Abstract
Objective:
To evaluate the Western blotting method for the detection of IgG anti-Toxoplasma gondii (T. gondii) (IgG-WB) in the serum of children with suspected congenital toxoplasmosis.
Methods:
We accompanied 47 mothers with acquired toxoplasmosis in pregnancy and their children, between June of 2011 and June of 2014. The IgG-WB was done in house and the test was considered positive if the child had antibodies that recognized at least one band on IgG blots different from the mother's or with greater intensity than the corresponding maternal band, during the first three months of life.
Results:
15 children (15.1%) met the criteria for congenital toxoplasmosis and 32 (32.3%) had the diagnosis excluded. The symptoms were observed in 12 (80.0%) children and the most frequent were cerebral calcification in 9 (60.0%), chorioretinitis in 8 (53.3%), and hydrocephalus in 4 (26.6%). IgM antibodies anti-T. gondii detected by chemiluminescence (CL) were found in 6 (40.0%) children and the polymerase chain reaction (PCR) for detection of T. gondii DNA was positive in 5 of 7 performed (71.4%). The sensitivity of IgG-WB was of 60.0% [95% confidence interval (CI) 32.3-83.7%] and specificity 43.7% (95% CI 26.7-62.3%). The sensitivity of IgG-WB increased to 76.0 and 89.1% when associated to the research of IgM anti-T. gondii or PCR, respectively.
Conclusions:
The IgG-WB showed greater sensitivity than the detection of IgM anti-T. gondii; therefore, it can be used for the diagnosis of congenital toxoplasmosis in association with other congenital infection markers.
KEYWORDS
Congenital Toxoplasmosis; Western Blotting; Diagnosis; Serology
Resumo
Objetivo:
Avaliar o método Western Blotting para detecção de IgG anti-Toxoplasma gondii (T. gondii) (IgG-WB) no soro de crianças com suspeita de toxoplasmose congênita.
Métodos:
Acompanhamos 47 mães com toxoplasmose adquirida na gravidez e seus filhos, entre junho de 2011 e junho de 2014. O IgG-WB foi feito internamente e o teste foi considerado positivo quando a criança apresentava anticorpos que reconheciam pelo menos uma banda nas manchas de IgG diferente das bandas da mãe ou com maior intensidade do que a banda materna correspondente, durante os primeiros 3 meses de vida.
Resultados:
Atenderam aos critérios para diagnóstico de toxoplasmose congênita 15 crianças (15,1%) e 32 (32,3%) tiveram o diagnóstico excluído. Os sintomas foram observados em 12 crianças (80%) e os mais frequentes foram calcificação cerebral em nove (60%), coriorretinite em oito (53,3%) e hidrocefalia em quatro (26,6%). Os anticorpos IgM anti-T. gondii detectados por quimiluminescência (QL) foram encontrados em seis crianças (40%) e a reação em cadeia da polimerase (RCP) para detecção do DNA de T. gondii foi positiva em cinco de sete reações (71,4%). A sensibilidade do IgG-WB foi de 60% [intervalo de confiança (IC) de 95%, 32,3 a 83,7%] e a especificidade foi de 43,7% (IC de 95%, 26,7 a 62,3%). A sensibilidade do IgG-WB aumentou para 76 e 89,1% quando relacionada à pesquisa de IgM anti-T. gondii ou à RCP, respectivamente.
Conclusões:
O IgG-WB mostrou maior sensibilidade do que a detecção de IgM anti-T. gondii; portanto, pode ser usado para o diagnóstico de toxoplasmose congênita em associação com outros marcadores de infecção congênita.
PALAVRAS-CHAVE
Toxoplasmose Congênita; Western blotting; Diagnóstico; Sorologia
Introduction
Most children with congenital toxoplasmosis (CT) show no signs or symptoms at birth, yet there is a risk of developing late sequelae, particularly ocular and neurological impairment.11 Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.
All children are considered suspect whose mothers had acute toxoplasmosis in the course of pregnancy; therefore, these children must be subjected to serological investigation with antibody detection for anti-Toxoplasma gondii (T. gondii).11 Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.,22 American Academy of Pediatrics. Report of committee on infectious diseases. Toxoplasma gondii infections (Toxoplasmosis). In: American academy of pediatrics. Red book. 28 ed. Illinois: Elk Grove Village; 2009. p. 667-72.
However, a confirmed serological diagnosis of T. gondii infection through the detection of specific IgM and/or IgA antibodies against the parasite does not occur in all newborns.11 Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.,33 Lebech M, Andersen O, Christensen NC, Hertel J, Nielsen HE, Peitersen B, et al. Feasibility of neonatal screening for toxoplasma infection in the absence of prenatal treatment. Danish Congenital Toxoplasmosis Study Group. Lancet. 1999;353:1834-7.
4 Lago EG, Neto EC, Melamed J, Rucks AP, Presotto C, Coelho JC, et al. Congenital toxoplasmosis: late pregnancy infections detected by neonatal screening and maternal serological testing at delivery. Paediatr Perinat Epidemiol. 2007;21:525-31.-55 Capobiango JD, Mitsuka-Breganó R, Navarro IT, Rezende Neto CP, Casella AM, Lopes-Mori FM, et al. Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil. Braz J Infect Dis. 2014;18:364-71. Therefore, IgG antibodies against T. gondii in serial serum samples must be analyzed and the child remains under outpatient follow-up, which can take months until the definitive diagnosis.11 Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.,66 Rodrigues IM, Castro AM, Gomes MB, Amaral WN, Avelino MM. Congenital toxoplasmosis: evaluation of serological methods for detection of anti-Toxoplasma gondii IgM and IgA antibodies. Mem Inst Oswaldo Cruz. 2009;104:434-40.
In an infected fetus, IgG and IgM antibodies produced against the antigenic determinants of T. gondii may differ from those anti-T. gondii IgG and IgM antibodies detected in the maternal serum, suggesting a neosynthesis of specific antibodies. Thus, children with CT with non-reactivity in conventional tests for IgM detection have been diagnosed in the first months of life through the Western blot method (WB).77 Pinon JM, Dumon H, Chemla C, Franck J, Petersen E, Lebech M, et al. Strategy for diagnosis of congenital toxoplasmosis: evaluation of methods comparing mothers and newborns and standard methods for postnatal detection of immunoglobulin G, M and A antibodies. J Clin Microbiol. 2001;39:2267-71.
8 Tissot-Dupont D, Fricker HH, Pinchart MP, Bost-Bru C, Thomas PA, Pelloux H. Usefulness of Western Blot in serological follow-up of newborns suspected of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:122-5.-99 Remington JS, Thulliez P, Montoya JG. Recent developments for diagnosis of toxoplasmosis. J Clin Microbiol. 2004;42:941-5.
There is a need for early and rapid diagnosis using a low complexity method that allows the reference laboratories for toxoplasmosis to differentiate the dubious results obtained using the routine conventional serological methods, such as indirect immunofluorescence (IIF), enzyme-linked immunoassay (ELISA), and immunoassay of microparticles using chemiluminescence (CL). The objective of this study was to evaluate the WB method for the detection of IgG antibodies against T. gondii (IgG-WB) in the serum of the child and his/her mother with acquired toxoplasmosis in pregnancy to assist in the early diagnosis of CT.
Methods
Subjects
The population was comprised of women with suspected acquired toxoplasmosis in pregnancy and their children, assisted at the Pediatric Infectious Disease Outpatient, between June of 2011 and June of 2014. The study included children whose mothers demonstrated reactivity for anti-T. gondii IgM during the pre-natal care. The blood samples of child/mother pairs were collected simultaneously during the first three months of child's life and stored at -20 ºC for WB. The control group consisted of children whose mothers showed suspected acute toxoplasmosis during pregnancy, but did not meet the criteria for CT.22 American Academy of Pediatrics. Report of committee on infectious diseases. Toxoplasma gondii infections (Toxoplasmosis). In: American academy of pediatrics. Red book. 28 ed. Illinois: Elk Grove Village; 2009. p. 667-72.,1010 Brasil. Ministério da Saúde. Secretaria de Atenção à Saúde. Departamento de Ações Programáticas Estratégicas. Atenção à saúde do recém-nascido: guia para os profissionais de saúde: intervenções comuns, icterícia e infecções. 2 ed. Brasília: Ministério da Saúde; 2013. p. 109-22.,1111 Lebech M, Joynson DH, Seitz HM, Thulliez P, Gilbert RE, Dutton GN, et al. Classification system and case definitions of Toxoplasma infection in immunocompetent pregnant women and their congenitally infected offspring. Eur J Clin Microbiol Infect Dis. 1996;15:799-805. In this period, 47 children and their mothers were monitored. Of these, 15 (15.1%) children were diagnosed with CT and in 32 (32.3%), this diagnosis was excluded. Pregnant women received spiramycin or sulfadiazine plus pyrimethamine and folinic acid until childbirth. The suspected infected children received sulfadiazine plus pyrimethamine and folinic acid until the definitive diagnosis.
Diagnostic criteria in children
CT was considered when the child presented elevation of specific anti-T. gondii IgG titers in sequential samples in the first months of his life and/or the persistence of T. gondii IgG titers after 12 months of life and/or reactivity for anti-T. gondii IgM and/or chorioretinitis and/or lesion of central nervous system (CNS) with reactivity for IgG and/or positivity for the T. gondii DNA using polymerase chain reaction (PCR).22 American Academy of Pediatrics. Report of committee on infectious diseases. Toxoplasma gondii infections (Toxoplasmosis). In: American academy of pediatrics. Red book. 28 ed. Illinois: Elk Grove Village; 2009. p. 667-72.,1010 Brasil. Ministério da Saúde. Secretaria de Atenção à Saúde. Departamento de Ações Programáticas Estratégicas. Atenção à saúde do recém-nascido: guia para os profissionais de saúde: intervenções comuns, icterícia e infecções. 2 ed. Brasília: Ministério da Saúde; 2013. p. 109-22.,1111 Lebech M, Joynson DH, Seitz HM, Thulliez P, Gilbert RE, Dutton GN, et al. Classification system and case definitions of Toxoplasma infection in immunocompetent pregnant women and their congenitally infected offspring. Eur J Clin Microbiol Infect Dis. 1996;15:799-805.
Serological test for the detection of anti-T. gondii IgM and IgG
The serological tests performed during pre-natal care and on samples from children were performed by conventional routine laboratory methods. Anti-T. gondii IgG antibodies were determined by Indirect immunofluorescence (IIF)1212 Camargo ME. Improved technique of indirect immunofluorescence for serological diagnosis of toxoplasmosis. Rev Inst Med Trop Sao Paulo. 1964;6:117-8. (Immunoblot, Biolab-Mérieux, Rio de Janeiro, RJ, Brazil), with T. gondii obtained from ascitic fluid of infected mice, and chemiluminescence (CL) (Architect, System Abbott-Wiesbaden, Germany) with p30 (SAG1) and p35 (GRA8) recombinant antigens of T. gondii. Anti-T. gondii IgM antibodies were also detected using CL (Architect, System Abbott-Wiesbaden, Germany) with p30 antigen and total lysate of T. gondii.
T. gondii antigens
Five albino female mice, aged from 45 to 60 days and weighing between 25 and 40 g were used for obtaining RH strain tachyzoites of T. gondii. The animals were inoculated by intraperitoneal route with a suspension of live tachyzoites (105/mL) in sterile saline solution. Forty-eight hours after the inoculation, the exudate was obtained by washing the peritoneal cavity with 3.0 mL of sterile saline solution. The samples were passed through a 27G needle for rupture of the host cells. Later, they were centrifuged and the sediment was standardized at 109 tachyzoites/mL by counting in a Neubauer chamber.1313 Lundén A. Immune responses in sheep after immunization with Toxoplasma gondii antigens incorporated into iscoms. Vet Parasitol. 1995;56:23-5.
The IgG-WB Method
The proteins of T. gondii to be used in IgG-WB were quantified using the Lowry et al. method,1414 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-75. and polyacrylamide gel 12% was used for electrophoretic separation of proteins with subsequent transfer of the proteins to a nitrocellulose membrane (iBlot® Gel Transfer System, California, USA). The nitrocellulose paper was stained with Ponceau and, after washing with distilled water, the nitrocellulose strips were cut and blocked with skim milk 5% plus tris buffered saline (TBS) with Tween® . Washes were subsequently performed with TBS and skim milk 5% and then, the patient's serum was added diluted in TBS with Tween (Sigma-Aldrich, MO, USA) and skim milk 5%, carried out washes, and added conjugated anti-human IgG (Invitrogen, Life Technologies - CA, USA) diluted in TBS with Tween (Sigma-Aldrich, MO, USA) and skim milk 5%. After further washes the authors added the chromogen substrate diaminobenzidine (DAB) 0.2% (Acrös Organics, Thermo Fisher Scientific - Geel, Belgium) and hydrogen peroxide (100 µL). When the bands were visualized, the reaction was stopped with distilled water. Positive and negative control samples for anti-T. gondii were included in each test.
The test was considered positive if the child produced antibodies that recognized at least one band of protein different from the mother or with higher intensity than the corresponding maternal band (Fig. 1), characterizing the neosynthesis of anti-T. gondii IgG antibodies.1515 Chumpitazi BF, Boussaid A, Pelloux H, Racinet C, Bost M, Fleuret AG. Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods. J Clin Microbiol. 1995;33:1479-85.
16 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22.
17 Rilling V, Dietz K, Krczal D, Knotek F, Enders G. Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:174-80.-1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61. To control the subjectivity of reading, two independent observers read the IgG-WB patterns blindly and without knowledge of the previous serological results of the conventional tests; there was concordance in 100.0% of the results.
Pattern recognition of RH strain proteins of Toxoplasma gondii by IgG antibodies using the Western blotting (IgG-WB) method performed with serum samples from mothers with acquired toxoplasmosis during pregnancy and their children with suspected congenital toxoplasmosis. (A) Positive IgG-Western blotting for congenital toxoplasmosis. Equal bands recognized by IgG antibodies, with stronger intensity in the child sample compared to maternal sample. (B) Positive IgG-Western blotting for congenital toxoplasmosis. Different bands recognized by IgG from the child sample as compared to the maternal sample. (C) Negative IgG-Western blotting for congenital toxoplasmosis. Equal bands recognized by IgG antibodies from child and mother samples. M, mother; C, child; PC, positive control; NC, negative control.
The specificity of the IgG-WB method was determined with 26 serum samples obtained from individuals seronegative for toxoplasmosis (anti-T. gondii IgG and IgM non-reactive by CL) and with seroreactivity to antibodies against other pathogens, such as Treponema pallidum (n = 5), Trypanosoma cruzi (n = 5), Leishmania spp. (n = 2), Paracoccidioides brasilienses (n = 5), or seroreactivity to serological markers of autoimmunity disorders, such as antinuclear antibodies (n = 5) and anti-DNA double strand antibodies (n = 4).
PCR for detection of T. gondii DNA
The DNA was extracted from peripheral blood cells of children, collected with EDTA as the anticoagulant up to three months after birth, using the kit EasyPrep DNA Mini I (EasyGen, Favorgen Biotech - Austria). The DNA amplification of T. gondii was performed using the method described by Homan et al.1919 Homan WL, Vercammen M, De Braekeleer J, Verschueren H. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int J Parasitol. 2000;30:69-75. Primers Tox4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and Tox5 (CGCTGCAGACACAGTGCATCTGGATT) were used for the amplification of a fragment of 529 base pairs (bp; GenBank No. AFI46527) of T. gondii DNA. PCR was performed in a final volume of 22.5 µL, containing 2.5 µL of DNA extracted from the sample; 1.0 µL of 1.0 mM for each primer, 100 mM of dNTP (Invitrogen, Life Technologies - CA, United States), 60 mM Tris-HCl (pH 9.0), 15 mM (NH4)2SO4, 2 mM MgCl2, and 0.25 µL Taq DNA polymerase (Invitrogen, Life Technologies - CA, United States), also completed with 7.75 µL of Milli Q water. The amplification was performed with 35 cycles in a thermal cycler (PTC-100, MJ Research - CA, United States), using the following cycling condition: 7 min at 94 ºC for denaturation in the 1st cycle, followed by 33 cycles of 1 min at 94 C for denaturation, 1 min at 55 ºC for annealing, and 1 min at 72 ºC for extension; cycle 35 was followed by a final extension of 10 min at 72 ºC. Aliquots of each PCR product were subjected to electrophoresis in 2% agarose gel. RH strain Tachyzoites (107/mL) had their DNA extracted to be used as positive control. The water was regarded as the negative control. Positive and negative control samples for T. gondii were included in each test.
Statistical analysis
The statistical analysis was done on GraphPad Prism 5 (GraphPad Software, Inc. - San Diego, United States). Categorical variables were expressed as absolute number (n) and percentage (%) and analyzed by the chi-squared test or Fisher's exact test. Parameters of sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated, with a confidence interval (CI) of 95.0%. Values of p < 0.05 were considered statistically significant.
The study was approved by the Ethics Committee for Research Involving Human Beings. All mothers participated voluntarily and signed the informed consent.
Results
Of the 15 children with CT, 12 (80.0%) were symptomatic and met the clinical criteria for the definition of the disease (nine with cerebral calcification, eight with chorioretinitis, and four with hydrocephalus), six (40.0%) presented reactivity for anti-T. gondii IgM, five (33.3%) showed elevation of anti-T. gondii IgG in the first months of life, and one (6.7%) showed persistence of anti-T. gondii IgG titers in sequential samples. Five of the seven children (71.4%) who underwent PCR to detect T. gondii DNA showed positive results (Table 1).
Clinical and laboratory characteristics of 15 children with congenital toxoplasmosis, from June 2011 to June 2014.
Among the 15 children with CT, the IgG-WB test was positive in nine (60.0%), and among the 32 children without CT, the test was positive in 18 (56.3%), which resulted in a sensitivity of 60.0% (95% CI: 32.3-83.7%), specificity of 43.7% (95% CI: 26.4-62.3%), PPV of 33.3% (95% CI: 16.5-54.0%), and NPV of 70.0% (95% CI: 45.7-88.1%) (p = 0.05875). Among the children with CT, two presented negative IgG-WB and were positive for anti-T. gondii IgM; five children presented positive IgG-WB and were negative for anti-T. gondii IgM, four presented both tests as positive, and four presented both tests as negative.
The molecular weight (MW) of the protein recognized by anti-T. gondii IgG in the serum of children with CT ranged from 2 to 94 kDa, and regarding the proteins recognized by IgG antibodies in the serum of the non-infected, the MW ranged from 1 to 160 kDa. Among the nine children diagnosed through IgG-WB, seven presented different bands from those observed in the maternal serum and two presented bands of greater intensity than those presented by their mother's sample. The dominant bands that were recognized by IgG antibodies from samples of children with CT and the non-infected are demonstrated in Fig. 2.
Distribution of the most frequent Toxoplasma gondii proteins recognized by IgG antibodies in the serum of children with congenital toxoplasmosis and children without the disease, according to their molecular weight (kDa) (p > 0.05 for all the recognized proteins).
As for the 26 samples from patients with other diseases, two showed no reactivity and 24 showed reactivity for IgG antibodies that recognized proteins with MW ranging from 17 to 118 kDa. Those most frequently recognized were p22 (11/40.7%), p34 (9/33.3%), p38 (8/29.6%), p94 (6/22.2%), p56 (5/18.5%), and p30 (5/18.5%).
The analysis of the results of anti-T. gondii IgM using CL showed sensitivity of 40.0% (95% CI: 16.3-67.6%), specificity of 100.0% (95% CI: 89.1-100.0%), PPV of 100.0% (95% CI: 54.1-100.0%), and NPV of 78.1% (95% CI: 62.4-89.4%; p = 0.0005). For the detection of the parasite's DNA using PCR, the sensitivity was 71.4% (95% CI: 29.0-96.3%), specificity of 100.0% (95% CI: 69.2-100.0%), PPV of 100.0% (95% CI: 47.8-100.0%), and NPV of 83.3% (95% CI: 51.6-98.0%; p = 0.0034).
The sensitivity and specificity of IgG-WB when associated with other markers of CT - such as the presence of anti-T. gondii IgM, positive PCR, and the clinical symptoms - are shown in Table 2.
Sensitivity and specificity of the Western blotting method for the detection of anti-Toxoplasma gondii IgG (IgG-WB), anti-Toxoplasma gondii IgM test, the polymerase chain reaction (PCR) to Toxoplasma gondii, and the presence of clinical symptoms compatible with congenital toxoplasmosis, assessed in series and in parallel, according to the presence or absence of congenital toxoplasmosis.
IgG-WB was positive in six of nine patients (66.7%) with eye injuries and in three of six patients (50.0%) with CT without eye injuries (p = 0.6224), with sensitivity of 66.7% (95% CI: 29.9-92.5%), specificity of 50.0% (95% CI: 11.8-88.2%), PPV of 66.7% (95% CI: 29.9-92.5%), and NPV of 50% (95% CI: 11.8-88.2%).
Discussion
The diagnosis of CT is a challenge in clinical practice, because the sensitivity of anti-T. gondii IgM using conventional serological methods varies widely, from 48.3% to 75.0%.33 Lebech M, Andersen O, Christensen NC, Hertel J, Nielsen HE, Peitersen B, et al. Feasibility of neonatal screening for toxoplasma infection in the absence of prenatal treatment. Danish Congenital Toxoplasmosis Study Group. Lancet. 1999;353:1834-7.
4 Lago EG, Neto EC, Melamed J, Rucks AP, Presotto C, Coelho JC, et al. Congenital toxoplasmosis: late pregnancy infections detected by neonatal screening and maternal serological testing at delivery. Paediatr Perinat Epidemiol. 2007;21:525-31.-55 Capobiango JD, Mitsuka-Breganó R, Navarro IT, Rezende Neto CP, Casella AM, Lopes-Mori FM, et al. Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil. Braz J Infect Dis. 2014;18:364-71. The absence of anti-T. gondii IgM can be justified by the fact that fetal infection occurred at the beginning of pregnancy or as a result of maternal treatment for toxoplasmosis carried out during the first two trimesters of pregnancy, which would cause blockage or delay of the immune response.2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12. Moreover, the delay or the absence of detectable immune response by standard methods (IgG and IgM dosage or WB) could be related to differences in the individual immune response. Another disadvantage of this marker is the delay in the sample collection, with decreased positivity of IgM after the first 30 days of life.2121 Lago EG, Oliveira AP, Bender AL. Presence and duration of anti-Toxoplasma gondii immunoglobulin M in infants with congenital toxoplasmosis. J Pediatr (Rio J). 2014;90:363-9. Therefore, it is often necessary to monitor the serological results with the identification of stable or increasing titers of anti-T. gondii IgG, which delays the diagnosis and causes uncertainty to the family.1616 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22. In this context, the IgG-WB can be used to compare the patterns of antibodies against T. gondii in serum samples from the mothers and their children, and determine if the antibodies are transmitted passively or synthesized by the fetus or infant in cases of CT.1515 Chumpitazi BF, Boussaid A, Pelloux H, Racinet C, Bost M, Fleuret AG. Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods. J Clin Microbiol. 1995;33:1479-85.
Other authors have observed a higher contribution of IgG-WB to the diagnosis of CT in the first months of life.2222 Magi B, Migliorini L. Western blotting for the diagnosis of congenital toxoplasmosis. New Microbiol. 2011;34:93-5.,2323 L'Ollivier C, Wallon M, Faucher B, Piarroux R, Peyron F, Franck J. Comparison of mother and child antibodies that target high-molecular-mass Toxoplasma gondii antigens by immunoblotting improves neonatal diagnosis of congenital toxoplasmosis. Clin Vaccine Immunol. 2012;19:1326-8. In addition, the association of IgG-WB with other serological methods can increase the probability of diagnosis. In a cohort of children, the sensitivity of IgG-WB was 82.4% and increased to 85.7% when IgG-WB was associated with the presence of IgM and/or IgA anti-T. gondii using ELISA.1616 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22. Another study showed that the combination of IgA and IgM immunocapture tests, the analysis of IgG an IgM WB patterns, and the combination of both techniques allowed the detection of 94.0%, 94.0%, and 100.0% of cases, respectively.2424 Gamgneux FR, Commere V, Schaefer CT, Camet JD. Performance of a Western Blot assay to compare mother and newborn anti-Toxoplasma gondii antibodies for the early neonatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 1999;18:648-54.
The IgG-WB results obtained in the present study are close to those found by other authors, who reported sensitivity of 73.5%.1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61. These same authors reported that the combination of IgG-WB and IgM-WB increased the sensitivity to 86.5%.1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61.
The lower sensitivity obtained in this study can be explained, in part, because all the patients with suspected CT were treated with sulfadiazine, pyrimethamine, and folinic acid during the investigation, which could inhibit the neosynthesis of antibodies.2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12.
Another strategy to improve the sensitivity of this proposed method is the repetition of IgG-WB throughout the first three months of life.88 Tissot-Dupont D, Fricker HH, Pinchart MP, Bost-Bru C, Thomas PA, Pelloux H. Usefulness of Western Blot in serological follow-up of newborns suspected of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:122-5. In a study with samples collected at birth, the sensitivity of anti-T. gondii IgM by conventional methods (ISAGA and ELISA) was 52.0% and for WB (with IgG and IgM) was 67.0%. By combining the two methods, the sensitivity increased to 78.0% at birth and to 85.0% at three months of life, with the detection of 94.0% of the cases of CT.1717 Rilling V, Dietz K, Krczal D, Knotek F, Enders G. Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:174-80.
The present study analyzed some sequential samples of IgG-WB. Among infected children, with false-negative result in the first sample by IgG-WB, two of six (33.3%) children have different recognized proteins in relation to the maternal sample in the second collection, characterizing neosynthesis of anti-T. gondii IgG, which justifies the need for repetition of IgG-WB in serial samples.
In a previous analysis, the time of maternal sample collection influenced the outcome of the IgG-WB test, because mothers who received treatment for toxoplasmosis during pregnancy may no longer react to the antigens of T. gondii in the late after birth period, with false-negative result.1616 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22. In the present study, this phenomenon was observed in one mother of an infected child. However, the majority of mothers showed an increase in the number of bands recognized in the samples collected immediately after the interruption of treatment at delivery.
In a previous study, the MW of antigenic bands that were recognized by IgG of neonates with CT varied from 21 to 116 kDa.1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61. In the present study, similar to that found by other authors,1515 Chumpitazi BF, Boussaid A, Pelloux H, Racinet C, Bost M, Fleuret AG. Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods. J Clin Microbiol. 1995;33:1479-85.,1616 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22. the antibodies found with high frequency in infected children were those against the proteins with MW higher than 30 kDa. The differences in the MW of recognized proteins reported by previous studies can be explained by different methodological requirements, such as the preparation of the T. gondii antigen, conditions of electrophoresis on acrylamide gel, and the serum dilutions.2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12. Another explanation is the genetic diversity among strains of T. gondii, which can lead to the recognition of different proteins, besides the fact that some individuals present IgG that recognizes multiple proteins, while others, a single protein.2525 Sun X, Lu H, Jia B, Chang Z, Peng S, Yin J, et al. A comparative study of Toxoplasma gondii seroprevalence in three healthy Chinese populations detected using native and recombinant antigens. Parasit Vectors. 2013;6:241-7.
In the present study, IgG-WB was also useful in demonstrating the active synthesis of anti-T. gondii IgG in patients with IgG non-reactive by conventional methods. In Patient 4, with anti-T. gondii IgG titer < 1:16 by IIF in the first sample and a slight increase in sequential samples (maximum of 1:64), disappearance of IgG antibodies was observed when assayed by CL and IIF methods after treatment. However, by the IgG-WB method, it was possible to demonstrate anti-T. gondii IgG, which recognized the proteins p22 and p46, which were absent in the maternal serum. After 12 months of life, this child, who showed chorioretinitis scarring, remained non-reactive to anti-T. gondii IgG antibodies evaluated by CL and IIF; however, positivity was shown for IgG-WB.
CT with non-reactivity for anti-T. gondii IgG and IgM may result from toxoplasmosis treatment on the mother and neonate.2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12. The treatment of the child for a year after birth may also cause antibody non-reactivity. However, in most of these cases there is detection of anti-T. gondii IgG soon after treatment interruption, called the rebound effect.11 Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.,77 Pinon JM, Dumon H, Chemla C, Franck J, Petersen E, Lebech M, et al. Strategy for diagnosis of congenital toxoplasmosis: evaluation of methods comparing mothers and newborns and standard methods for postnatal detection of immunoglobulin G, M and A antibodies. J Clin Microbiol. 2001;39:2267-71.,2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12.
In this present study, Patient 1 showed non-reactivity, but presented detectable anti-T. gondii antibodies after interruption of the treatment. Similarly to Patient 4, Patients 6, 8, and 9 also showed a drop in antibodies up to the point of non-reactivity and remained thus after interruption of treatment. It is possible that these patients no longer recognize the proteins p30 and p35 present in the CL test, which justifies the non-reactivity in this test with the evolution of the infection.
Therefore, instead of evaluating only the persistence of anti-T. gondii IgG by CL, the authors suggest the use of IgG-WB in serological monitoring, since the infected child can produce antibodies against other proteins of the parasite and thus remains positive after 12 months age. In this case, the absence of anti-T. gondii IgG in the CL may not exclude CT, which would also justify the lower specificity of IgG-WB found during the present study compared to previous studies.1616 Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22.
17 Rilling V, Dietz K, Krczal D, Knotek F, Enders G. Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:174-80.-1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61.,2222 Magi B, Migliorini L. Western blotting for the diagnosis of congenital toxoplasmosis. New Microbiol. 2011;34:93-5.,2323 L'Ollivier C, Wallon M, Faucher B, Piarroux R, Peyron F, Franck J. Comparison of mother and child antibodies that target high-molecular-mass Toxoplasma gondii antigens by immunoblotting improves neonatal diagnosis of congenital toxoplasmosis. Clin Vaccine Immunol. 2012;19:1326-8. However, more studies should be done before using IgG-WB in serological monitoring.
According to a study carried out in a Brazilian population, patients with IgM reactive by WB method (IgM-WB) showed greater risk for active macular injury than patients with negative IgM-WB.1818 Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61. However, no significant difference was found between positivity of IgG-WB and the presence of macular injury, as in the present study. It is not clear whether there are specific proteins of T. gondii strains associated with eye injuries and if they could explain the greater frequency of eye injury on Brazilian children with CT than in other countries.2626 Gilbert RE, Freeman K, Lago EG, Bahia-Oliveira LM, Tan HK, Wallon M, et al. European Multicentre Study on Congenital Toxoplasmosis (EMSCOT). Ocular sequelae of congenital toxoplasmosis in Brazil compared with Europe. PLoS Negl Trop Dis. 2008;2(e277):1-7. The main limitation to this present study was the absence of evaluation of the samples with IgM-WB, which could improve the diagnostic sensitivity of the test.
The technical procedure for IgG-WB is of low complexity and with available cost, which makes it viable in the laboratory routine. The drawback of the in-house method is its slowness, which could be reduced with standardization of a set of reagents to be produced in Brazil. The semi-automation of the method with the use of a program for the reading of band intensity viewed though WB would facilitate the reading and the reproducibility of results.2020 Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12.
The results reinforce the usefulness of the IgG-WB method for serological evaluation of patients with CT, with greater sensitivity than the detection of anti-T. gondii IgM by conventional methods. Therefore, IgG-WB can be used for the early diagnosis of CT in combination with other markers of the congenital T. gondii infection.
-
FundingProgram of Support to the University Extension of the Ministry of Education of Brazil (PROEXT - MEC/SESu) and the National Council of Scientific and Technological Development (CNPq).
-
☆
Please cite this article as: Capobiango JD, Monica TC, Ferreira FP, Mitsuka-Breganó R, Navarro IT, Garcia JL, et al. Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis. J Pediatr (Rio J). 2016;92:616-23.
-
☆☆
Study conducted at Universidade Estadual de Londrina, Londrina, PR, Brazil.
Acknowledgments
To all the patients and family members who contributed to the fulfillment of this work, to the Postgraduate Program in Health Sciences of the Universidade Estadual de Londrina (UEL), and to the Postgraduate Program in Animal Sciences of the UEL.
References
-
1Remington JS, McLeod R, Wilson CB, Desmonts G. Toxoplasmosis. In: Remington JS, Klein JO, Wilson CB, Nizet V, Maldonado YA, editors. Infectious disease of the fetus and newborn infant. 7 ed. Philadelphia: Elsevier Saunders; 2011. p. 918-1041.
-
2American Academy of Pediatrics. Report of committee on infectious diseases. Toxoplasma gondii infections (Toxoplasmosis). In: American academy of pediatrics. Red book. 28 ed. Illinois: Elk Grove Village; 2009. p. 667-72.
-
3Lebech M, Andersen O, Christensen NC, Hertel J, Nielsen HE, Peitersen B, et al. Feasibility of neonatal screening for toxoplasma infection in the absence of prenatal treatment. Danish Congenital Toxoplasmosis Study Group. Lancet. 1999;353:1834-7.
-
4Lago EG, Neto EC, Melamed J, Rucks AP, Presotto C, Coelho JC, et al. Congenital toxoplasmosis: late pregnancy infections detected by neonatal screening and maternal serological testing at delivery. Paediatr Perinat Epidemiol. 2007;21:525-31.
-
5Capobiango JD, Mitsuka-Breganó R, Navarro IT, Rezende Neto CP, Casella AM, Lopes-Mori FM, et al. Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil. Braz J Infect Dis. 2014;18:364-71.
-
6Rodrigues IM, Castro AM, Gomes MB, Amaral WN, Avelino MM. Congenital toxoplasmosis: evaluation of serological methods for detection of anti-Toxoplasma gondii IgM and IgA antibodies. Mem Inst Oswaldo Cruz. 2009;104:434-40.
-
7Pinon JM, Dumon H, Chemla C, Franck J, Petersen E, Lebech M, et al. Strategy for diagnosis of congenital toxoplasmosis: evaluation of methods comparing mothers and newborns and standard methods for postnatal detection of immunoglobulin G, M and A antibodies. J Clin Microbiol. 2001;39:2267-71.
-
8Tissot-Dupont D, Fricker HH, Pinchart MP, Bost-Bru C, Thomas PA, Pelloux H. Usefulness of Western Blot in serological follow-up of newborns suspected of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:122-5.
-
9Remington JS, Thulliez P, Montoya JG. Recent developments for diagnosis of toxoplasmosis. J Clin Microbiol. 2004;42:941-5.
-
10Brasil. Ministério da Saúde. Secretaria de Atenção à Saúde. Departamento de Ações Programáticas Estratégicas. Atenção à saúde do recém-nascido: guia para os profissionais de saúde: intervenções comuns, icterícia e infecções. 2 ed. Brasília: Ministério da Saúde; 2013. p. 109-22.
-
11Lebech M, Joynson DH, Seitz HM, Thulliez P, Gilbert RE, Dutton GN, et al. Classification system and case definitions of Toxoplasma infection in immunocompetent pregnant women and their congenitally infected offspring. Eur J Clin Microbiol Infect Dis. 1996;15:799-805.
-
12Camargo ME. Improved technique of indirect immunofluorescence for serological diagnosis of toxoplasmosis. Rev Inst Med Trop Sao Paulo. 1964;6:117-8.
-
13Lundén A. Immune responses in sheep after immunization with Toxoplasma gondii antigens incorporated into iscoms. Vet Parasitol. 1995;56:23-5.
-
14Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-75.
-
15Chumpitazi BF, Boussaid A, Pelloux H, Racinet C, Bost M, Fleuret AG. Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods. J Clin Microbiol. 1995;33:1479-85.
-
16Gross U, Lüder CG, Hendgen V, Heeg C, Sauer I, Weidner A, et al. Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis. J Clin Microbiol. 2000;38:3619-22.
-
17Rilling V, Dietz K, Krczal D, Knotek F, Enders G. Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 2003;22:174-80.
-
18Machado AS, Andrade GM, Januário JN, Fernandes MD, Carneiro AC, Carneiro M, et al. IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis. Mem Inst Oswaldo Cruz. 2010;105:757-61.
-
19Homan WL, Vercammen M, De Braekeleer J, Verschueren H. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int J Parasitol. 2000;30:69-75.
-
20Sensini A. Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis. Clin Microbiol Infect. 2006;12:504-12.
-
21Lago EG, Oliveira AP, Bender AL. Presence and duration of anti-Toxoplasma gondii immunoglobulin M in infants with congenital toxoplasmosis. J Pediatr (Rio J). 2014;90:363-9.
-
22Magi B, Migliorini L. Western blotting for the diagnosis of congenital toxoplasmosis. New Microbiol. 2011;34:93-5.
-
23L'Ollivier C, Wallon M, Faucher B, Piarroux R, Peyron F, Franck J. Comparison of mother and child antibodies that target high-molecular-mass Toxoplasma gondii antigens by immunoblotting improves neonatal diagnosis of congenital toxoplasmosis. Clin Vaccine Immunol. 2012;19:1326-8.
-
24Gamgneux FR, Commere V, Schaefer CT, Camet JD. Performance of a Western Blot assay to compare mother and newborn anti-Toxoplasma gondii antibodies for the early neonatal diagnosis of congenital toxoplasmosis. Eur J Clin Microbiol Infect Dis. 1999;18:648-54.
-
25Sun X, Lu H, Jia B, Chang Z, Peng S, Yin J, et al. A comparative study of Toxoplasma gondii seroprevalence in three healthy Chinese populations detected using native and recombinant antigens. Parasit Vectors. 2013;6:241-7.
-
26Gilbert RE, Freeman K, Lago EG, Bahia-Oliveira LM, Tan HK, Wallon M, et al. European Multicentre Study on Congenital Toxoplasmosis (EMSCOT). Ocular sequelae of congenital toxoplasmosis in Brazil compared with Europe. PLoS Negl Trop Dis. 2008;2(e277):1-7.
Publication Dates
-
Publication in this collection
Nov-Dec 2016
History
-
Received
13 Oct 2015 -
Accepted
16 Feb 2016