Abstracts
Juvenile myoclonic epilepsy (JME) accounts for 26% of generalized idiopathic epileptic syndromes. The highest levels of thrombin activity are closely involved in the development of neurological diseases, including epilepsy. The prothrombin c.20210G>A (rs1799963) variation, which alters prothrombin mRNA stability, is associated with high plasma prothrombin levels.
Objective
: The present study was designed to investigate whether the SNP rs1799963 is a risk factor for JME in the northeastern Brazilian population.
Results
: The polymorphism was genotyped in 207 controls and 123 patients using polymerase chain reaction-restriction fragment length polymorphism method. No significant differences were observed in the genotype and allele frequencies of this polymorphism between cases and controls.
Conclusion
: These results present no evidence for an association of rs1799963 with JME. Further studies including other types of epilepsy are required to investigate the involvement of prothrombin gene in the genetic susceptibility to chronic seizure.
polymorphism; prothrombin; juvenile myoclonic epilepsy
Epilepsia mioclônica juvenil (EMJ) representa 26% das síndromes epilépticas idiopáticas generalizadas. Níveis elevados de atividade da trombina estão intimamente envolvidos no desenvolvimento de distúrbios neurológicos, incluindo epilepsia. A variante c.20210G>A (rs1799963) do gene de protrombina, que altera a estabilidade do RNAm, está associada com altos níveis de protrombina no plasma. Objetivo: Investigar se o SNP rs1799963 é um fator de risco para EMJ em uma amostra da população do nordeste brasileiro.
Resultados
: O polimorfismo foi genotipado em 123 pacientes e 207 controles usando a reação de polimerase em cadeia com restrição de polimorfismo. Não observamos diferença significativa nas frequências alélicas e genotípicas deste polimorfismo, entre as populações de pacientes e controle.
Conclusão
: Estes resultados não demonstram evidências para uma associação do polimorfismo rs1799963 com EMJ. Estudos posteriores, incluindo outros tipos de epilepsia, são necessários para investigar o envolvimento do gene protrombina na susceptibilidade genética a crises crônicas.
polimorfismo; protrombina; epilepsia mioclônica juvenil
Juvenile myoclonic epilepsy (JME) is a subtype of common idiopathic generalized epilepsy
(IGE) and accounts for 10% of all forms of epilepsy and up to 26% of IGE. Onset is at puberty
with equal sex ratio and it is characterized by myoclonic jerks, occasional generalized
tonic-clonic seizures, and sometimes absence seizures11 Janz D. Epilepsy with impulsive petit mal (juvenile myoclonic epilepsy).
Acta Neurol Scand. 1985;72(5):449-59.
http://dx.doi.org/10.1111/j.1600-0404.1985.tb00900.x
https://doi.org/10.1111/j.1600-0404.1985...
. It is also highly drug-dependent, since a frequent recurrence is
reported after antiepileptic drugs (AED) discontinuation22 Beghi E. AED discontinuation may not be dangerous in seizure-free patients.
J Neural Transm. 2011;118(2):187-91.
http://dx.doi.org/10.1007/s00702-010-0528-y
https://doi.org/10.1007/s00702-010-0528-...
. Genetic factors are known to play an important role in the etiology
of JME. Despite the existence of rare mutations responsible for some familial forms inherited
in a mendelian pattern, the genetics of JME is complex and probably reflect the simultaneous
involvement of multiple genes with minor effect and environmental factors33 Gardiner M. Genetics of idiopathic generalized epilepsies. Epilepsia.
2005;46(suppl s9):15-20.
http://dx.doi.org/10.1111/j.1528-1167.2005.00310.x
https://doi.org/10.1111/j.1528-1167.2005...
. The identification of these susceptibility genes is a great
challenge44 Gitai DL, Romcy-Pereira RN, Gitai LL, Leite JP, Garcia-Cairasco N,
Paco-Larson ML. Genes e epilepsia I: epilepsia e alterações genéticas. Rev Assoc Med Bras.
2008;54(3):272-8. http://dx.doi.org/10.1590/S0104-42302008000300023
https://doi.org/10.1590/S0104-4230200800...
. For this purpose, an
experimental approach that has been widely used is genetic association studies directed to
candidate genes selected according to their molecular function.
Evidences support a role for serine proteases in the sequence of events that can lead to
neuropathological situations55 Gingrich MB, Traynelis SF. Serine proteases and brain damage - is there a
link? Trends Neurosci. 2000;23(9):399-407.
http://dx.doi.org/10.1016/S0166-2236(00)01617-9
https://doi.org/10.1016/S0166-2236(00)01...
. Thrombin, a
serine protease essential in the coagulation cascade is involved in the production of
seizures66 Maggio N, Shavit E, Chapman J, Segal M. Thrombin induces long-term
potentiation of reactivity to afferent stimulation and facilitates epileptic seizures in
rat hippocampal slices: toward understanding the functional consequences of
cerebrovascular insults. J Neurosci. 2008;28(3):732-6.
http://dx.doi.org/10.1523/JNEUROSCI.3665-07.2008
https://doi.org/10.1523/JNEUROSCI.3665-0...
. It was demonstrated that active
thrombin injected into rat brains resulted in both electrographic and clinical seizures77 Lee KR, Drury I, Vitarbo E, Hoff JT. Seizures induced by intracerebral
injection of thrombin: a model of intracerebral hemorrhage. J Neurosurg. 1997;87(1):73-8.
http://dx.doi.org/10.3171/jns.1997.87.1.0073
https://doi.org/10.3171/jns.1997.87.1.00...
. It was proposed that thrombin, acting on its
receptor, protease-activated receptor 1 (PAR1), has marked effects on the production of
long-term potentiation (LTP) in responses to afferent stimulation and that it enhances the
sensitivity to epileptic seizures in brain slices66 Maggio N, Shavit E, Chapman J, Segal M. Thrombin induces long-term
potentiation of reactivity to afferent stimulation and facilitates epileptic seizures in
rat hippocampal slices: toward understanding the functional consequences of
cerebrovascular insults. J Neurosci. 2008;28(3):732-6.
http://dx.doi.org/10.1523/JNEUROSCI.3665-07.2008
https://doi.org/10.1523/JNEUROSCI.3665-0...
. Thrombin may triggers the generation of epileptic seizures by reducing
the inhibitory and increasing the excitatory tone in CA3 neurons55 Gingrich MB, Traynelis SF. Serine proteases and brain damage - is there a
link? Trends Neurosci. 2000;23(9):399-407.
http://dx.doi.org/10.1016/S0166-2236(00)01617-9
https://doi.org/10.1016/S0166-2236(00)01...
,88 Isaeva E, Hernan A, Isaev D, Holmes GL. Thrombin facilitates seizures
through activation of persistent sodium current. Ann Neurol. 2012;72(2):192-8.
http://dx.doi.org/10.1002/ana.23587
https://doi.org/10.1002/ana.23587...
,99 Maggio N, Cavaliere C, Papa M, Blatt I, Chapman J, Segal M. Thrombin
regulation of synaptic transmission: implications for seizure onset. Neurobiol Dis.
2013;50:171-8. http://dx.doi.org/10.1016/j.nbd.2012.10.017
https://doi.org/10.1016/j.nbd.2012.10.01...
. The
brain can be exposed to thrombin as a result of increased permeability of the blood-brain
barrier that takes place during severe epilepsy. Moreover, at a brain with a intact BBB as
supposed for idiophatic epilepsy, thrombin can be generated locally from prothrombin which was
shown to be expressed in rat and human brains1010 Arai T, Miklossy J, Klegeris A, Guo JP, McGeer PL. Thrombin and prothrombin
are expressed by neurons and glial cells and accumulate in neurofibrillary tangles in
Alzheimer disease brain. J Neuropathol Exp Neurol. 2006;65(1):19-25.
http://dx.doi.org/10.1097/01.jnen.0000196133.74087.cb
https://doi.org/10.1097/01.jnen.00001961...
,1111 Boven LA, Vergnolle N, Henry SD, Silva C, Imai Y, Holden J, et al.
Up-regulation of proteinase-activated receptor 1 expression in astrocytes during HIV
encephalitis. J Immunol. 2003;170(5):2638-46.
http://dx.doi.org/10.4049/jimmunol.170.5.2638
https://doi.org/10.4049/jimmunol.170.5.2...
. In
support of this, patients with neurological disorders present the levels of local prothrombin,
thrombin and PAR1 increased on astrocytes and neurons1212 Sokolova E, Reiser G. Prothrombin/thrombin and the thrombin receptors PAR-1
and PAR-4 in the brain: localization, expression and participation in neurodegenerative
diseases. Thromb Haemost. 2008;100(4):576-81.
http://dx.doi.org/10.1160/TH08-03-0131
https://doi.org/10.1160/TH08-03-0131...
.
The SNP rs1799963 leads to the c.20210G>A variation in the 3´-UTR region of prothrombin
gene, which is a bifunctional polymorphism that alters prothrombin mRNA stability and
processing1313 Carter AM, Sachchithananthan M, Stasinopoulos S, Maurer F, Medcalf RL.
Prothrombin G20210A is a bifunctional gene polymorphism. Thromb Haemost.
2002;87(5):846-53.. Three-fold more prothrombin
protein and mRNA were produced in NIH-3T3 cells transfected with the prothrombin cDNAs
containing the rs1799963*A allele compared to cells with rs1799963*G1313 Carter AM, Sachchithananthan M, Stasinopoulos S, Maurer F, Medcalf RL.
Prothrombin G20210A is a bifunctional gene polymorphism. Thromb Haemost.
2002;87(5):846-53.. In fact, this polymorphism is associated with high plasma
prothrombin levels and with an increased risk of thrombosis and other disease conditions1414 Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation
in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma
prothrombin levels and an increase in venous thrombosis. Blood.
1996;88(10):3698-703.,1515 Favaretto E, Sartori M, Conti E, Legnani C, Palareti G. G1691A factor V and
G20210A FII mutations, acute ischemic stroke of unknown cause, and patent foramen ovale.
Thromb Res. 2012;130(5):720-4.
http://dx.doi.org/10.1016/j.thromres.2012.07.020
https://doi.org/10.1016/j.thromres.2012....
. These physiological attributes make the protrombin an interesting
candidate gene for investigation in an IGE syndrome such as JME. Through this case/control
design, we intended to investigate whether SNP rs1799963 show association with JME in one
northeastern Brazilian population.
METHOD
Patients and controls
This study included 123 unrelated Brazilian patients with JME and 207 normal control
subjects. The study was approved by the Ethics Committee of the Federal University of
Alagoas, Brazil (no. 0900-2005-11). The subjects signed informed consent before blood
tests were performed. Cases were matched with controls according to age, sex, ethnicity,
and geographic location of origin. Individuals with a history of epileptic seizures or
neuropsychiatric disorders were excluded from the control sample. All patients were
recruited from the state of Alagoas in northeastern Brazil. The probands were
unambiguously diagnosed cases of JME with classification based on the published criteria
of the Commission on Classification and Terminology of the International League Against
Epilepsy1616 Commission on Classification and Terminology of the International League
Against Epilepsy. Proposal for revised classification of epilepsies and epileptic
syndromes. Epilepsia. 1989;30(4):389-99.
http://dx.doi.org/10.1111/j.1528-1157.1989.tb05316.x
https://doi.org/10.1111/j.1528-1157.1989...
. All patients were
submitted to electroencephalography analysis and only those with generalized spike wave
were included in this study.
Genetic analysis
The SNP rs1799963 was detected by the use of the protocols described by Kruse et al.1717 Kruse L, Mitchell AM, Camargo CA Jr, Hernandez J, Kline JA. Frequency of
thrombophilia-related genetic variations in patients with idiopathic pulmonary embolism in
an urban emergency department. Clin Chem. 2006;52(6):1026-32.
http://dx.doi.org/10.1373/clinchem.2005.061861
https://doi.org/10.1373/clinchem.2005.06...
, with modification. Briefly, DNA was
extracted from peripheral blood leucocytes using FlexiGene DNA Kit (Qiagen). A total of 50
ng of genomic DNA was mixed with 5 pmol of each polymerase chain reaction (PCR) primer in
a total volume of 25 µL containing 10 mM Tris-hydrochloride, pH 8.8; 50 mM potassium
chloride; 0.8% Nonidet P40; 1.5 mM magnesium chloride; 0.2 mM each deoxyribonucleotide
triphosphate; and 0.5 of DNA polymerase (Fermentas Life Sciences). Following primers: 5`
CAATAAAAGTGACTCTCATC 3´ (forward, underlined T indicates change to create TaqI site) and
5´ AGGTGGTGGATTCTTAAGTC 3` (reverse) were used to obtain PCR products of 118 bp size
(Gene-Bank accession no. ref|NT_009237.18). The reaction mixture was cycled as follows in
a DNA thermal cycler (BioCycler, MJ96G model): inicial denaturation step at 94ºC for 3
min, 35 cycles at 94ºC for 1 min, 55ºC for 1 min and 72ºC for 1 min, and a final extension
at 72ºC for 7 min. A 12 µL aliquot of the amplicon was then submitted to restriction
reaction at 65°C for 6 h with Taq I Restriction Enzyme (New England Biolabs, UK; cat. no.
R0149L). Digestion products were separated by electrophoresis on 2.5% agarose gels and
were visualized by ultraviolet light after staining with ethidium bromide. In this assay,
the rs1799963*G allele was digested, whereas the rs1799963*A was not. Digestion of the
wild-type PCR product gave a fragment of 98 bp, and digestion of the variant PCR product
gave a fragment of 118 bp.
Statistical analysis
All descriptive and statistical analysis was performed using SNPStats1818 Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the
analysis of association studies. Bioinformatics. 2006;22(15):1928-9.
http://dx.doi.org/10.1093/bioinformatics/btl268
https://doi.org/10.1093/bioinformatics/b...
. Allele and genotype frequencies were
calculated by counting and Hardy-Weinberg equilibrium was estimated using Chi-square test.
Genetic association analysis was performed using logistic regression analysis, including
odds ratio (OR) with the 95% confidence interval (95%CI). We then estimated the OR
adjusted by those clinical variables that were selected in the general linear model
analysis with a logistic regression stepwise procedure. The selected clinical variables
evaluated were sex, pharmacological treatment and type of seizure. A priori statistical
power analysis was performed by GPOWER 3.1.7 software1919 Faul F, Erdfelder E, Buchner A, Lang AG. Statistical power analyses using
G*Power 3.1: tests for correlation and regression analyses. Behav Res Methods.
2009;41(4):1149-60. http://dx.doi.org/10.3758/BRM.41.4.1149
https://doi.org/10.3758/BRM.41.4.1149...
using the following parameters: logistic regression test;
two-tail; OR = 1.5; nominal significance level α = 0.05; n = 330.
RESULTS
The mean age at onset of the JME probands was 13 years (standard deviation (SD) = 4.0), of which 65% were females. The triad of myoclonus, absences, and generalized tonic-clonic seizures was observed in 41%, the combination of myoclonus and generalized tonic-clonic seizures in 50%, the combination of myoclonus and absence was observed in 8%, and the myoclonus alone in 1% of patients. Of the patients, 58% were receiving monotherapy treatment with sodium valproate, 7% with Phenobarbital and 5% with lamotrigine, carbamazepine or fenitoine. The other 30% of patients were receiving polytherapy treatment. The populations studied had the following ethnic distribution: among patients 23% were Caucasians, 73.7% were Mulatto and 3.3% were African descent; among controls 30.3% were Caucasians, 62.2% were Mulatto and 7.5 % were of African descent.
The genotype distribution did not deviate significantly from that expected by Hardy-Weinberg equilibrium (p = 1.0). Duplicated genotyping of 20% of samples revealed 100% of genotyping concordance. According Table, the proportions of rs1799963*GG and rs1799963GA were 97.6% and 2.4% in JME patients, and 97.6% and 2.4% in control group, respectively. None individual was genotyped as rs1799963*AA. The allele frequencies of rs1799963*G and rs1799963*A were 99% and 1% in JME patients, and 99% and 1% in control group, respectively. Logistic regression results did not showed significant association signal between rs1799963 and JME phenotype (p = 0.99) even when odds ratio was adjusted by clinical variables (data not shown). This study showed a statistical power of 82.81% to detect association of SNP rs1799963 as susceptibility for JME.
DISCUSSION
To our knowledge this is the first association study between the SNP rs1799963 of the
prothrombin gene and epilepsy. Patients with JME, the most common subtype of idiopathic
generalized epilepsy which presents a strong influence of the genetic component, were
selected. We studied rs1799963 in JME because it has been functionally related to altered
levels of products (RNA and proteins) of the prothrombin gene and thrombin protein1313 Carter AM, Sachchithananthan M, Stasinopoulos S, Maurer F, Medcalf RL.
Prothrombin G20210A is a bifunctional gene polymorphism. Thromb Haemost.
2002;87(5):846-53.,1414 Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation
in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma
prothrombin levels and an increase in venous thrombosis. Blood.
1996;88(10):3698-703.. The highest levels of thrombin activity are closely involved in
the development of neurological diseases, including epilepsy99 Maggio N, Cavaliere C, Papa M, Blatt I, Chapman J, Segal M. Thrombin
regulation of synaptic transmission: implications for seizure onset. Neurobiol Dis.
2013;50:171-8. http://dx.doi.org/10.1016/j.nbd.2012.10.017
https://doi.org/10.1016/j.nbd.2012.10.01...
. However, our data did not show a significant difference in the
genotype and allele frequencies of this polymorphism between cases and controls, suggesting
that there is no association of rs1799963 with JME in this Brazilian sample.
Although the sample size used in this analysis, statistical power showed that this sample
is enough to detect association with JME Additionaly, our study included only the patients
with JME rather than analyzing a clinically heterogeneous population with several epilepsy
syndromes. This approach might have minimized possible bias from the limited sample size,
which is a common problem in genetic association studies2020 Greenberg DA, Subaran R. Blinders, phenotype, and fashionable genetic
analysis: a critical examination of the current state of epilepsy genetic studies.
Epilepsia. 2011;52(1):1-9.
http://dx.doi.org/10.1111/j.1528-1167.2010.02734.x
https://doi.org/10.1111/j.1528-1167.2010...
,2121 Santos B, Marques T, Malta M, Gameleira F, Secolin R, Andrade T et al. PER2
rs2304672, CLOCK rs1801260, and PER3 rs57875989 polymorphisms are not associated with
juvenile myoclonic epilepsy. Epilepsy Behav. 2014;36:82-5.
http://dx.doi.org/10.1016/j.yebeh.2014.04.024
https://doi.org/10.1016/j.yebeh.2014.04....
.
However, replication studies in independent sample are needed in order to strength our
findings.
Our data also contributes to the investigation of the frequency of rs1799963 polymorphism
in Brazilian population. Considering the general population, including both patient and
control individuals, the prevalence of heterozygous carriers were 0.6% and 1.8% among
Caucasian and Mulatto individuals, respectively. The mutant allele rs1799963*A was not
detected in Afro-descendants individuals. These findings are in agreement with other reports
showing that the prothrombin polymorphism varies among different ethnic groups, presenting a
very low frequency in Afro-descendants (0.3%)2222 Segal JB, Brotman DJ, Necochea AJ, Emadi A, Samal L, Wilson LM, et al.
Predictive value of factor V Leiden and prothrombin G20210A in adults with venous
thromboembolism and in family members of those with a mutation: a systematic review. JAMA.
2009;301(23):2472-85. http://dx.doi.org/10.1001/jama.2009.853
https://doi.org/10.1001/jama.2009.853...
.
The frequencies of genotypes (98% for rs1799963*GG and 2% for rs1799963*GA) and alleles
(99% for rs1799963*G and 1% for rs1799963*A) in northeastern Brazilian population (patients
and control) observed in this study are consistent with results in other Brazilian
subpopulations reported in previous studies. In fact, in general Brazilian population the
mutant allele frequency ranged between 0.7%-3.6% (rs1799963*A)2323 Andrade FL, Annichino-Bizzacchi JM, Saad ST, Costa FF, Arruda VR.
Prothrombin mutant, factor V Leiden, and thermolabile variant of methylenetetrahydrofolate
reductase among patients with sickle cell disease in Brazil. Am J Hematol.
1998;59(1):46-50.
http://dx.doi.org/10.1002/(SICI)1096-8652(199809)59:1<46::AID-AJH9>3.0.CO;2-#
http://dx.doi.org/10.1002/(SICI)1096-865...
,2424 Couto FD, Boas WV, Lyra I, Zanette A, Dupuit MF, Almeida MN et al. A C677T
methylenetetrahydrofolate reductase (MTHFR) polymorphism and G20210A mutation in the
prothrombin gene of sickle cell anemia patients from Northeast Brazil. Hemoglobin.
2004;28(3):237-41. http://dx.doi.org/10.1081/HEM-120040308
https://doi.org/10.1081/HEM-120040308...
,2525 Silva Filho IL, Leite AC, Moura PG, Ribeiro GS, Cavalcante AC, Azevedo FC et
al. Genetic polymorphisms and cerebrovascular disease in children with sickle cell anemia
from Rio de Janeiro, Brazil. Arq Neuropsiquiatr. 2011;69(3):431-5.
http://dx.doi.org/10.1590/S0004-282X2011000400004
https://doi.org/10.1590/S0004-282X201100...
.
Brazilian population has an extremely heterogeneous ethnic composition, unevenly distributed
across the country with variable degrees of admixtures2525 Silva Filho IL, Leite AC, Moura PG, Ribeiro GS, Cavalcante AC, Azevedo FC et
al. Genetic polymorphisms and cerebrovascular disease in children with sickle cell anemia
from Rio de Janeiro, Brazil. Arq Neuropsiquiatr. 2011;69(3):431-5.
http://dx.doi.org/10.1590/S0004-282X2011000400004
https://doi.org/10.1590/S0004-282X201100...
. This heterogeneity may also explain the allele frequency spectrum
observed when different reports are considered. Various studies showed that the carrier
frequency of the prothrombin rs1799963 is different among populations who immigrated to
Brazil. In healthy Southern Europeans it was around 3%2626 Rosendaal FR, Doggen CJ, Zivelin A, Arruda VR, Aiach M, Siscovick DS, et al.
Geographic distribution of the 20210 G to A prothrombin variant. Thromb Haemost.
1998;79(4):706-8., nearly twice as high as the data obtained from Northern European
populations2727 Cumming AM, Keeney S, Salden A, Bhavnani M, Shwe KH, Hay CR. The prothrombin
gene G20210A variant: prevalence in a U.K. anticoagulant clinic population. Br J Haematol.
1997;98(2):353-5. http://dx.doi.org/10.1046/j.1365-2141.1997.2353052.x
https://doi.org/10.1046/j.1365-2141.1997...
,2828 Hillarp A, Zöller B, Svensson PJ, Dahlbäck B. The 20210 A allele of the
prothrombin gene is a common risk factor among Swedish outpatients with verified deep
venous thrombosis. Thromb Haemost. 1997;78(3):990-2.. In contrast, rs1799963 was found to be
rare in African Americans and totally absent among Japanese and Koreans2929 Hessner MJ, Luhm RA, Pearson SL, Endean DJ, Friedman KD, Montgomery RR.
Prevalence of prothrombin G20210A, factor V G1691A (Leiden), and methylenetetrahydrofolate
reductase (MTHFR) C677T in seven different populations determined by multiplex
allele-specific PCR. Thromb Haemost. 1999;81(5):733-8.,3030 Isshiki I, Murata M, Watanabe R, Matsubara Y, Kawano K, Aoki N et al.
Frequencies of prothrombin 20210 G-->A mutation may be different among races--studies
on Japanese populations with various forms of thrombotic disorders and healthy subjects.
Blood Coagul Fibrinolysis. 1998;9(1):105-6.
http://dx.doi.org/10.1097/00001721-199801000-00014
https://doi.org/10.1097/00001721-1998010...
. Knowing the frequency of prothrombin polymorphism in Brazilian
miscigenated population and subgroups may have clinical and epidemiological
implications.
Acknowledgments
The authors thank all the individuals who participated in the study and the Neurology care unit team of Professor Alberto Antunes Hospital/Federal University of Alagoas.
Acknowledgments References:
-
1Janz D. Epilepsy with impulsive petit mal (juvenile myoclonic epilepsy). Acta Neurol Scand. 1985;72(5):449-59. http://dx.doi.org/10.1111/j.1600-0404.1985.tb00900.x
» https://doi.org/10.1111/j.1600-0404.1985.tb00900.x -
2Beghi E. AED discontinuation may not be dangerous in seizure-free patients. J Neural Transm. 2011;118(2):187-91. http://dx.doi.org/10.1007/s00702-010-0528-y
» https://doi.org/10.1007/s00702-010-0528-y -
3Gardiner M. Genetics of idiopathic generalized epilepsies. Epilepsia. 2005;46(suppl s9):15-20. http://dx.doi.org/10.1111/j.1528-1167.2005.00310.x
» https://doi.org/10.1111/j.1528-1167.2005.00310.x -
4Gitai DL, Romcy-Pereira RN, Gitai LL, Leite JP, Garcia-Cairasco N, Paco-Larson ML. Genes e epilepsia I: epilepsia e alterações genéticas. Rev Assoc Med Bras. 2008;54(3):272-8. http://dx.doi.org/10.1590/S0104-42302008000300023
» https://doi.org/10.1590/S0104-42302008000300023 -
5Gingrich MB, Traynelis SF. Serine proteases and brain damage - is there a link? Trends Neurosci. 2000;23(9):399-407. http://dx.doi.org/10.1016/S0166-2236(00)01617-9
» https://doi.org/10.1016/S0166-2236(00)01617-9 -
6Maggio N, Shavit E, Chapman J, Segal M. Thrombin induces long-term potentiation of reactivity to afferent stimulation and facilitates epileptic seizures in rat hippocampal slices: toward understanding the functional consequences of cerebrovascular insults. J Neurosci. 2008;28(3):732-6. http://dx.doi.org/10.1523/JNEUROSCI.3665-07.2008
» https://doi.org/10.1523/JNEUROSCI.3665-07.2008 -
7Lee KR, Drury I, Vitarbo E, Hoff JT. Seizures induced by intracerebral injection of thrombin: a model of intracerebral hemorrhage. J Neurosurg. 1997;87(1):73-8. http://dx.doi.org/10.3171/jns.1997.87.1.0073
» https://doi.org/10.3171/jns.1997.87.1.0073 -
8Isaeva E, Hernan A, Isaev D, Holmes GL. Thrombin facilitates seizures through activation of persistent sodium current. Ann Neurol. 2012;72(2):192-8. http://dx.doi.org/10.1002/ana.23587
» https://doi.org/10.1002/ana.23587 -
9Maggio N, Cavaliere C, Papa M, Blatt I, Chapman J, Segal M. Thrombin regulation of synaptic transmission: implications for seizure onset. Neurobiol Dis. 2013;50:171-8. http://dx.doi.org/10.1016/j.nbd.2012.10.017
» https://doi.org/10.1016/j.nbd.2012.10.017 -
10Arai T, Miklossy J, Klegeris A, Guo JP, McGeer PL. Thrombin and prothrombin are expressed by neurons and glial cells and accumulate in neurofibrillary tangles in Alzheimer disease brain. J Neuropathol Exp Neurol. 2006;65(1):19-25. http://dx.doi.org/10.1097/01.jnen.0000196133.74087.cb
» https://doi.org/10.1097/01.jnen.0000196133.74087.cb -
11Boven LA, Vergnolle N, Henry SD, Silva C, Imai Y, Holden J, et al. Up-regulation of proteinase-activated receptor 1 expression in astrocytes during HIV encephalitis. J Immunol. 2003;170(5):2638-46. http://dx.doi.org/10.4049/jimmunol.170.5.2638
» https://doi.org/10.4049/jimmunol.170.5.2638 -
12Sokolova E, Reiser G. Prothrombin/thrombin and the thrombin receptors PAR-1 and PAR-4 in the brain: localization, expression and participation in neurodegenerative diseases. Thromb Haemost. 2008;100(4):576-81. http://dx.doi.org/10.1160/TH08-03-0131
» https://doi.org/10.1160/TH08-03-0131 -
13Carter AM, Sachchithananthan M, Stasinopoulos S, Maurer F, Medcalf RL. Prothrombin G20210A is a bifunctional gene polymorphism. Thromb Haemost. 2002;87(5):846-53.
-
14Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood. 1996;88(10):3698-703.
-
15Favaretto E, Sartori M, Conti E, Legnani C, Palareti G. G1691A factor V and G20210A FII mutations, acute ischemic stroke of unknown cause, and patent foramen ovale. Thromb Res. 2012;130(5):720-4. http://dx.doi.org/10.1016/j.thromres.2012.07.020
» https://doi.org/10.1016/j.thromres.2012.07.020 -
16Commission on Classification and Terminology of the International League Against Epilepsy. Proposal for revised classification of epilepsies and epileptic syndromes. Epilepsia. 1989;30(4):389-99. http://dx.doi.org/10.1111/j.1528-1157.1989.tb05316.x
» https://doi.org/10.1111/j.1528-1157.1989.tb05316.x -
17Kruse L, Mitchell AM, Camargo CA Jr, Hernandez J, Kline JA. Frequency of thrombophilia-related genetic variations in patients with idiopathic pulmonary embolism in an urban emergency department. Clin Chem. 2006;52(6):1026-32. http://dx.doi.org/10.1373/clinchem.2005.061861
» https://doi.org/10.1373/clinchem.2005.061861 -
18Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22(15):1928-9. http://dx.doi.org/10.1093/bioinformatics/btl268
» https://doi.org/10.1093/bioinformatics/btl268 -
19Faul F, Erdfelder E, Buchner A, Lang AG. Statistical power analyses using G*Power 3.1: tests for correlation and regression analyses. Behav Res Methods. 2009;41(4):1149-60. http://dx.doi.org/10.3758/BRM.41.4.1149
» https://doi.org/10.3758/BRM.41.4.1149 -
20Greenberg DA, Subaran R. Blinders, phenotype, and fashionable genetic analysis: a critical examination of the current state of epilepsy genetic studies. Epilepsia. 2011;52(1):1-9. http://dx.doi.org/10.1111/j.1528-1167.2010.02734.x
» https://doi.org/10.1111/j.1528-1167.2010.02734.x -
21Santos B, Marques T, Malta M, Gameleira F, Secolin R, Andrade T et al. PER2 rs2304672, CLOCK rs1801260, and PER3 rs57875989 polymorphisms are not associated with juvenile myoclonic epilepsy. Epilepsy Behav. 2014;36:82-5. http://dx.doi.org/10.1016/j.yebeh.2014.04.024
» https://doi.org/10.1016/j.yebeh.2014.04.024 -
22Segal JB, Brotman DJ, Necochea AJ, Emadi A, Samal L, Wilson LM, et al. Predictive value of factor V Leiden and prothrombin G20210A in adults with venous thromboembolism and in family members of those with a mutation: a systematic review. JAMA. 2009;301(23):2472-85. http://dx.doi.org/10.1001/jama.2009.853
» https://doi.org/10.1001/jama.2009.853 -
23Andrade FL, Annichino-Bizzacchi JM, Saad ST, Costa FF, Arruda VR. Prothrombin mutant, factor V Leiden, and thermolabile variant of methylenetetrahydrofolate reductase among patients with sickle cell disease in Brazil. Am J Hematol. 1998;59(1):46-50. http://dx.doi.org/10.1002/(SICI)1096-8652(199809)59:1<46::AID-AJH9>3.0.CO;2-#
» http://dx.doi.org/10.1002/(SICI)1096-8652(199809)59:1<46::AID-AJH9>3.0.CO;2-# -
24Couto FD, Boas WV, Lyra I, Zanette A, Dupuit MF, Almeida MN et al. A C677T methylenetetrahydrofolate reductase (MTHFR) polymorphism and G20210A mutation in the prothrombin gene of sickle cell anemia patients from Northeast Brazil. Hemoglobin. 2004;28(3):237-41. http://dx.doi.org/10.1081/HEM-120040308
» https://doi.org/10.1081/HEM-120040308 -
25Silva Filho IL, Leite AC, Moura PG, Ribeiro GS, Cavalcante AC, Azevedo FC et al. Genetic polymorphisms and cerebrovascular disease in children with sickle cell anemia from Rio de Janeiro, Brazil. Arq Neuropsiquiatr. 2011;69(3):431-5. http://dx.doi.org/10.1590/S0004-282X2011000400004
» https://doi.org/10.1590/S0004-282X2011000400004 -
26Rosendaal FR, Doggen CJ, Zivelin A, Arruda VR, Aiach M, Siscovick DS, et al. Geographic distribution of the 20210 G to A prothrombin variant. Thromb Haemost. 1998;79(4):706-8.
-
27Cumming AM, Keeney S, Salden A, Bhavnani M, Shwe KH, Hay CR. The prothrombin gene G20210A variant: prevalence in a U.K. anticoagulant clinic population. Br J Haematol. 1997;98(2):353-5. http://dx.doi.org/10.1046/j.1365-2141.1997.2353052.x
» https://doi.org/10.1046/j.1365-2141.1997.2353052.x -
28Hillarp A, Zöller B, Svensson PJ, Dahlbäck B. The 20210 A allele of the prothrombin gene is a common risk factor among Swedish outpatients with verified deep venous thrombosis. Thromb Haemost. 1997;78(3):990-2.
-
29Hessner MJ, Luhm RA, Pearson SL, Endean DJ, Friedman KD, Montgomery RR. Prevalence of prothrombin G20210A, factor V G1691A (Leiden), and methylenetetrahydrofolate reductase (MTHFR) C677T in seven different populations determined by multiplex allele-specific PCR. Thromb Haemost. 1999;81(5):733-8.
-
30Isshiki I, Murata M, Watanabe R, Matsubara Y, Kawano K, Aoki N et al. Frequencies of prothrombin 20210 G-->A mutation may be different among races--studies on Japanese populations with various forms of thrombotic disorders and healthy subjects. Blood Coagul Fibrinolysis. 1998;9(1):105-6. http://dx.doi.org/10.1097/00001721-199801000-00014
» https://doi.org/10.1097/00001721-199801000-00014
-
Support: Brazilian Agencies FAPEAL grant #60030-692/2009 and CNPq. JPLB and DHA received fellowships from FAPEAL. TGA is a CNPq research fellow.
-
The study was produced in Department of Cell, Molecular Biology and Genetic, Institute of Biological Sciences and Health, Federal University of Alagoas, Maceió, Alagoas, Brazil.
Publication Dates
-
Publication in this collection
Apr 2015
History
-
Received
14 Oct 2013 -
Received
08 Nov 2014 -
Accepted
28 Nov 2014