg, i.p.) and lidocaine (10 mg/ml, i.p.). All animal protocols were approved by the Committee on Ethical Use of Animals of Federal University of Ceará under registration number 9255280218 (ID 000223).

TPA-induced acute irritant contact dermatitis

The acute irritant contact dermatitis was induced as described by Recio et al. (2000), in which mice were divided into groups (n = 8/group) and received a single topical application of 12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma Aldrich®, USA) diluted in acetone (2.5 µg/ear; 20 µL) in the right ear. Immediately after TPA application, vehicle (2% Tween 80 in distilled water; 20 µL), NMP (0.03 – 0.50 mg/ear; 20 µL), or dexamethasone (0.10 mg/ear; 20 µL) was administered topically at the same site of TPA application. A group of untreated (naive) animals was included. Edema was determined by measuring ear thickness 0 h (before TPA administration), 4 h, 6 h, and 24 h after TPA administration using a digital caliper (100.174B/Digimess®). Immediately after the last edema measurement, the animals were euthanized and ear tissue samples were collected (6 mm diameter) for subsequent analyses.

Determination of the enzymatic activity of myeloperoxidase (MPO)

Approximately 100 mg of ear tissue was homogenized in 1 ml of PBS buffer (50 mM; pH 6) containing 0.5% hexadecyltrimethylammonium bromide. The homogenate was then subjected to three cycles of freezing and thawing. After this procedure, samples were centrifuged at 2,000 g and 4 °C, for 15 minutes, and MPO activity in the supernatant was measured after adding PBS containing 0.167 mg/ml of o-dianisidine hydrochloride and 0.0005% hydrogen peroxide. The kinetics of the change in absorbance was measured at time points 0 and 5 min at 470 nm (Bradley et al. 1982).

Histological analysis

Ear tissue samples were fixed in a 10% buffered formalin solution for 24 h, then dehydrated, included in paraffin blocks, and cut into 3-5 μm sections with a microtome. The sections were mounted on slides for histology and stained with hematoxylin and eosin (H&E). Tissues from the ears (n = 8) were analyzed using specific scores as described by Biondo-Simões et al. (2006), and the relative thickness of edema was measured as described by Pinto et al. (2015).

Levels of TNF-α, IL-6, IL-1β, IL-10, INF-γ and MCP-1 in ear tissues

The collected ear tissue samples were immediately homogenized in Tris-HCl buffer (50 mM; pH 7.5) with EDTA (1 mM) and 10x Halt ™ protease inhibitor cocktail (1:10, Thermo Scientific®, USA). Then the homogenates were centrifuged at 10,000 g for 10 min at 4 ºC. After centrifugation, the supernatants were collected and the concentrations of TNF-α, IL-6, IL-1β, IL-10, INF-γ, and MCP-1 were determined using specific ELISA kits (Merck®, USA) according to the manufacturer’s instructions, and the results were expressed in pg/ml.

Gene expression of TNF-α, IL-6, and IL-1β by RT-qPCR

To analyze the relative changes in mRNA expression of the cytokines TNF-α, IL-6, and IL-1β, the reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used. Total mRNA was isolated from ear tissue using the QIAzol Lysis RNeasy Lipid Tissue Mini Kit (Qiagen, Germany), and its purity was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Subsequently, cDNA was synthesized using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) and the RT-qPCR technique was performed using the GoTaq® Master Mix kit containing an SYBR green® probe (Promega, USA) in an Mx3005p PCR thermocycler system, with all steps performed according to the protocols described by the manufacturer. PCR was performed with a pre-degeneration step at 95 °C for 2 minutes, followed by 40 cycles of amplification/degeneration at 95 °C for 15 seconds and an annealing/extension step at 59/60 °C for 60 seconds. The 2^-ΔΔCt method of Livak & Schmittgen (2001) was used for the relative quantification of samples. The primers used in these procedures are described in Table I.

Table I
Gene sequence and annealing temperature (°C) of primers used in RT-qPCR.

Gene	Sequence	Annealing temperature (ºC)	Described by
TNF-α	Forward: 5´ CCCACTCTGACCCCTTTACT 3´ Reverse: 5´ TTTGAGTCCTTGATGGTGGT 3´	59	Syed et al. (2015)
IL-1β	Forward: 5´ GCCACCTTTTGACAGTGATG 3´ Reverse: 5´ AAGGTCCACGGGAAAGACAC 3´	60	Cheng et al. (2019)
IL-6	Forward: 5´ CTGCAAGAGACTTCCATCCAG 3´ Reverse: 5´ AGTGGTATAGACAGGTCTGTTGG 3´	59	Syed et al. (2015)
β-actin	Forward: 5´GGGAATGGGTCAGAAGGACTC 3´ Reverse: 5´GGTGTGGTGCCAGATCTTCTC 3´	59	De Lima et al. (2021)

Statistical analysis

Results were expressed as mean ± standard error of the mean (SEM) or median (minimum-maximum). For multiple comparisons of data, one-way analysis of variance (ANOVA) was used, and the level of significance between groups was determined by the Tukey post-test or Kruskal-Wallis test followed by the Dunn post-test. RT-qPCR results were analyzed by the Kolmogorov-Smirnov test. The difference between the means of the normal distribution (parametric data) was analyzed with Student’s t-test. p < 0.05 was considered statistically significant. All tests were performed using the GraphPad Prism® 5.03 statistical software (GraphPad Software Inc., USA).

RESULTS

Evaluation of edema, myeloperoxidase activity, and histological changes

Topical application of TPA induced acute ear edema 4 ̶24 h as well as an increase in myeloperoxidase (MPO) activity compared to the naive group (Figure 2a, 2b). NMP (0.03, 0.06, 0.12, 0.25, and 0.50 mg/ear) significantly reduced the ear edema response at all observation times as well as the MPO activity in comparison with the vehicle group. Dexamethasone (0.10 mg/ear) also significantly reduced ear edema and MPO activity (Figure 2b).

Figure 2
Effect of NMP on ear edema (a), myeloperoxidase (MPO) activity (b), average distance between epithelial crests of the ears (c) and histological changes (d - o) on TPA-induced contact dermatitis in mice. Dexamethasone (Dexa). Values are expressed as the mean ± SEM (n = 8 mice per group). Data were analyzed by one-way ANOVA followed by the Tukey’s test. * p < 0.05 vs naive group and # p < 0.05 vehicle group. Representative photomicrographs of transverse sections of mice ear biopsies obtained from the TPA-induced contact dermatitis in mice (d – o) (H&E staining). Naive (d, h and l); Vehicle (e, i and m); NMP 0.06 mg/ear (f, j and n); Dexamethasone 0.10 mg/ear (g, k and o). In (d), (e), (f) and (g), the double arrows indicate the edema intensity; in (i) the arrows indicate ectatic vessels; in (m) the arrows indicate the presence of inflammatory cells.

Histological analysis revealed significant ear tissue changes induced by TPA, including edema, inflammatory cell infiltrates, ectatic blood vessels, vascular neoformation, and hemorrhage (Figure 2; Table II). NMP (0.06 mg/ear) and dexamethasone (0.10 mg/ear) were able to minimize tissue damage induced by TPA, with a reduction of the tissue edema, inflammatory cell infiltrates, number of ectatic blood vessels, and hemorrhage compared with the vehicle group (Figure 2; Table II). NMP 0.06 mg/ear (171.60 ± 5.98 µm) and dexamethasone 0.10 mg/ear (104.5 ± 5.87 µm) reduced the relative distance between epithelial ridges as quantified by histological analysis compared to the vehicle group (234.10 ± 13.05 µm) (Figure 2c).

Table II
Histological analysis scores of the ears tissues of animals treated with NMP in TPA-induced contact dermatitis. Scores expressed as median (minimum - maximum) of 8 animals/group. Null (0), mild (1), moderate (2) and severe (3). ^a p < 0.05 vs Naive Group and ^b p < 0.05 vs Vehicle Group (Ethanol). For the analysis, the Kruskal-wallis test was used followed by the Dunns post-test.

Group	Edema	Inflammatory Cell Infiltration	Ectatic Blood Vessels	Vascular Neoformation	Hemorrhage
Naive	0 (0-1)	0 (0-1)	0 (0-2)	0 (0-0)	0 (0-0)
Vehicle	2 (1-3) a	3 (3-3) a	2 (1-3) a	0 (0-1)	1 (0-1) a
NMP (0.06 mg/ear)	0 (0-1) b	1 (0-2) b	1 (0-1) b	0 (0-1)	0 (0-0) b
Dexamethasone (0.10 mg/ear)	0 (0-0) b	0 (0-0) b	0 (0-1) b	0 (0-0)	0 (0-0) b

TNF-α, IL-6, IL-1β, IL-10, INF-γ, and MCP-1 tissue levels

The application of TPA resulted in a significant increase in tissue levels of TNF-α, IL-6, IL-1β, IL-10, INF-γ, and MCP-1 in the ear tissues of the vehicle group compared to the naive group. Specifically, there was a 580%, 912%, 100%, 713%, 249%, and 483% increase in TNF-α, IL-6, IL-1β, IL-10, INF-γ, and MCP-1, respectively. In contrast, treatment with NMP (0.06 mg/ear) reduced tissue levels of TNF-α, IL-6, IL-1β, IL-10, INF-γ, and MCP-1 by 48%, 29%, 32%, 45%, 52%, and 41%, respectively, compared to the vehicle group. Furthermore, treatment with Dexamethasone (0.10 mg/ear) reduced the same parameters by 40%, 65%, 41%, 59%, 73%, and 84%, respectively, compared to the vehicle group (Figure 3).

Figure 3
Effect of NMP on TNF-α (a), IL-6 (b), IL-1β (c), IL-10 (d), INF-γ (e) and MCP-1 (f) levels on TPA-induced in contact dermatitis in mice. NMP (0.06 mg/ear) and dexamethasone (Dexa, 0.10 mg/ear). Values are expressed as the mean ± SEM (n = 8 mice per group). Data were analyzed by one-way ANOVA followed by the Tukey’s test. * p < 0.05 vs naive group and # p < 0.05 vs vehicle group.

Relative expression of mRNA by RT-PCR

TPA increased mRNA expression for TNF-α, IL-6, and IL-1β in the tissues of the ears of the vehicle group compared to the naive group by 92%, 83%, and 93%, respectively. While treatments with NMP (0.06 mg/ear) and dexamethasone (0.10 mg/ear) reduced the expression of mRNA for TNF-α, IL-6, and IL-1β in the ear tissues compared to the vehicle group. NMP reduced the mRNA expression of TNF-α, IL-6, and IL-1β mRNA by 67%, 78%, and 45%, respectively, compared to the vehicle group, while for dexamethasone the reductions were 96%, 80%, and 92%, respectively (Figure 4).

Figure 4
Effect of NMP on TNF-α, IL-6 and IL-1β gene expression on TPA-induced contact dermatitis in mice. Values are expressed as the mean ± SEM (n = 8 mice per group). NMP (0.06 mg/ear) and dexamethasone (Dexa, 0.10 mg/ear). Data were analyzed by one-way ANOVA followed by the Tukey’s test. * p < 0.05 vs naive group and # p < 0.05 vs vehicle group.

DISCUSSION

The bark and leaves of S. obtusifolium are used in Brazilian folk medicine for their anti-inflammatory action (Oliveira et al. 2012, Ribeiro et al. 2018). Previously, the analysis of metabolites from S. obtusifolium leaves identified the presence of flavonoids, saponins, and triterpenes as the main components of its composition (Oliveira et al. 2012). An aqueous extract is obtained from the leaves of S. obtusifolium, whose methanolic fraction is rich in N-methyl-(2S,4R)-trans-4-hydroxy-L-proline (NMP), enabling the isolation of NMP from these leaves (Aquino et al. 2017).

Aquino et al. (2016) showed that topical administration of the methanolic extract of S. obtusifolium exerted an anti-edematogenic effect on Croton-oil- and phenol-induced ear edema in mice, but the mechanisms of action were not investigated. The present study provides evidence that topical administration of NMP exerts anti-inflammatory activity on TPA-induced irritant contact dermatitis in mice by decreasing the expression of pro-inflammatory cytokines.

Irritant contact dermatitis (ICD) is an inflammatory skin disease caused by chemicals. The initial event of ICD is the disruption of the epidermal barrier by the injurious agent, increasing skin permeability and induction of the release of proinflammatory cytokines, such as IL-1Ꞵ, TNF-α, IL-6, and IL-8, along with the release of vascular endothelial growth factor (VEGF) by keratinocytes (Nedoszytko et al. 2014, Turner et al. 2014, Mostosi & Simonart 2016). Thus, counter-regulatory cytokines appear in an attempt to control inflammation, such as IL-10 and the IL-1 receptor antagonist (Wei et al. 2011, Esser & Martin 2017, Pattarini & Soumelis 2017).

TPA is a known chemical skin irritant and ICD inducer in murine models. Its action is believed to occur when keratinocytes and epidermal dendritic cells produce inflammatory inducers such as pro-inflammatory cytokines and eicosanoids when they come into contact with TPA, inducing the onset of the acute inflammatory process and recruiting immune cells such as neutrophils, macrophages and mast cells from tissue surrounding the lesion (Zhang et al. 2014, You et al. 2019).

TPA stimulates a wide variety of intracellular pathways through protein kinase C (PKC) activation, including PI3K/AKT/NF-κB signaling, STAT3 signaling, and the consequent generation of inflammatory mediators such as TNF-α, IL-1β, IL-6, iNOS, COX-2, keratinocyte-derived chemokine and macrophage inflammatory protein (MIP-2), among other chemokines and prostaglandins with roles in the maintenance and amplification of the inflammatory process (Rakariyatham et al. 2019, Nakamura et al. 2020).

In our evaluation, topically administered NMP was able to significantly reduce edema and migration of neutrophils into the ear tissue induced by TPA, observed by the reduced activity of myeloperoxidase (MPO), an enzyme indicative of the presence of neutrophilic granulocytes in inflamed tissue (Derin et al. 2006, Gordon et al. 2008). The ability of NMP to reduce ear edema and MPO activity was checked by histological evaluation, where it reduced the mean distance between epithelial ridges and the amount of cellular inflammatory infiltrate, in addition to reducing other histological parameters indicative of tissue injuries, such as tissue edema, ectatic blood vessels, and hemorrhage.

Previously, Aquino et al. (2017) observed the reduction of carrageenan-induced paw edema in mice treated orally with NMP, verifying the inhibition of increased immunoreactivity of iNOS, COX-2, TNF-α, and NF-kB in the injured tissue. Our results are in agreement with these findings since they demonstrate a reduction in the levels of the pro-inflammatory cytokines TNF-α, IL-6, IL-1β, IFN-γ, and MCP-1, in addition to negatively regulating the expression genes for TNF-α, IL-6, and IL-1β in ear tissues subjected to TPA-induced contact dermatitis and treated topically with NMP.

TNF-α and IL-6 released by dendritic cells are key mediators of inflammatory and immune responses. This expression is controlled by TLR4-stimulated activation of NF-κB via regulation of the transcriptional activities of these cytokines in monocytes and dendritic cells (Wei et al. 2011). This possibly explains the reduction in the levels and expression of these inflammatory cytokines, and consequently of polymorphonuclear cells found in the present work.

MCP-1 is an important chemokine that attracts monocytes/macrophages, T cells, and dendritic cells to the inflammation site (Deshmane et al. 2009, Gschwandtner et al. 2019). In our study, TPA induced inflammatory cell chemotaxis by increasing tissue MCP-1 levels, while NMP and dexamethasone treatments significantly decreased this phenomenon.

IL-1β activates dendritic cells and T cells, with increased production of cytokines, chemokines, and VEGF and induction of the expression of adhesion molecules in endothelial cells and fibroblasts, which together lead to the perpetuation and intensification of cutaneous inflammation (Wei et al. 2011, Esser & Martin 2017, Pattarini & Soumelis 2017). IFN-γ, on the other hand, positively regulates several pro-inflammatory parameters, such as some interleukins, caspases, and TNF-α, being able to stimulate macrophages and dendritic cells (Schoenborn & Wilson 2007, Miller et al. 2009, Kopitar-Jerala 2017). In our study, TPA induced an increase in tissue levels of IL-1β and IFN-γ, which is related to the inflammatory process, while treatments with NMP and dexamethasone significantly decreased tissue levels of IL-1β and IFN-γ.

Although it has historically been considered an anti-inflammatory cytokine, IL-10 is a pleiotropic interleukin that has a dual role in the inflammatory processes (Ouyang et al. 2011, Mannino et al. 2015). We observed that TPA increased IL-10 levels in the ear tissues, while the groups treated with NMP and dexamethasone had a reduction in tissue levels of this cytokine. The discrepancy in IL-10 levels presented here can be explained by the results previously reported by Rakariyatham et al. (2019), wherein in the same model of TPA-induced contact dermatitis, the authors obtained results similar to ours. One explanation for this phenomenon is the correlation between low levels of IL-10 in the tissues of the ears undergoing treatment, with evidence of less tissue inflammation, which consequently produces less need for high levels of anti-inflammatory cytokines, such as IL-10.

NMP has a pyrrolidine ring in its structure, as does proline and its derivatives. The pyrrolidine ring has multiple functions, such as antioxidant, antimicrobial, anti-inflammatory, and immunomodulatory properties (Bamdad et al. 2015, Vitali 2015, Bamdad et al. 2017). This fact is already well documented and has a direct correlation with the results of several studies. Andrade et al. (2018) demonstrated that proline produced antioxidant and anti-inflammatory activities in the brain of rats treated with bacterial lipopolysaccharide (LPS). Ugwu et al. (2018) reported that lower molecular weight molecules obtained through chemical derivations of L-proline and hydroxyproline showed anti-inflammatory activity in a carrageenan-induced paw edema model in rats. Kumar & Yin (2018) and Zhi et al. (2022) correlated more complex proline-derived structures with their immunomodulatory action.

The negative modulatory effect of NMP on the expression of pro-inflammatory cytokines in TPA-induced contact dermatitis seen in this study may have implications for its future use as a topical anti-inflammatory substance.

CONCLUSION

Our results suggest that NMP acts as a topical anti-inflammatory agent that decreases the production of inflammatory cytokines in TPA-induced ICD, resulting in reduced tissue damage, suggesting that this natural product should be further evaluated for development as a therapeutic agent for the control of inflammatory skin diseases.

ACKNOWLEDGMENTS

This work was supported by grants and financial support from the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and the Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico (FUNCAP).

REFERENCES

• AGRA MF, BARACHO GS, BASÍLIO IJD, NURIT K, COELHO VP & BARBOSA DA. 2007. Sinopse da flora medicinal do cariri paraibano. Oecol Bras 4: 323-330.
• ALBUQUERQUE UP & OLIVEIRA RF. 2007. Is the use-impact on native caatinga species in Brasil reduced by the high species richness of medicinal plants. J Ethnopharmacol 113: 156-170.
• ANDRADE VS, ROJAS DB, ANDRADE RB, KIM TDH, VIZUETE AF, ZANATTA A, WAJNER M, GONÇALVES CAS & WANNMACHER CMD. 2018. A possible anti-inflammatory effect of proline in the brain cortex and cerebellum of rats. Mol Neurobiol 55: 4068-4077.
• AQUINO P ET AL. 2016. Avaliação da atividade anti-inflamatória tópica e antibacteriana do extrato metanólico das folhas de Sideroxylon obtusifolium. Acta biol. Colomb 21: 131-140.
• AQUINO PEA ET AL. 2019. The Wound Healing Property of N-Methyl-(2 S, 4 R)-trans-4-Hydroxy-L-Proline from Sideroxylon obtusifolium is Related to its Anti-Inflammatory and Antioxidant Actions. J Evid Based Integr Med 24: 1-11.
• AQUINO PEA, LUSTOSA IR, SOUSA CNS, CHAVES-FILHO AJM, LIMA FAV, SANTOS ADC, GRAMOSA NV, SILVEIRA ER & VIANA GSB. 2020. The N-Methyl-(2S, 4R)-trans-4-hydroxy-L-proline-Enriched Methanol Fraction from Sideroxylon obtusifolium Shows an Anticonvulsant Activity Associated with its Anti-inflammatory/Antioxidant Actions. Planta Med Int Open 7: e158-e169.
• AQUINO PEA, MAGALHÃES TR, NICOLAU LAD, LEAL LKAM, AQUINO NC, SANTOS SM, NEVES KRT, SILVEIRA ER & VIANA GSB. 2017. The anti-inflammatory effects of N-methyl-(2S, 4R)-trans-4-hydroxy-L-proline from Syderoxylon obtusifolium are related to its inhibition of TNF-alpha and inflammatory enzymes. Phytomedicine 24: 14-23.
• ARAÚJO-NETO V, BOMFIM RR, OLIVEIRA VOB, PASSOS AMPR, OLIVEIRA JPR, LIMA CA, MENDES SS, ESTEVAM CS & THOMAZZI SM. 2010. Therapeutic benefits of Sideroxylon obtusifolium (Humb. ex Roem. & Schult.) T.D. Penn., Sapotaceae, in experimental models of pain and inflammation. Rev Bras Farmacogn 20: 933-938.
• ATANASOV AG ET AL. 2021. Natural products in drug discovery: advances and opportunities. Nat Rev Drug Discov 20: 200-216.
• BAMDAD F, AHMED S & CHEN L. 2015. Specifically designed peptide structures effectively suppressed oxidative reactions in chemical and cellular systems. J Funct Foods 18: 35-46.
• BAMDAD F, SHIN SH, SUH JW, NIMALARATNE C & SUNWOO H. 2017. Anti-inflammatory and antioxidant properties of casein hydrolysate produced using high hydrostatic pressure combined with proteolytic enzymes. Molecules 22: 609.
• BELTRÃO AES, TOMAZ ACA, BELTRÃO FAS & MARINHO P. 2008. In vitro biomass production of Sideroxylon obtusifolium (Roem & Schult). Rev Bras Farmacogn 18: 696-698.
• BIONDO-SIMÕES MLP, ALCANTARA EM, DALLAGNOL JC, YOSHIZUMI KO, TORRES LFB & BORSATO KS. 2006. Cicatrização de feridas: estudo comparativo em ratos hipertensos não tratados e tratados com inibidor da enzima conversora da angiotensina. Rev Col Bras Cir 33: 74-78.
• BRADLEY PP, CHRISTENSEN RD & ROTHSTEIN G. 1982. Cellular and extracellular myeloperoxidase in pyogenic inflammation. Blood 60: 618-622.
• CALIXTO JB. 2019. The role of natural products in modern drug discovery. An Acad Bras Cienc 91: e20190105.
• CHATZIDIONYSIOU K ET AL. 2017. Efficacy of glucocorticoids, conventional and targeted synthetic disease-modifying antirheumatic drugs: a systematic literature review informing the 2016 update of the EULAR recommendations for the management of rheumatoid arthritis. Ann Rheum Dis 76: 1102-1107.
• CHENG C, WU H, WANG M, WANG L, ZOU H, LI S & LIU R. 2019. Estrogen ameliorates allergic airway inflammation by regulating activation of NLRP3 in mice. Biosci Rep 39: 1-12.
• DELFINO L, MASCIADRI S & FIGUEREDO E. 2005. Registro de Sideroxylon obtusifolium (Roem. & Schult.) T.D. Penn. (Sapotaceae) en bosques psamófilos de la costa atlántica de Rocha, Uruguay. Iheringia, Sér Bot 2: 129-133.
• DE LIMA RP ET AL. 2021. α, β-Amyrin prevents steatosis and insulin resistance in a high-fat diet-induced mouse model of NAFLD via the AMPK-mTORC1-SREBP1 signaling mechanism. Braz J Med Biol Res 54: 1-9.
• DERIN N, AGAC A, BAYRAM Z, ASAR M & IZGUT-UYSAL, VN. 2006. Effects of Lcarnitine on neutrophil-mediated ischemia–reperfusion injury in rat stomach. Cell Biochem Funct 24: 437-442.
• DESHMANE SL, KREMLEV S, AMINI S & SAWAYA BE. 2009. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res 29: 313-326.
• EGAWA G & KABASHIMA K. 2016. Multifactorial skin barrier deficiency and atopic dermatitis: essential topics to prevent the atopic march. J Allergy Clin Immunol 138: 350-358.
• ESSER PR & MARTIN SF. 2017. Pathomechanisms of Contact Sensitization. Curr Allergy Asthma Rep 17: 83.
• GORDON JS, WOLANIN PM, GONZALEZ AV, FELA DA, SARNGADHARAN G, ROUZARD K, PEREZ E, STOCK JB & STOCK MB. 2008. Topical N-acetyl-S-farnesyl-L-cysteine inhibits mouse skin inflammation, and unlike dexamethasone, its effects are restricted to the application site. J Invest Dermatol 128: 643-654.
• GSCHWANDTNER M, DERLER R & MIDWOOD KS. 2019. More than just attractive: how CCL2 influences myeloid cell behavior beyond chemotaxis. Front Immunol 10: 2759.
• HOWELL AN, GHAMRAWI RI, STROWD LC & FELDMAN SR. 2020. Pharmacological management of atopic dermatitis in the elderly. Expert Opin Pharmacother 21: 761-771.
• JOHNSON-HUANG LM, MCNUTT NS, KRUEGER JG & LOWES MA. 2009. Cytokine-producing dendritic cells in the pathogenesis of inflammatory skin diseases. Clinical J Clin Immunol 29: 247-256.
• KHALIFA SAM ET AL. 2019. Marine natural products: A source of novel anticancer drugs. Mar Drugs 17: 491-522.
• KOPITAR-JERALA N. 2017. The role of interferons in inflammation and inflammasome activation. Front Iimmunol 8: 873.
• KUMAR N & YIN C. 2018. The anti-inflammatory peptide Ac-SDKP: Synthesis, role in ACE inhibition, and its therapeutic potential in hypertension and cardiovascular diseases. Pharmacol Res 134: 268-279.
• LEE YG, LEE H, RYUK JA, HWANG JT, KIM HG, LEE DS, KIM YJ, YANG DC, KO BS & BAEK NI. 2019. 6-Methoxyflavonols from the aerial parts of Tetragonia tetragonoides (Pall.) Kuntze and their anti-inflammatory activity. Bioorg Chem 88: 102922.
• LIVAK KJ & SCHMITTGEN TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25: 402-408.
• LORENZI H & MATOS FJA. 2002. Plantas Medicinais do Brasil: nativas e exóticas. 2. ed. Nova Odessa-SP: Instituto Plantarum, 485 p.
• MANDLIK DS & MANDLIK SK. 2021. Atopic dermatitis: new insight into the etiology, pathogenesis, diagnosis and novel treatment strategies. Immunopharmacol Immunotoxicol 43: 105-125.
• MANNINO MH, ZHU Z, XIAO H, BAI Q, WAKEFIELD MR & FANG Y. 2015. The paradoxical role of IL-10 in immunity and cancer. Cancer Lett 367: 103-107.
• MILLER CHT, MAHER SG & YOUNG HA. 2009. Clinical use of interferon-γ. Ann N Y Acad Sci 1182: 69-79.
• MOSTOSI C & SIMONART T. 2016. Effectiveness of Barrier Creams against Irritant Contact Dermatitis. Dermatology 232: 353-362.
• NAKAMURA A, URATSUJI H, YAMADA Y, HASHIMOTO K, NOZAWA N & MATSUMOTO T. 2020. Anti-inflammatory effect of lanoconazole on 12-O-tetradecanoylphorbol-13-acetate-and 2, 4, 6-trinitrophenyl chloride–induced skin inflammation in mice. Mycoses 63: 189-196.
• NEDOSZYTKO B, SOKOŁOWSKA-WOJDYŁO M, RUCKEMANN-DZIURDZIŃSKA K, ROSZKIEWICZ J & NOWICKI RJ. 2014. Chemokines and cytokines network in the pathogenesis of the inflammatory skin diseases: atopic dermatitis, psoriasis and skin mastocytosis. Postepy Dermatol Alergol 31: 84-91.
• NGUYEN AV & SOULIKA AM. 2019. The dynamics of the skin’s immune system. Int J Mol Sci 20: 1811.
• NGUYEN HL & YIANNIAS JA. 2019. Contact dermatitis to medications and skin products. Clin Rev Allergy Immunol 56: 41-59.
• OLIVEIRA AP, RAITH M, KUSTER RM, ROCHA LM, HAMBURGER M & POTTERAT O. 2012. Metabolite profiling of the leaves of the Brazilian folk medicine Sideroxylon obtusifolium. Planta Med 78: 703-710.
• OUYANG W, RUTZ S, CRELLIN NK, VALDEZ PA & HYMOWITZ SG. 2011. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol 29: 71-109.
• PATTARINI L & SOUMELIS V. 2017. Keeping skin inflammation local. Nature Immunology 18: 250-251.
• PINTO NCC, MACHADO DC, SILVA JM, CONEGUNDES JLM, GUALBERTO ACM, GAMEIRO J, CHEDIER LM, CASTAÑON MCMN & SCIO E. 2015. Pereskia aculeata Miller leaves present in vivo topical anti-inflammatory activity in models of acute and chronic dermatitis. J Ethnopharmacol 173: 330-337.
• RAKARIYATHAM K ET AL. 2019. Inhibitory effects of 7, 7’-bromo-curcumin on 12-O-tetradecanoylphorbol-13-acetate-induced skin inflammation. Eur J Pharmacoly 858: 172479.
• RECIO MC, GINER RM, URIBURU L, MÁÑEZ S, CERDÁ M, DE LA FUENTE JR & RÍOS JL. 2000. In vivo activity of pseudoguaianolide sesquiterpene lactones in acute and chronic inflammation. Life Sci 66: 2509-2518.
• RIBEIRO VP, ARRUDA C, EL-SALAM MA & BASTOS JK. 2018. Brazilian medicinal plants with corroborated anti-inflammatory activities: a review. Pharma Bio 56: 253-268.
• SANTOS EB, DANTAS GS, SANTOS HB, DINIZ, MFFM & SAMPAIO FC. 2009. Estudo etnobotânico de plantas medicinais para problemas bucais no município de João Pessoa, Brasil. Rev Bras Farmacogn 19: 321-324.
• SCHOENBORN JR & WILSON CB. 2007. Regulation of interferon-γ during innate and adaptive immune responses. Adv Immunol 96: 41-101.
• SYED AK ET AL. 2015. Staphlyococcus aureus phenol-soluble modulins stimulate the release of proinflammatory cytokines from keratinocytes and are required for induction of skin inflammation. Infect Immun 83: 3428-3437.
• TURNER MD, NEDJAI B, HURST T & PENNINGTON DJ. 2014. Cytokines and chemokines: at the crossroads of cell signalling and inflammatory disease. Biochim Biophys Acta 1843: 2563-2582.
• UGWU DI, OKORO UC & MISHRA NK. 2018. Synthesis of proline derived benzenesulfonamides: A potent anti-Trypanosoma brucei gambiense agent. Eur J Med Chem 154: 110-116.
• VITAGLIANO L, BERISIO R, MAZZARELLA L & ZAGARI A. 2001. Structural Bases of Collagen Stabilization Induced by Proline Hydroxylation. Biopolymers 58: 459-464.
• VITALI A. 2015. Proline-rich peptides: Multifunctional bioactive molecules as new potential therapeutic drugs. Curr Protein Pept Sci 16: 147-162.
• WARSHAW EM ET AL. 2017. Occupational contact dermatitis in North American production workers referred for patch testing: retrospective analysis of cross-sectional data from the North American Contact Dermatitis Group 1998 to 2014. Dermatitis 28: 183-194.
• WEI WC, LIN SY, CHEN YJ, WEN CC, HUANG CY, PALANISAMY A, YANG NS & SHEU JH. 2011. Topical application of marine briarane-type diterpenes effectively inhibits 12-O-tetradecanoylphorbol-13-acetate-induced inflammation and dermatitis in murine skin. J Biomed Sci 8: 94.
• WITTMANN M, MCGONAGLE D & WERFEL T. 2014. Cytokines as therapeutic targets in skin inflammation. Cytokine Growth Factor Rev 25: 443-451.
• WOLLENBERG A ET AL. 2018. Consensus-based European guidelines for treatment of atopic eczema (atopic dermatitis) in adults and children: part I. J Eur Acad Dermatol Venereol 32: 657-682.
• YOU BR, YOO JM, BAEK SY & KIM MR. 2019. Anti-inflammatory effect of aged black garlic on 12-O-tetradecanoylphorbol-13-acetate-induced dermatitis in mice. Nutr Res Pract 13: 189-195.
• ZHANG M, ZHOU J, WANG L, LI B, GUO J, GUAN X, HAN Q & ZHANG H. 2014. Caffeic acid reduces cutaneous tumor necrosis factor alpha (TNF-α), IL-6 and IL-1β levels and ameliorates skin edema in acute and chronic model of cutaneous inflammation in mice. Biol Pharm Bull 37: 347-354.
• ZHI T, HONG D, ZHANG Z, LI S, XIA J, WANG C, WU Y, JIA Y & MA A. 2022. Anti-inflammatory and gut microbiota regulatory effects of walnut protein derived peptide LPF in vivo. Food Res Int 152: 110875.

Publication Dates

• Publication in this collection
  27 Oct 2023
• Date of issue
  2023

History

• Received
  17 Oct 2022
• Accepted
  20 Apr 2023