SciELO - Scientific Electronic Library Online

 
vol.89 issue5Maternal perception and attitudes regarding healthcare professionals' guidelines on feeding practices in the child's first year of lifeInterdisciplinary intervention in obese children and impact on health and quality of life author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Jornal de Pediatria

Print version ISSN 0021-7557

J. Pediatr. (Rio J.) vol.89 no.5 Porto Alegre Sept./Oct. 2013

http://dx.doi.org/10.1016/j.jped.2013.01.004 

ARTIGO ORIGINAL

 

Adiposidade corporal, mas não resistência insulínica, associa-se ao polimorfismo -675 4G/5G no gene PAI-1 em uma amostra de crianças mexicanas

 

 

Ulises de la Cruz-MossoI; José Francisco Muñoz-ValleII; Aralia Berenice Salgado-BernabéI; Natividad Castro-AlarcónIII; Lorenzo Salgado-GoytiaIII; José Sánchez-CoronaIV; Silvia Esperanza Flores-MartínezIV; Isela Parra-RojasIII,*

IBSc, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Guerrero, México
IIDoutor, Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Guadalajara, Jalisco, México
IIIDoutora, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Guerrero, México
IVDoutor, División de Medicina Molecular, Centro de Investigación Biomédica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, México

 

 


RESUMO

OBJETIVO: Elaboramos este estudo para avaliar se o polimorfismo -675 4G/5G no gene inibidor 1 do ativador do plasminogênio se associa à obesidade e à resistência insulínica em crianças mexicanas.
MÉTODOS: Foi realizado um estudo transversal em 174 crianças, 89 delas com peso normal e 85 obesas, variando sua idade de 6 a 13 anos. Todas as crianças eram do estado de Guerrero e foram recrutadas de três escolas primárias na cidade de Chilpancingo, México. Os níveis de insulina foram determinados por prova imunoenzimática. Foi usado o modelo de avaliação da homeostase para determinar resistência insulínica. O polimorfismo -675 4G/5G no gene PAI-1 foi analisado pelo método reação de polimerase em cadeia-polimorfismo no comprimento dos fragmentos de restrição.
RESULTADOS: A prevalência de resistência insulínica no grupo obeso foi mais alta (49,41%) do que no grupo com peso normal (16,85%). O polimorfismo 4G/5G do PAI-1 foi encontrado em equilíbrio de Hardy Weinberg. O genótipo 4G/5G contribuiu para um aumento significativo da relação cintura-quadril (
β = 0,02, p = 0,006), da circunferência da cintura (β = 4,42, p = 0,009) e da espessura da prega subescapular (β = 1,79, p = 0,04), mas não se relacionou com a resistência insulínica.
CONCLUSÃO: O genótipo -675 4G/5G do gene PAI-1 se associou a aumento da adiposidade corporal em crianças mexicanas.

Palavras-chave: Gene PAI-1; Polimorfismos; Adiposidade corporal; Resistência insulínica


 

 

Introdução

A obesidade é uma doença crônica multifatorial e complexa frequentemente associada à resistência insulínica, que parece ser a característica central à patogênese do diabetes tipo 2; esses transtornos metabólicos se associam a aumento dos níveis do inibidor 1 do ativador do plasminogênio na circulação.1

O PAI-1 é o principal inibidor do sistema de ativação do plasminogênio (SAP), que compreende uma proenzima inativa, o plasminogênio, que pode ser convertida à sua forma ativa, a plasmina, pela ação dos ativadores fisiológicos do plasminogênio (AP).2 A plasmina é a principal enzima que degrada a fibrina em produtos solúveis. Sob condições fisiológicas, o PAI-1 é liberado na circulação e no espaço extracelular por algumas células, como os hepatócitos, células musculares lisas, células do baço, miócitos, adipócitos, monócitos, macrófagos e plaquetas, sendo essas as principais fontes de PAI-1.3-5 Em condições patológicas, outros tecidos, como tumores e células endoteliais, secretam uma grande quantidade de PAI-1, principalmente em resposta à regulação para cima por citocinas inflamatórias e, assim, o PAI-1 é visto como marcador na evolução de processos inflamatórios.3,6,7 O aumento dos níveis de PAI-1 no plasma se associa a fatores de risco, tais como obesidade, intolerância à glicose, hipertensão, resistência insulínica e síndrome metabólica.4,8-10

Foram descritos mais de 180 polimorfismos de um único nucleotídeo (SNP) no gene PAI-1. O polimorfismo -675 4G/5G se caracteriza por uma inserção/deleção de um único nucleotídeo, a guanina, na posição -675 do promotor do gene PAI-1.11 Esse polimorfismo se associa a altos níveis de PAI-1, obesidade, hipertensão, dislipidemia, intolerância à glicose e resistência insulínica.12 Em uma população caucasiana europeia, relatou-se que indivíduos homozigóticos para o alelo 4G (genótipo 4G/4G) têm concentrações plasmáticas aproximadamente 25% mais altas de PAI-1 do que os indivíduos que são homozigóticos para o alelo 5G (genótipo 5G/5G).11 Em outro estudo, o polimorfismo -675 4G/5G influenciou o desenvolvimento de um estado de resistência insulínica e obesidade, indicando que esse polimorfismo pode ser indicador de suscetibilidade genética para essas doenças.1,12 Portanto, elaboramos este estudo para avaliar se o polimorfismo -675 4G/5G do gene PAI-1 se associa à obesidade e à resistência insulínica em crianças mexicanas.

 

Métodos

Foi realizado um estudo transversal de 174 crianças, 89 das quais com peso normal e 85 obesas, variando a idade entre 6 e 13 anos. Todas as crianças eram do estado de Guerrero, e foram recrutadas de três escolas primárias na cidade de Chilpancingo, México. Foi obtido consentimento livre e esclarecido de todos os pais antes do recrutamento das crianças no estudo. Foi obtida aprovação do Comitê de Ética em Pesquisa da Universidade de Guerrero para o estudo, de acordo com as diretrizes éticas da Declaração de Helsinque de 2008.

O peso corporal foi determinado utilizando-se um monitor de composição corporal Tanita (Tanita BC-553, Arlington, EUA), e a estatura foi medida com um estadiômetro (Seca, Hamburgo, Alemanha), graduado para 0,1 cm. As circunferências corporais foram medidas em duplicata com uma fita diamétrica de precisão aproximada de ± 0,1 cm (Seca 201, Hamburgo, Alemanha). A circunferência da cintura foi medida no nível da cicatriz umbilical e da crista ilíaca superior. A circunferência do quadril foi medida no ponto máximo abaixo da cintura, sem comprimir a pele. Foi medida a espessura de quatro pregas cutâneas com aproximação de 0,1 mm, em duplicata, com a utilização de um adipômetro (Dynatronics Co, Salt Lake City, EUA): tríceps, bíceps, subescapular e suprailíaca. Fez-se a média das medidas em duplicata. Foi feita a classificação da obesidade usando-se os gráficos de crescimento de 2000 dos Centers for Disease Control and Prevention, definindo como peso normal do 5º ao 85º percentil e obesidade > 95º percentil.

As amostras de sangue foram coletadas por punção venosa antecubital depois de jejum de uma noite. Analisou-se a glicemia com equipamento semiautomatizado (COBAS MIRA). Os níveis de insulina foram determinados por ensaio enzimático (kit GenWay INS-EASIA). Foi usado o modelo de avaliação da homeostase (HOMA) para determinar resistência insulínica (IR) em crianças; esse escore foi calculado com a seguinte fórmula: insulina em jejum no soro (µU/mL) x glicemia em jejum (mmol/L)/22,5. Definiu-se como resistência insulínica uma HOMA-IR acima do 75º percentil para todas as crianças (HOMA-IR > 2,4).

A extração do DNA genômico (DNAg) foi realizada a partir de leucócitos obtidos de amostras de sangue total, de acordo com o método de Miller. O polimorfismo -675 4G/5G do gene PAI-1 foi triado pelo método reação de polimerase em cadeia-polimorfismo no comprimento dos fragmentos de restrição (PCR-RFLP) usando-se os seguintes primers: 5'CACAGAGAGAGTCTGGCCACGT3' (forward) e 5'CCAACAGAGGACTCTTGGTCT3' (reverse). A PCR foi realizada em um volume final de 25 µL, contendo 1 µg de DNA, 0,06 µM de cada oligonucleotídeo, 1,25 U/µL de Taq DNA polimerase, enzima tampão fornecida 1X, 1,5 mM MgCl2 e 0,1 mM de cada dNTP (Invitrogen®, tecnologias para a vida). A PCR foi realizada por desnaturação inicial a 94ºC durante três minutos, 30 ciclos de amplificação a 94ºC 30 segundos para desnaturação, 60ºC durante 30 s para anelamento ou hibridização, e 72ºC durante 30 s para extensão. Finalmente, usou-se a temperatura de 72ºC durante um minuto para extensão das extremidades, resultando em um fragmento de 99 pb para o 5G ou de 98 pb para o 4G. Foi analisado em um gel de poliacrilamida a 6% (Invitrogen®, tecnologias para a vida) e corado com nitrato de prata. Os fragmentos amplificados passaram por digestão por duas horas e 30 minutos a 55ºC, com 3 U da enzima de restrição Bsl I (New England Biolabs). Depois disso, os fragmentos de restrição foram analisados por eletroforese em gel de poliacrilamida a 6% (Invitrogen®, tecnologias para a vida) e corados com nitrato de prata. Foi feita genotipagem do PAI-1 em duplicata em todos os casos (fig. 1). Para confirmar os resultados, alguns genótipos foram aleatoriamente selecionados e analisados para sequenciamento.

 

 

Foi realizada análise estatística utilizando-se o software estatístico STATA v. 9.2. Para a análise descritiva, foram expressas variáveis nominais como frequências, variáveis contínuas normalmente distribuídas como média e desvio padrão, e aquelas distribuídas normalmente foram como medianas e percentis 5 e 95. Realizamos o teste do Qui-quadrado para comparar proporções entre grupos (peso normal e crianças obesas) e teste t de Student e/ou teste de Mann Whitney para comparar medidas quantitativas entre grupos. Determinamos o genótipo e as frequências dos alelos para o polimorfismo -675 4G/5G do gene PAI-1 por contagem direta, e a significância das diferenças entre os parâmetros bioquímicos e antropométricos para cada genótipo foi determinada utilizando-se ANOVA, e pelos testes de Kruskal-Wallis e do Qui-quadrado para avaliar o equilíbrio de Hardy-Weinberg. Para avaliar o efeito do polimorfismo, usamos modelos de regressão linear. As diferenças foram consideradas estatisticamente significativas em p < 0,05.

 

Resultados

A comparação das variáveis clínicas e antropométricas entre ambos os grupos revelou aumento significativo dos níveis de glicose e insulina, das medidas da adiposidade central e periférica, bem como da pressão arterial sistólica e diastólica no grupo obeso. A prevalência de resistência insulínica, no grupo obeso, foi de 49,41%, em comparação com o grupo com peso normal (16,85%) (tabela 1).

Foi encontrado polimorfismo 4G/5G do PAI-1 em equilíbrio de Hardy-Weinberg (χ2 = 0,95, p = 0,4). A distribuição das frequências dos genótipos e dos alelos do polimorfismo -675 4G/5G do PAI-1 foi a seguinte: no grupo obeso, 8,24% 4G/4G, 49,41% 4G/5G e 42,35% 5G/5G, 32,94% para o alelo 4G, e 67,06% para o alelo 5G, enquanto que no grupo com peso normal, 8,99% 4G/4G, 34,83% 4G/5G e 56,18% 5G/5G, 26,40% para o alelo 4G, e 73,60% para o alelo 5G. Em ambos os grupos, o genótipo 5G/5G e o alelo 5G foram os mais frequentemente identificados. A comparação entre ambos os grupos não mostrou diferenças significativas das frequências de genótipos (χ2 = 3,91, p = 0,14) e de alelos (χ2 = 1,78, p = 0,18).

Foram comparadas as variáveis clínicas e bioquímicas por genótipos do polimorfismo -675 4G/5G. Os portadores do genótipo 4G/5G mostraram aumento significativo da relação cintura-quadril (p = 0,02) e tendências para aumento da circunferência da cintura (p = 0,08) e da espessura da prega cutânea subescapular (p = 0,09), em comparação com os portadores dos genótipos 4G/4G e 5G/5G (tabela 2).

Usamos modelos de regressão linear múltipla para a estimativa da contribuição do polimorfismo para as variáveis antropométricas e metabólicas. Depois do ajuste para idade e gênero, determinou-se que o genótipo 4G/5G contribuiu para um aumento significativo da relação cintura-quadril (β = 0,02, p = 0,006), circunferência da cintura (β = 4,42, p = 0,009) e espessura da prega cutânea subescapular (β = 1,79, p = 0,04) (tabela 3). No entanto, não encontramos uma relação com os níveis de insulina, HOMA-IR e resistência insulínica (dados não mostrados).

 

Discussão

Atualmente, sabe-se que a resistência insulínica é um preditor importante de diabetes melito tipo 2, sendo um dos principais fatores envolvidos com o desenvolvimento de resistência insulínica relacionado com o aumento de tecido adiposo e a liberação de adipocitocinas por este; uma proteína secretada pelos adipócitos em grandes quantidades é PAI-1.13 Estudos anteriores em outras populações, para investigar a contribuição do polimorfismo PAI-1 para a obesidade e a resistência insulínica, tiveram resultados inconsistentes.14 No presente estudo, verificamos que o polimorfismo -675 4G/5G está relacionado com medidas da adiposidade corporal, mas não com a resistência insulínica em crianças mexicanas.

Nossos resultados indicam que uma amostra de crianças obesas teve aumento dos níveis de glicose e de insulina, das medidas da adiposidade central e periférica e alta prevalência de resistência insulínica (49,41%), mas 16,85% das crianças com peso normal tiveram resistência insulínica.

No que se refere à frequência de genótipos e alelos, observamos que esse polimorfismo está distribuído inversamente ao relatado nas populações caucasianas, nas quais o genótipo 4G/4G (> 25%) foi mais comum do que o genótipo 5G/5G. Em nossa população, o genótipo 5G/5G foi mais frequente (42,35%), e o genótipo 4G/4G foi menos comum (8,24%). Essas diferenças podem ser atribuídas à influência racial, que pode estar relacionada com a formação genética de nossa população. Sabe-se que a população mexicana se originou de uma mistura de populações europeias e africanas com grupos ameríndios, dando origem à população de mestiços mexicanos, que tem uma importante diversidade genética na distribuição desse e de outros polimorfismos.15 Assim sendo, essa é uma razão que pode explicar as diferenças de distribuição das frequências genotípicas e alélicas de nossa população com referência a outras populações no mundo. As ocorrências relatadas em um estudo anterior da população de mestiços do oeste do México apontam que houve uma alta frequência do alelo 5G.16 De modo semelhante, nos grupos étnicos do México, o alelo 5G é predominante (> 50%), em comparação com o alelo 4G,17 o que sugere que a alta frequência do alelo 5G pode ser causada pela contribuição dos genes dos ameríndios à constituição genética de nossa população mexicana.

O presente estudo descreveu, pela primeira vez em crianças mexicanas, que o polimorfismo -675 4G/5G do gene PAI-1 não se associa à resistência insulínica, mas ao aumento da adiposidade corporal, determinada pelo aumento da relação cintura-quadril, da circunferência da cintura e da espessura da prega subescapular em portadores do genótipo 4G/5G. Diferentemente, alguns autores relatam uma relação entre o genótipo 4G/4G e a resistência insulínica e aumento do tecido adiposo em populações caucasianas,14 nas quais o alelo 4G é considerado o alelo de risco, porque se associa a altos níveis plasmáticos de PAI-1 devido à falta de um sítio de ligação para um gene repressor transcricional.11,18

Sabe-se bem que adultos e crianças obesos têm níveis plasmáticos mais altos de PAI-1 do que os controles não obesos. Outros estudos têm mostrado que o IMC alto, a dislipidemia e a resistência insulínica se associam a níveis altos de PAI-1 nos adultos obesos.14,19-22 Isso se deve, possivelmente, à produção de PAI-1 pelo tecido adiposo e ao aumento dos níveis circulantes de PAI-1 em indivíduos obesos e resistentes à insulina. Além disso, estudos de camundongos em que foi inativado o gene PAI-1 mostram um efeito do PAI-1 no ganho de peso e aumento da celularidade adiposa associada às dietas hipergordurosas.23 Além disso, a falta de atividade do gene PAI-1 reduz a adiposidade dos camundongos obesos ob/ob, o que sugere que esse gene controle a massa gordurosa. Embora o mecanismo de ação seja desconhecido, foi proposto que a proliferação de adipócitos possa estar relacionada com a expressão de genes como o fator de necrose tumoral alfa (TNF-α), o fator transformador de crescimento beta (TGF-β), a leptina e a insulina.24

Em nosso estudo, o polimorfismo -675 4G/5G do gene PAI-1 se associou a aumento da adiposidade corporal, e não à resistência insulínica, o que provavelmente se deve ao fato de o polimorfismo -675 4G/5G no gene PAI-1 não contribuir diretamente para o desenvolvimento da resistência insulínica em crianças com peso normal e obesas; como a resistência insulínica pode ter origem multifatorial, em que estão envolvidos fatores ambientais e genéticos, ela poderia ser influenciada por outros polimorfismos relacionados com alterações do metabolismo energético e com o desenvolvimento de obesidade em crianças. Embora os dados sugiram que o polimorfismo -675 4G/5G no gene PAI-1 esteja ligado à adiposidade corporal, são necessários mais estudos para esclarecer esse papel.

Embora, em nosso estudo, tenha sido encontrada uma associação do polimorfismo do genótipo 4G/5G do gene PAI-1 à adiposidade corporal, uma limitação do estudo é que os níveis plasmáticos do PAI-1 não foram medidos; por isso, continua incerta a associação dos genótipos com os níveis do PAI-1 em nossa população. Portanto, são necessários futuros estudos em crianças mexicanas para determinar esse parâmetro.

Em resumo, como o genótipo -675 4G/5G do gene PAI-1 se associa às medidas da adiposidade corporal, mas não à resistência insulínica, esse achado sugere que o genótipo possa conferir suscetibilidade à obesidade nas crianças mexicanas.

 

Financiamento

Esta pesquisa foi apoiada pelos financiamentos de Nº 106734 do Fondo de Investestigación Básica SEP-CONACYT 2008-01 e 147778 do Fondo Misto CONACYT - Gobierno del Estado de Guerrero 2010-01.

 

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.

 

References

1. Ozel Demiralp D, Aktas H, Akar N. The effect of plasminogen activator inhibitor-1 -675 4G/5G polymorphism on PAI-1 gene expression and adipocyte differentiation. Clin Appl Thromb Hemost. 2008;14:438-46.         [ Links ]

2. Aso Y. Plasminogen activator inhibitor (PAI)-1 in vascular inflammation and thrombosis. Front Biosci. 2007;12:2957-66.         [ Links ]

3. Binder BR, Christ G, Gruber F, Grubic N, Hufnagl P, Krebs M, et al. Plasminogen activator inhibitor 1: physiological and pathophysiological roles. News Physiol Sci. 2002;17:56-61.         [ Links ]

4. Ha H, Oh EY, Lee HB. The role of plasminogen activator inhibitor 1 in renal and cardiovascular diseases. Nat Rev Nephrol. 2009;5:203-11.         [ Links ]

5. Ma Z, Paek D, Oh CK. Plasminogen activator inhibitor-1 and asthma: role in the pathogenesis and molecular regulation. Clin Exp Allergy. 2009;39:1136-44.         [ Links ]

6. Lopes C, Dina C, Durand E, Froguel P. PAI-1 polymorphisms modulate phenotypes associated with the metabolic syndrome in obese and diabetic caucasian population. Diabetologia. 2003;46:1284-90.         [ Links ]

7. Kruithof EK. Regulation of plasminogen activator inhibitor type 1 gene expression by inflammatory mediators and statins. Thromb Haemost. 2008;100:969-75.         [ Links ]

8. Morange PE, Saut N, Alessi MC, Yudkin JS, Margaglione M, Di Minno G, et al. Association of plasminogen activator inhibitor (PAI)-1 (SERPINE1) SNPs with myocardial infarction, plasma PAI-1, and metabolic parameters: the HIFMECH study. Arterioscler Thromb Vasc Biol. 2007;27:2250-7.         [ Links ]

9. Naran NH, Chetty N, Crowther NJ. The influence of metabolic syndrome components on plasma PAI-1 concentrations is modified by the PAI-1 4G/5G genotype and ethnicity. Atherosclerosis. 2008;196:155-63.         [ Links ]

10. Bouchard L, Vohl MC, Lebel S, Hould FS, Marceau P, Bergeron J, et al. Contribution of genetic and metabolic syndrome to omental adipose tissue PAI-1 gene mRNA and plasma levels in obesity. Obes Surg. 2010;20:492-9.         [ Links ]

11. Eriksson P, Kallin B, van 't Hooft FM, Båvenholm P, Hamsten A. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci U S A. 1995;92:1851-5.         [ Links ]

12. McCormack LJ, Nagi DK, Stickland MH, Mansfield MW, Mohamed-Ali V, Yudkin JS, et al. Promoter (4G/5G) plasminogen activator inhibitor-1 genotype in Pima Indians: relationship to plasminogen activator inhibitor-1 levels and features of the insulin resistance syndrome. Diabetologia. 1996;39:1512-8.         [ Links ]

13. Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. J Clin Endocrinol Metab. 2004;89:2548-56.         [ Links ]

14. Hoffstedt J, Andersson IL, Persson L, Isaksson B, Arner P. The common -675 4G/5G polymorphism in the plasminogen activator inhibitor -1 gene is strongly associated with obesity. Diabetologia. 2002;45:584-7.         [ Links ]

15. Silva-Zolezzi I, Hidalgo-Miranda A, Estrada-Gil J, Fernandez-Lopez JC, Uribe-Figueroa L, Contreras A, et al. Analysis of genomic diversity in Mexican mestizo populations to develop genomic medicine in Mexico. Proc Natl Acad Sci U S A. 2009;106:8611-6.         [ Links ]

16. Ruiz-Quezada S, Vázquez-Del Mercado M, Parra-Rojas I, Rangel-Villalobos H, Best-Aguilera C, Sánchez-Orozco LV, et al. Genotype and allele frequency of PAI-1 promoter polymorphism in healthy subjects from the west of Mexico. Association with biochemical and hematological parameters. Ann Genet. 2004;47:155-62.         [ Links ]

17. Nuño-Arana I, Páez-Riberos LA, Sando-val-Ramírez L, Muñoz-Valle JM, Pinto-Escalante D, Ceballos-Quintal JM, et al. High prevalence of 5G allele in Amerindian tribes and mestizos from Mexico at 4G/5G PAI-I gene promoter polymorphism. Thromb Haemost. 2005;93:1005-7.         [ Links ]

18. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) 498 de la Cruz-Mosso U et al. gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:10739-45.         [ Links ]

19. Henry M, Chomiki N, Scarabin PY, Alessi MC, Peiretti F, Arveiler D, et al. Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI activity, and triglyceride levels in a healthy population. Arterioscler Thromb Vasc Biol. 1997;17:851-8.         [ Links ]

20. Yamamoto K, Saito H. A pathological role of increased expression of plasminogen activator inhibitor-1 in human or animal disorders. Int J Hematol. 1998;68:371-85.         [ Links ]

21. Juhan-Vague I, Alessi MC, Morange PE. Hypofibrinolysis and increased PAI-1 are linked to atherothrombosis via insulin resistance and obesity. Ann Med. 2000;32:78-84.         [ Links ]

22. Bastard JP, Piéroni L, Hainque B. Relationship between plasma plasminogen activator inhibitor 1 and insulin resistance. Diabetes Metab Res Rev. 2000;16:192-201.         [ Links ]

23. Morange PE, Lijnen HR, Alessi MC, Kopp F, Collen D, Juhan-Vague I. Influence of PAI-1 on adipose tissue growth and metabolic parameters in a murine model of diet-induced obesity. Arterioscler Thromb Vasc Biol. 2000;20:1150-4.         [ Links ]

24. Schäfer K, Fujisawa K, Konstantinides S, Loskutoff DJ. Disruption of the plasminogen activator inhibitor 1 gene reduces the adiposity and improves the metabolic profile of genetically obese and diabetic ob/ob mice. FASEB J. 2001;15:1840-2.         [ Links ]

 

 

Recebido em 1 de outubro de 2012; aceito em 10 de janeiro de 2013

 

 

* Autor para correspondência. E-mail: iprojas@yahoo.com (I. Parra-Rojas).

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License