SciELO - Scientific Electronic Library Online

 
vol.58 issue9Brown adipose tissue: what have we learned since its recent identification in human adultsAn international survey of screening and management of hypothyroidism during pregnancy in Latin America author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • Portuguese (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Arquivos Brasileiros de Endocrinologia & Metabologia

On-line version ISSN 1677-9487

Arq Bras Endocrinol Metab vol.58 no.9 São Paulo Dec. 2014

http://dx.doi.org/10.1590/0004-2730000002819 

Artigos Originais

Estudo do polimorfismo G54D do gene MBL2 no diabetes melito gestacional

Study of polymorphism G54D of MBL2 gene in gestational diabetes mellitus

Rejane Baggenstoss 1  

Silvia Vanderléia Petzhold 1  

Izabela K. Michels Willemann 1  

Francisco Simões Pabis 1  

Paulo Gimenes 2  

Barbara Vicente de Souza 3  

Paulo Henrique Condeixa de França 1  

Jean Carl Silva 1  

1Departamento de Medicina da Universidade da Região de Joinville (Univille), Joinville, SC, Brazil

2Laboratório Gimenes, Joinville, SC, Brazil

3Endocrinologista do Instituto Catarinense de Endocrinologia e Diabetes, Joinville, SC, Brazil

RESUMO

Objetivo

Analisar a influência da associação do polimorfismo G54D (rs1800450) do gene MBL2 no diabetes melito gestacional (DMG) quanto à necessidade de tratamento complementar e ocorrência de recém-nascidos grandes para a idade gestacional.

Sujeitos e métodos

Cento e cinco pacientes com DMG segundo parâmetro da OMS (Organização Mundial da Saúde) foram avaliadas no período de novembro de 2010 a outubro de 2012. As gestantes foram divididas em dois grupos correspondentes à presença (n = 37) ou à ausência (n = 68) do alelo mutante. As variantes do polimorfismo G54D foram identificadas por meio da técnica de polimorfismos de comprimentos de fragmentos de restrição (RFLP). Parâmetros antropométricos e bioquímicos da mãe e do recém-nascido (RN) e a necessidade de terapia complementar associada à dietoterapia foram avaliados como desfechos primários.

Resultados

Das pacientes analisadas, 35,2% carregavam pelo menos um alelo mutante do polimorfismo G54D. Os dois grupos não apresentaram diferença significativa quanto a ganho de peso, paridade, idade, índice de massa corporal e idade gestacional de chegada à maternidade. Os grupos de pacientes portadoras ou não do alelo mutante não diferiram quanto à necessidade de tratamento complementar à dietoterapia (16,2% vs. 26,7%) respectivamente e à ocorrência de recém-nascidos grandes para a idade gestacional (24,3% vs. 13,2%).

Conclusão

Nossos dados demonstraram que o polimorfismo G54D do gene MBL2 não teve efeito sobre a necessidade de tratamento complementar acrescido à dietoterapia e à ocorrência de recém-nascidos grandes para a idade gestacional na população estudada. Arq Bras Endocrinol Metab. 2014;58(9):900-5

Palavras-Chave: MBL2; polimorfismo de nucleotídeo único; diabetes melito gestacional

ABSTRACT

Objective

To assess the association of the G54D (rs1800450) polymorphism of the gene MBL2 in the gestational diabetes mellitus with the need for additional treatment and the occurrence of large newborns for the gestational age.

Subjects and methods

One hundred and five patients recruited in Joinville – Brazil were evaluated between November 2010 and October 2012. Pregnant women were divided in two groups correspondents to the presence (n = 37) or absence (n = 68) of the mutant allele. The variants of the polymorphism G54D were identified by restriction fragment lengths polymorphisms (RFLP). Anthropometric and biochemical parameters of the mother and the newborn, and the necessity of additional therapy associated with diet were assessed as the primary outcomes.

Results

Thirty-five point two percent of the evaluated patients carried at least one mutated allele of G54D polymorphism. There were no significant differences in weight gain, parity, age, body mass index and gestational age of arrival at maternity between the two groups. The groups of patients with or without the mutated allele did not differ in the need for additional treatment associated with diet (16.2% vs. 26.7%) respectively and with the occurrence of large newborns for gestational age (24.3% vs. 13.2%).

Conclusion

Our data showed that the polymorphism G54D of the gene MBL2 had no effect in the need for additional treatment associated with the diet-based therapy and in the occurrence of large newborns for gestational age in the studied population. Arq Bras Endocrinol Metab. 2014;58(9):900-5

Key words: MBL2; single nucleotide polymorphism; gestational diabetes mellitus

INTRODUÇÃO

O diabetes melito gestacional (DMG) é conceituado como o aparecimento de um grau variável de intolerância à glicose diagnosticada pela primeira vez durante a gestação e que pode ou não persistir após o parto (1,2). Ocorre em 7% das gestações, podendo variar de 1% a 14% dependendo da população estudada (3,4).

DMG é um distúrbio heterogêneo no qual vários fatores genéticos e ambientais podem estar envolvidos. Duas características marcantes na gravidez são a hiperinsulinemia e a resistência à insulina, que podem predispor a paciente ao desenvolvimento do DMG. No diabetes, tem-se um estado de inflamação crônica subclínica no tecido adiposo, músculos e fígado, caracterizado pela produção anormal de citocinas e mediadores pró-inflamatórios (5-7).

A proteína lectina de ligação à manose (MBL) tem capacidade de ativar a cascata do complemento e estimular a fagocitose. Adicionalmente, a MBL também inibe a liberação de fator de necrose tumoral alfa (TNF-α). Então, a deficiência de MBL na gestação favorece uma resposta inflamatória prolongada e sustentada, favorecendo a atividade do TNF-α e outras citocinas pró-inflamatórias como as interleucinas IL-1β, IL-6, IL-8 e IL-12 que, por sua vez, participam das vias moleculares de resistência à insulina (8-10).

Há dados conflitantes sobre diabetes tipo 1 e a deficiência de MBL. No estudo de Araujo e cols. (11), demonstrou-se que a deficiência de MBL está associada a aumento do risco de desenvolver diabetes na infância e adolescência, resistência à insulina e à obesidade. Já no estudo de Bouwman e cols. (12), verificou-se o aumento sérico de MBL nos pacientes diabéticos tipo 1.

A MBL é uma proteína sintetizada no fígado, considerada um componente importante do sistema imune inato, cujo nível sérico é determinado geneticamente (13). São conhecidos três alelos mutantes principais no éxon 1 do gene MBL2 associados à deficiência de MBL e implicados na redução da funcionalidade da proteína R52C (polimorfismo rs5030737), G54D (rs1800450) e G57E (rs1800451). A ocorrência dos alelos mutantes, em homozigose ou heterozigose, determina o fenótipo correspondente à deficiência de MBL (13,14).

No presente estudo trabalhamos com a hipótese de que a deficiência de MBL poderia estar envolvida no aparecimento de algum grau de resistência à insulina. Portanto, o objetivo do presente estudo foi verificar a prevalência das variantes do polimorfismo G54D do gene MBL2 nas gestantes apresentando DMG. Avaliamos também a relação dos genótipos com parâmetros antropométricos da mãe e do recém-nascido (RN), assim como a necessidade de terapia complementar à dieta.

MATERIAIS E MÉTODOS

Sujeitos e variáveis clínico-laboratoriais

Estudo de coorte prospectivo com recrutamento consecutivo de participantes, entre novembro de 2010 a outubro de 2012, na Maternidade Darcy Vargas (MDV) em Joinville, SC. Participaram do estudo gestantes diagnosticadas com DMG, conforme os critérios da OMS (15).

Dividiram-se as gestantes em dois grupos, correspondentes à presença ou à ausência do alelo mutante. As gestantes apresentavam idade mínima de 18 anos, idade gestacional entre 20 e 32 semanas (calculada a partir da primeira ultrassonografia realizada pela paciente) e gestação única. Na primeira consulta de pré-natal, foram verificados a massa corporal, a estatura e o índice de massa corporal (IMC), que foi calculado pela divisão da massa corporal pela altura ao quadrado. Consideraram-se como sobrepeso os resultados obtidos acima de 25 kg/cm2 até 29,9 kg/cm2 e obesidade acima de 30 kg/cm2. Foram avaliados o ganho de peso durante a gestação, a necessidade de tratamento complementar e o tipo de tratamento (hipoglicemiante oral ou insulina). Foram excluídas as gestantes diagnosticadas com doença hipertensiva específica da gravidez (DHEG) (n = 3) e uma gestante que teve aborto hidrópico.

Em todas as gestantes, após o jejum de 8 a 12 horas, foram coletadas as amostras de sangue em veia antecubital. As variáveis avaliadas foram: curva glicêmica com 75 gramas de glicose entre a 24ª e 28ª semanas de gravidez, glicemia de jejum no diagnóstico e glicemia após o tratamento, hemoglobina glicada (HbA1c) após tratamento e glicemia pós-prandial. As mensurações das glicemias foram realizadas por meio do método de química seca no aparelho Vitros Fusion 5.1. Foi coletado 1 mL de sangue, no mesmo local no momento das coletas da rotina de acompanhamento pré-natal dessas pacientes, sem necessidade de uma punção venosa específica. O sangue foi encaminhado para o Laboratório de Biologia Molecular da Universidade da Região de Joinville (Univille), onde foi processado e analisado para a pesquisa do polimorfismo G54D do gene MBL2.

Os dados avaliados dos recém-nascidos foram: peso ao nascer, sendo considerados recém-nascidos grandes para a idade gestacional quando peso acima do percentil 90 em curvas de crescimento ou macrossomia se peso superior a 4.000 g (16), ocorrência de hipoglicemia (glicemia capilar < 40 mg/dL) e APGAR de primeiro e quinto minutos.

Todas as gestantes foram acompanhadas no serviço de alto risco da MDV, pela mesma equipe multidisciplinar, composta por médicos, nutricionista, enfermeiras e fisioterapeuta. As gestantes consentiram à participação por meio de assinatura do Termo de Consentimento Livre e Esclarecido específico. A pesquisa foi aprovada pelo Comitê de Ética em Pesquisa da Univille – processo 203/2011.

O tamanho da amostra foi calculado estimando que na MDV sejam atendidas, em média, 500 gestantes diagnosticadas com DMG por ano. A presença da deficiência da MBL na população geral é estimada em, aproximadamente, 10% (10). Os outros dois desfechos primários selecionados (ocorrência de recém-nascido grande para a idade gestacional e necessidade de terapia complementar) apresentam frequências estimadas de 30% (17). Uma vez que se estabeleceu comparar a diferença das frequências de necessidade de implementação de terapia complementar entre as gestantes portadoras e não portadoras do alelo mutante do polimorfismo G54D, então a frequência estimada é de 3% (30% x 10%). Considerando o intervalo de confiança (IC) da prevalência estimada de 1,5 a 4,5%, chega-se a uma amostra de 109 (80% de nível de confiança).

Análises genotípicas

As amostras de sangue periférico (300 µL) foram submetidas à extração do DNA genômico utilizando-se os procedimentos recomendados pelo fabricante do kit Genomic DNA Extraction Kit (Real Biotech Corporation, Taiwan).

Um segmento do gene MBL2, correspondente ao éxon 1 e parte da região 5’ não traduzida, foi amplificado via reação em cadeia da polimerase (PCR) com emprego dos iniciadores GAGGCTTAGACCTATGGGGCTAG e CAGGCAGTTTCCTCTGGAAGG (18). As reações (50 µL) foram preparadas em cabine de uso específico e continham 50-500 ng DNA, 200 µM dNTP’s, 1,5 mM MgCl2, 1 U Platinum Taq® DNA Polimerase (Invitrogen, EUA), tampão de reação (Invitrogen), 50 pmol iniciadores e água grau PCR. A termociclagem foi realizada segundo as informações do produtor em aparelho XP Cycler (Bioer Technology Co., Japão).

Os produtos gerados na PCR (amplicons) foram submetidos à digestão pela endonuclease BanI (New England Biolabs, EUA), com sítio de reconhecimento específico correspondente a GGYRCC, a 37ºC durante duas horas, conforme recomendações do fabricante. Os padrões de restrição obtidos foram verificados por meio de eletroforese (100V/2h) em gel de agarose a 1%, contendo 0,5 µg/mL de brometo de etídeo, e documentados digitalmente sob luz ultravioleta (MiniBis-Pro, DNR Bio-Imaging Systems Ltda., Israel). São previstos três padrões de restrição: para o genótipo heterozigoto (A/B) são esperados três fragmentos distintos (83, 1034 e 1117 pares de base; pb), para o genótipo homozigoto selvagem (A/A) preveem-se dois fragmentos (83 e 1034 pb) e para o genótipo homozigoto mutante (B/B) espera-se observar apenas o segmento de 1117 pb.

Análises estatísticas

Inicialmente, todas as variáveis foram analisadas descritivamente. Para as variáveis contínuas (quantitativas), a análise foi realizada por meio do cálculo de médias e desvios-padrão. Para as variáveis categóricas (qualitativas), calcularam-se frequências absolutas e relativas.

Para a análise da hipótese de igualdade entre as médias dos grupos, foi utilizado o teste t. Como a normalidade foi rejeitada, utilizou-se o teste não paramétrico de Mann-Whitney. O teste de normalidade utilizado foi Kolmogorov-Smirnov.

Para se testar a homogeneidade dos grupos em relação às proporções, foi utilizado o teste Qui-quadrado ou o teste exato de Fisher. Ficou estabelecido nível de significância menor que 0,05.

Os cálculos estatísticos foram realizados utilizando-se o software SPSS versão 11.0.

RESULTADOS

O polimorfismo G54D no éxon 1 do gene MBL2 foi investigado em um grupo de 109 pacientes com DMG. Foram excluídas três gestantes que desenvolveram doença hipertensiva específica da gravidez (DHEG) e uma que teve aborto hidrópico, resultando em 105 pacientes efetivamente consideradas no presente estudo. As gestantes foram divididas em dois subgrupos correspondentes à presença (n = 37) ou à ausência (n = 68) do alelo mutado.

O perfil epidemiológico dos subgrupos foi comparado quanto ao ganho de peso, paridade, idade, IMC e idade gestacional de chegada à maternidade, não sendo observadas diferenças estatisticamente significantes (Tabela 1). No tocante à antropometria e à composição corporal das gestantes, identificou-se excesso de peso na maioria da população estudada. No subgrupo das pacientes portadoras do genótipo selvagem, 63,2% apresentavam sobrepeso, com um IMC médio de 26,5 kg/m2, enquanto 62,2% das pacientes portadoras do alelo mutado apresentavam sobrepeso, com um IMC médio de 26,3 kg/m2.

Tabela 1 Perfil epidemiológico da população (médias e desvio-padrão) 

Gene MBL2 Alelo selvagem N = 68 Alelo raro N = 37 P
Idade (anos) 30,6 (6,2) 30,6 (6,0) 0,830*
Idade gestacional chegada (semanas) 28,1 (5,6) 26,1 (6,0) 0,380
Gestações (número) 2,8 (1,9) 2,5 (1,5) 0,842
IMC (kg/m2) 26,5 (5,2) 26,2 (3,3) 0,520*
Ganho peso (kg) 11,3 (6,3) 10,4 (9,1) 0,923*

* Teste t Student; Teste de Mann-Whitney; Índice de massa corporal.

Das 105 mulheres com DMG em que as variantes do polimorfismo G54D do gene MBL2 foram estudadas, 37 (35,2%) apresentavam ao menos um alelo mutado, sendo que quatro (3,8%) apresentavam o genótipo AA e 33 (31,4%), o genótipo AG. Portanto, o genótipo GG (64,8%) e o alelo G (79,5%) mostraram-se os mais prevalentes na população estudada (Tabela 2). Os genótipos estavam em equilíbrio de Hardy-Weinberg.

Tabela 2 Frequências genotípica e alélica relativas ao códon 54 do gene MBL2 e necessidade de terapia complementar 

  Somente dieta Dieta e terapia complementar P OR
  [n (%)] [n (%)]   (95% CI)
Genótipo        
MBL2 selvagem 40 (38,1) 28 (26,7) 0,7 1,21
MBL2 mutado 20 (19,0) 17 (16,2)    
G54D        
 GG 40 (38,1) 28 (26,7)    
 AG 17 (16,2) 16 (15,2)    
 AA 3 (2,9) 1 (0,9)    
Alelo        
 G 97 (46,2) 72 (34,3)    
 A 23 (10,9) 18 (8,6) 1 0,948

OR: odds ratio.

De forma equivalente não foram encontradas diferenças significantes quanto aos resultados laboratoriais de glicemia em jejum no diagnóstico, glicemia duas horas após curva glicêmica com 75 gramas de glicose e HbA1c, assim como glicemias de jejum e pós-prandial com tratamento, conforme apresentado na tabela 3.

Tabela 3 Resultados de parâmetros clínico-laboratoriais de acompanhamento do diabetes melito gestacional (médias e desvios-padrão) 

Gene MBL2 G54D selvagem (GG) n = 68 G54D mutado (AG+AA) n = 37 P
Glicemia jejum no diagnóstico 87,6 mg/dL (12,4) 85,36 mg/dL (10,7) 0,156*
Glicemia 2 h após GTT no diagnóstico 155,36 mg/dL (17,2) 154,66 mg/dL (12,3) 0,968*
Glicemia jejum com tratamento 85,86 mg/dL (8,9) 85,96 mg/dL (8,6) 0,239*
Glicemia pós-prandial com tratamento 114,96 mg/dL (15,1) 114,46 mg/dL (13,7) 0,488*
HbA1c 5,4% (0,3) 5,6% (0,5) 0,748*
Trat. somente dieta§ 40   20   0,482||
Trat. dieta e med. 28   17   0,482||

* Teste t Student; Glicemia 2 horas após curva glicêmica com 75 g de glicose; Hemoglobina glicada; § Tratamento somente com dieta; || Teste Qui-quadrado de Fischer; Tratamento com dieta e medicação.

Houve necessidade de tratamento complementar com metformina para 13 (35,1%) pacientes que apresentavam o alelo mutado do polimorfismo G54D e para 20 (29,4%) das pacientes com o genótipo selvagem (p = 0,537). A terapêutica com metformina não foi suficiente, sendo realizada complementação com insulinoterapia em 8 (11,8%) das gestantes que estavam no grupo do genótipo selvagem e 5 (13,5%) no grupo com o alelo mutado (p = 0,475).

Os recém-nascidos (RNs) das mães que apresentavam o alelo mutado do polimorfismo G54D geraram infantes mais pesados, porém sem alcançar significância estatística (Tabela 4). Verificou-se a presença de RN grandes para a idade gestacional (GIG) em nove (9/37; 24,3%) das pacientes no grupo dispondo o alelo raro e apenas nove (9/68; 13,2%) no outro grupo.

Tabela 4 Características do recém-nascido 

Gene MBL2 G54D selvagem (GG) [n (%)] G54D mutado (AG+AA) [n (%)] P
  68 (64,8) 37 (35,2)  
PIG 4 (5,9) 2 (5,4) 0,212*
AIG 55 (80,9) 26 (70,3) 0,216*
GIG 9 (13,2) 9 (24,3) 0,149*
APGAR 1 7,7 (1,9) 8,6 (0,6) 0,326
APGAR 2 8,9 (1,5) 9,3 (0,5) 0,940

* Teste Qui-quadrado de Fischer; Teste de Mann-Whitney; PIG: pequeno para idade gestacional; AIG: adequado para idade gestacional; GIG: grande para idade gestacional.

DISCUSSÃO

O DMG é uma doença complexa, sendo razoável acreditar na existência de vários mediadores para sua ocorrência. Nos RNs das mães que desenvolveram DMG, há maior probabilidade de macrossomia fetal, sendo este um fator predisponente à resistência à insulina, obesidade e diabetes tipo 2 na infância e no adulto (19,20). Para essas mães, há um risco de 10% ao ano de desenvolver diabetes tipo 2 no futuro (1).

A identificação de variantes genéticas que influenciam o DMG é um foco importante de pesquisas na atualidade com vistas a melhorar o entendimento dos mecanismos subjacentes à patogênese dessa desordem. A mutação G54D do gene MBL2 está associada à diminuição dos níveis de MBL (21).

O primeiro relato sobre o risco aumentado para o desenvolvimento de DMG associado a uma mutação no gene MBL2 foi realizado por Megia e cols. em 2004 (10). A mutação no códon 54 do éxon 1 é considerada a mutação mais frequente do gene MBL2. O polimorfismo G54D é comum na população caucasiana. No estudo de Ferraroni em 2011, a prevalência do genótipo AA foi de 5,1%, que é semelhante à europeia (4%) e à japonesa (5%). Em nosso estudo, foram identificados quatro pacientes (3,8%) com presença do genótipo AA (22).

A presença de ao menos um alelo mutado do polimorfismo G54D foi observada em 30% da população na maioria dos grupos étnicos avaliados (23,24). Em nosso estudo, 35,2% das pacientes analisadas carregavam o alelo mutado do polimorfismo G54D, enquanto 43,8% das gestantes diabéticas apresentavam o mesmo alelo no grupo de espanholas estudado por Megia e cols.

Na análise do peso das gestantes com DMG, observou-se que a maioria das pacientes de ambos os subgrupos apresentou excesso de peso. É reconhecido que a obesidade constitui um fator de risco significativo para o desenvolvimento de diabetes melito tipo 2 (DM2) após o parto (25,26). A identificação da alta frequência (62,7%) de sobrepeso é de suma importância, pois as mulheres com DMG, avaliadas no presente estudo, encontram-se sob elevado risco de desenvolver DM2 após a gestação. Tal fato indica um aspecto a ser considerado no planejamento da assistência durante e após a gestação, o que também foi apontado por outros autores, constituindo fator de risco modificável passível de intervenção e prevenção quanto à ocorrência de DM2 após DMG (27-29).

Há estudos que demonstraram que a presença do alelo mutado está associada à deficiência de MBL, ocorrência que favorece o desenvolvimento de diabetes gestacional mais severo (10). No estudo de Megia e cols., as gestantes portadoras do alelo mutado necessitaram mais de insulina em seu tratamento complementar à dietoterapia, o que não foi observado em nossa população estudada.

Os dados coletados e resultados de genotipagem demonstraram que o polimorfismo não esteve significantemente associado aos parâmetros do RN, inclusive peso ao nascimento e ocorrência de RN classificado como GIG. Enquanto alguns autores encontraram uma relação com aumento do risco para o parto prematuro e peso reduzido ao nascimento quando as pacientes apresentavam o alelo mutado do polimorfismo G54D (30), outros autores, como Megia e cols., demonstraram associação com maior peso ao nascimento (10).

Considerando os resultados aqui apresentados, fazem-se necessários estudos adicionais para investigar a associação e o impacto do polimorfismo G54D do gene MBL2 em relação ao DMG, visto que o número limitado de sujeitos alocados pode justificar a ausência de diferenças entre os subgrupos.

REFERÊNCIAS

American Diabetes Association. Standards of Medical Care in Diabetes Position Statement. Diabetes Care. 2011;34 Suppl1:S11-61. [ Links ]

Committee opinion nº 504: screening and diagnosis of gestational diabetes mellitus. Obstet Gynecol. 2011;118(3):751-3. [ Links ]

International Association of Diabetes and Pregnancy Study Groups Consensus Panel, Metzger BE, Gabbe SG, Persson B, Buchanan TA, Catalano PA, Damm P, et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 2010;33(3):676-82. [ Links ]

Bardenheier BH, Elixhauser A, Imperatore G, Devlin HM, Kuklina EV, Geiss LS, et al. Variation in prevalence of gestational diabetes mellitus among hospital discharges for obstetric delivery across 23 States in the United States. Diabetes Care. 2013;36(5):1209-14. [ Links ]

Petry CJ. Gestational diabetes: risk factors and recent advances in its genetics and treatment. Br J Nutr. 2010;104(6):775-87. [ Links ]

Catalano PM, Kirwan JP, Haugel-de Mouzon S, King J. Gestational diabetes and insulin resistance: role in short- and long-term implications for mother and fetus. J Nutr. 2003;133(5 Suppl 2):1674S-1683S. [ Links ]

Denison FC, Roberts KA, Barr SM, Norman JE. Obesity, pregnancy, inflammation, and vascular function. Reproduction. 2010;140(3):373-85. [ Links ]

Soell M, Lett E, Holveck F, Schöller M, Wachsmann D, Klein JP. Activation of human monocytes by streptococcal manose glucose polymers is mediated by CD14 antigen, and mannan binding protein inhibits TNF-alpha release. J Immunol. 1995;154(2):851-60. [ Links ]

Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol. 2010;11(5):373-84. [ Links ]

Megia A, Gallart L, Fernández-Real JM, Vendrell J, Simón I, Gutierrez C, et al. Mannose-binding lectin gene polymorphisms associated with gestational diabetes mellitus. J Clin Endocrinol Metab. 2004;89(10):5081-7. [ Links ]

Araujo J, Brandão LA, Guimarães RL, Santos S, Falcão EA, Milanese M, et al. Mannose binding lectin gene polymorphisms are associated with type 1 diabetes in Brazilian children and adolescents. Hum Immunol. 2007;68(9):739-43. [ Links ]

Bouwman LH, Eerligh P, Terpstra OT, Daha MR, de Knijff P, Ballieux BE, et al. Elevated levels of mannose-binding lectin at clinical manifestation of type 1 diabetes in juveniles. Diabetes. 2005;54(10):3002-6. [ Links ]

Madsen HO, Garred P, Thiel S, Kurtzhals JA, Lamm LU, Ryder LP, et al. Interplay between promoter and structural gene variants control basal serum level of mannan-binding protein. J Immunol. 1995;155(6):3013-20. [ Links ]

Steffensen R, Thiel S, Varming K, Jersild C, Jensenius JC. Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J Immun Methods. 2000;241(1-2):33-42. [ Links ]

WHO World Health Organization. Report of a WHO consultation: diagnosis and classification of diabetes mellitus and its complications. Department of Noncommunicable Disease Surveillance. Genebra, 1999. [ Links ]

Marcondes E. Crescimento normal e deficiente. São Paulo: Editora Sarvier; 1989. [ Links ]

Jolly MC, Sebire NJ, Harris JP, Regan L, Robinson S. Risk factors for macrosomia and its clinical consequences: a study of 350,311 pregnancies. Eur J Obstet Gynecol Reprod Biol. 2003;111(1):9-14. [ Links ]

Matsushita M, Hijikata M, Ohta Y, Iwata K, Matsumoto M, Nakao K, et al. Hepatitis C virus 116 infection and mutations of mannose-binding lectin gene MBL. Arch Virol. 1998;143(4):645-51. [ Links ]

Silva JC, Bertini AM, Ribeiro TE, de Carvalho LS, Melo MM, Barreto Neto L. Fatores relacionados à presença de recém- -nascidos grandes para a idade gestacional em gestantes com diabetes mellitus gestacional. Rev Bras Ginecol Obstet. 2009;31(1):5-9. [ Links ]

Dabelea D. The predisposition to obesity and diabetes in offspring of diabetic mothers. Diabetes Care. 2007;30(2):169-74. [ Links ]

Garred P, Larsen F, Madsen HO, Koch C. Mannose-binding lectin deficiency--revisited. Mol Immunol. 2003;40(2-4):73-84. [ Links ]

Ferraroni NR. Níveis séricos e polimorfismos gênicos da lectina ligadora de manose (MBL) e da serino protease associada à MBP (MASP)-2 em uma amostra da população brasileira [tese]. São Paulo: Faculdade de Medicina; 2011; Disponível em: http://www.teses.usp.br/teses/disponiveis/5/5133/tde-20072011-141341/. [ Links ]

Minchinton RM, Dean MM, Clark TR, Heatley S, Mullighan CG. Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population. Scand J Immunol. 2002;56(6):630-41. [ Links ]

Van Till JW, Boermeester MA, Modderman PW, Van Sandick JW, Hart MH, Gisbertz SS, et al. Variable mannose-binding lectin expression during postoperative acute-phase response. Surg Infect (Larchmt). 2006;7(5):443-52. [ Links ]

Baptiste-Roberts K, Barone BB, Gary TL, Golden SH, Wilson LM, Bass EB, et al. Risk factors for type 2 diabetes among women with gestational diabetes: a systematic review. Am J Med. 2009;122(3):207-14. [ Links ]

Tovar A, Chasan-Taber L, Eggleston E, Oken E. Postpartum screening for diabetes among women with a history of gestational diabetes mellitus. Prev Chronic Dis. 2011;8(6):A124. [ Links ]

Lee AJ, Hiscock RJ, Wein P, Walker SP, Permezel M. Gestational diabetes mellitus: clinical predictors and long-term risk of developing type 2 diabetes: a retrospective cohort study using survival analysis. Diabetes Care. 2007;30(4):878-83. [ Links ]

Ratner RE. Prevention of type 2 diabetes in women with previous gestational diabetes. Diabetes Care. 2007;30(2):242-5. [ Links ]

Kim SY, England L, Sappenfield W, Wilson HG, Bish CL, Salihu HM, et al. Racial/ethnic differences in the percentage of gestational diabetes mellitus cases attributable to overweight and obesity, Florida, 2004-2007. Prev Chronic Dis. 2012;9:E88. [ Links ]

Annells MF, Hart PH, Mullighan CG, Heatley SL, Robinson JS, Bardy P, et al. Interleukins-1, -4, -6, -10, tumor necrosis factor, transforming growth factor-beta, FAS, and mannose-binding protein C gene polymorphisms in Australian women: risk of preterm birth. Am J Obstet Gynecol. 2004;191(6):2056-67. [ Links ]

Received: May 22, 2014; Accepted: October 21, 2014

Correspondência para: Rejane Baggenstoss. Departamento de Medicina, Universidade da Região de Joinville. Rua Paulo Malschitzki, 10, Campus Universitário, Zona Industrial. 89219-710 – Joinville, SC, Brazil. rejane@icedjoinville.com.br

Declaração: os autores declaram não haver conflitos de interesse científico neste estudo.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.