Abstract
Objective:
The prevalence of non-alcoholic fatty liver disease in children has risen significantly, owing to the worldwide childhood obesity epidemic in the last two decades. Non-alcoholic fatty liver disease is closely linked to sedentary lifestyle, increased body mass index, and visceral adiposity. In addition, individual genetic variations also have a role in the development and progression of non-alcoholic fatty liver disease. The aim of this study was to investigate the gene polymorphisms of MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), ABCA1 (883 G/A) (rs4149313), and IL-17A (-197 G/A) (rs2275913) in obese Turkish children with non-alcoholic fatty liver disease.
Methods:
The study recruited 186 obese children aged 10 -17 years, including 101 children with non-alcoholic fatty liver disease and 85 children without non-alcoholic fatty liver disease. Anthropometric measurements, insulin resistance, a liver panel, a lipid profile, liver ultrasound examination, and genotyping of the four variants were performed.
Results:
No difference was found between the groups in respect to age and gender, body mass index, waist/hip ratio, or body fat ratio. In addition to the elevated ALT levels, AST and GGT levels were found significantly higher in the non-alcoholic fatty liver disease group compared to the non non-alcoholic fatty liver disease group (p < 0.05). The A-allele of IL-17A (-197 G/A) (rs2275913) was associated with non-alcoholic fatty liver disease (odds ratio [OR] 2.05, 95% confidence interval: 1.12 -3.77, p = 0.02).
Conclusions:
The findings of this study suggest that there may be an association between IL-17A (-197 G/A) (rs2275913) polymorphism and non-alcoholic fatty liver disease development in obese Turkish children.
KEYWORDS
Liver disease; Single-nucleotide polymorphisms; Obesity; Children; Interleukin-17
Resumo
Objetivo:
A prevalência de doença hepática gordurosa não alcoólica em crianças aumentou significativamente devido à epidemia de obesidade infantil em todo o mundo nas últimas duas décadas. A doença hepática gordurosa não alcoólica está intimamente ligada ao estilo de vida sedentário, ao aumento do índice de massa corporal e à adiposidade visceral. Além disso, variações genéticas individuais também têm um papel no desenvolvimento e na progressão da doença hepática gordurosa não alcoólica. O objetivo deste estudo foi investigar os polimorfismos genéticos MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), ABCA1 (883 G/A) (rs4149313) e IL-17A (-197 G/A) (rs2275913) em crianças turcas obesas com doença hepática gordurosa não alcoólica.
Métodos:
O estudo recrutou 186 crianças obesas entre 10 e 17 anos, inclusive 101 crianças com doença hepática gordurosa não alcoólica e 85 crianças sem doença hepática gordurosa não alcoólica. Medidas antropométricas, resistência à insulina, painel hepático, perfil lipídico, exame ultrassonográfico do fígado e genotipagem de quatro variantes foram feitos.
Resultados:
Nenhuma diferença foi encontrada entre os grupos em relação à idade e sexo, índice de massa corporal, relação cintura/quadril ou proporção de gordura corporal. Além dos níveis elevados de ALT, os níveis de AST e GGT foram significativamente maiores no grupo doença hepática gordurosa não alcoólica em comparação com o grupo não doença hepática gordurosa não alcoólica (p < 0,05). O alelo A de IL-17A (-197 G/A) (rs2275913) foi associado à doença hepática gordurosa não alcoólica (odds ratio [OR] 2,05, intervalo de confiança de 95%: 1,12-3,77, p = 0,02).
Conclusões:
Os achados deste estudo sugerem que pode haver uma associação entre o polimorfismo IL-17A (-197 G/A) (rs2275913) e o desenvolvimento da doença hepática gordurosa não alcoólica em crianças turcas obesas.
PALAVRAS-CHAVE
Doença hepática; Polimorfismos de nucleotídeo único; Obesidade; Crianças; Interleucina 17
Introduction
Non-alcoholic fatty liver disease (NAFLD) is a chronic liver disease caused by excessive fat accumulation in the liver, without a history of chronic alcohol consumption, metabolic liver diseases (Wilson disease), or congenital, viral, or autoimmune liver diseases.11 Vos MB, Abrams SH, Barlow SE, Caprio S, Daniels SR, Kohli R, et al. NASPGHAN clinical practice guideline for the diagnosis and treatment of nonalcoholic fatty liver disease in children: recommendations from the Expert Committee on NAFLD (ECON) and the North American Society of Pediatric Gastroenterology, Hepatology and Nutrition (NASPGHAN). J Pediatr Gastroenterol Nutr. 2017;64:319-34. NAFLD is included in a broad spectrum of liver damage, ranging from simple steatosis to steatohepatitis, fibrosis, and even cirrhosis.11 Vos MB, Abrams SH, Barlow SE, Caprio S, Daniels SR, Kohli R, et al. NASPGHAN clinical practice guideline for the diagnosis and treatment of nonalcoholic fatty liver disease in children: recommendations from the Expert Committee on NAFLD (ECON) and the North American Society of Pediatric Gastroenterology, Hepatology and Nutrition (NASPGHAN). J Pediatr Gastroenterol Nutr. 2017;64:319-34. The prevalence of NAFLD has increased significantly due to the worldwide childhood obesity epidemic in the last two decades.22 Nobili V, Donati B, Panera N, Vongsakulyanon A, Alisi A, Dallapiccola B, et al. A 4-polymorphism risk score predicts steatohepatitis in children with nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr. 2014;58:632-6. NAFLD is closely linked to a sedentary lifestyle, increased body mass index (BMI), and visceral adiposity in children, resulting from excess caloric intake.33 Feldstein AE, Charatcharoenwitthaya P, Treeprasertsuk S, Benson JT, Enders FB, Angulo P. The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years. Gut. 2009;58:1538-44. Several recent studies have reported that, in addition to environmental risk factors, individual genetic variations may also contribute to the development and progression of NAFLD.44 Lin YC, Chang PF, Hu FC, Yang WS, Chang MH, Ni YH. A common variant in the PNPLA3 gene is a risk factor for non-alcoholic fatty liver disease in obese Taiwanese children. J Pediatr. 2011;158:740-4.
Several candidate genes have been implicated in the pathogenesis of NAFLD, including genes involved in hepatic lipid metabolism, insulin sensitivity, and generation of reactive oxidant species or cytokines.55 Hernaez R. Genetic factors associated with the presence and progression of nonalcoholic fatty liver disease: a narrative review. Gastroenterol Hepatol. 2012;35:32-41. Single-nucleotide polymorphisms in genes involved in lipid metabolism (patatin-like phospholipase domain-containing 3 and lipin 1), oxidative stress (superoxide dismutase 2), insulin signalling (insulin receptor substrate-1), and fibrogenesis (Krüppel-like factor 6) have been found to be associated with NAFLD in children.22 Nobili V, Donati B, Panera N, Vongsakulyanon A, Alisi A, Dallapiccola B, et al. A 4-polymorphism risk score predicts steatohepatitis in children with nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr. 2014;58:632-6. Apart from these well-known polymorphisms, polymorphisms in genes that encode proteins known to be involved in the pathogenesis of NAFLD may also be associated with NAFLD development.
The monocyte chemo-attractant protein-1 (MCP-1), also called chemokine ligand 2 (CCL2), a strong chemotactic factor, plays a role in the activation of monocytes, macrophages, and T-cells in the acute and chronic phases of inflammation.66 Harigai M, Hara M, Yoshimura T, Leonard EJ, Inoue K, Kashiwazaki S. Monocyte chemoattractant protein-1 (MCP-1) in inflammatory joint diseases and its involvement in the cytokine network of rheumatoid synovium. Clin Immunol Immunopathol. 1993;69:83-91. The 2518 A/G polymorphism in the MCP-1 gene affects the level of MCP-1 expression in response to inflammatory stimuli, and is known to be associated with diabetes mellitus and several auto-immune diseases.77 Moon JY, Jeong L, Lee S, Jeong K, Lee T, Ihm CG, et al. Association of polymorphisms in monocyte chemoattractant protein-1 promoter with diabetic kidney failure in Korean patients with type 2 diabetes mellitus. Korean Med Sci. 2007;22:810-4.,88 Hwang SY, Cho ML, Park B, Kim JY, Kim YH, Min DJ, et al. Allelic frequency of the MCP-1 promoter -2518 polymorphism in the Korean population and in Korean patients with rheumatoid arthritis, systemic lupus erythematosus and adult onset Still's disease. Eur J Immunogenet. 2002;29:413-6. MCP-1 exerts a chemotactic effect on monocytes and T-cells via the chemokine receptor 2 (CCR2).99 Singh V, Srivastava N, Srivastava P, Mittal RD. Impact of CCL2 and its receptor CCR2 gene polymorphism in North Indian population: a comparative study in different ethnic groups worldwide. Indian J Clin Biochem. 2013;28:259-64. The 190 G/A polymorphism in the CCR gene has also been reported to be associated with NAFLD development.1010 Zhang C, Guo L. Interaction of polymorphisms of monocyte chemoattractant protein-1 receptor CCR2 gene 190A/G, nicotinamide adenine dinucleotide phosphate oxidase subunit p22phox gene C242T and cigarette smoking increases the risk of nonalcoholic fatty liver disease. Wei Sheng Yan Jiu. 2015;44:730-7.
ATP-binding cassette transporter 1 (ABCA1) is a member of the ATP-binding cassette (ABC) membrane transporter family. ABCA1 expression resulted in increased cholesterol efflux and decreased hepatic lipid contents.1111 Vega-Badillo J, Gutiérrez-Vidal R, Hernández-Pérez HA, Villamil-Ramírez H, León-Mimila P, Sánchez-Muñoz F, et al. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016;36:1383-91. Inflammatory stress increases cholesterol accumulation in hepatocytes and inhibits the expression of ABCA1.1212 Ma KL, Ruan XZ, Powis SH, Chen Y, Moorhead JF, Varghese Z. Inflammatory stress exacerbates lipid accumulation in hepatic cells and fatty livers of apolipoprotein E knockout mice. Hepatology. 2008;48:770-8. Furthermore, it has been reported that decreased hepatic ABCA1 expression can cause steatohepatitis in morbidly obese adult patients.1111 Vega-Badillo J, Gutiérrez-Vidal R, Hernández-Pérez HA, Villamil-Ramírez H, León-Mimila P, Sánchez-Muñoz F, et al. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016;36:1383-91. Interleukin-17 (IL-17) is a pro-inflammatory molecule produced by T-helper 17 cells (Th17). It mediates the immune response against extra-cellular bacterial and fungal pathogens, and is involved in the development of inflammatory and auto-immune diseases.1313 Puel A, Doffinger R, Natividad A, Chrabieh M, Barcenas-Morales G, Picard C, et al. Autoantibodies against IL-17A, IL-17F, and IL-22 in patients with chronic mucocutaneous candidiasis and autoimmune polyendocrine syndrome type I. J Exp Med. 2010;207:291-7. IL-17 has also been suggested to play a critical role in the development of various liver diseases, such as chronic viral hepatitis, auto-immune diseases, and alcoholic liver diseases.1414 Zhao L, Qiu D, Ma X. Th17 cells: the emerging reciprocal partner of regulatory T cells in the liver. J Dig Dis. 2010;11:126-33.
15 Ye C, Li WY, Zheng MH, Chen YP. T-helper 17 cell: a distinctive cell in liver diseases. Hepatol Res. 2011;41:22-9.-1616 Hammerich L, Heymann F, Tacke F. Role of IL-17 and Th17 cells in liver diseases. Clin Dev Immunol. 2011;2011:345803. IL-17A (-197 G/A) has been shown to affect the development of ulcerative colitis and rheumatoid arthritis.1717 Arisawa T, Tahara T, Shibata T, Nagasaka M, Nakamura M, Kamiya Y, et al. The influence of polymorphisms of interleukin-17A and interleukin-17F genes on the susceptibility to ulcerative colitis. J Clin Immunol. 2008;28:44-9.
The present study aimed to investigate the association between NAFLD and polymorphisms in genes encoding proteins that have been suggested to play a role in NAFLD pathogenesis. To the best of the authors' knowledge, the relationship between the four single-nucleotide polymorphisms and NAFLD has not been studied previously.
Methods
The study included obese Turkish patients aged 10 -17 years, who presented at the Paediatric Gastroenterology, Hepatology, and Nutrition Clinic and the Paediatric Endocrinology Clinic of the Kanuni Training and Research Hospital between June, 2015 and July, 2016. Patients were considered obese if they had BMI Z-scores ≥2 for age and gender.1818 WHO Multicentre Growth Reference Study Group. WHO Child Growth Standards: length/height-for-age, weight-for-age, weight-for-length, weight-for-height and body mass index-for-age: methods and development. Geneva: World Health Organization; 2006. The 186 patients enrolled in the study were separated into two groups. The NAFLD group (n = 101) comprised patients diagnosed with NAFLD, with alanine aminotransferase (ALT) levels greater than twice the upper limit of the normal level (males > 50 U/L, females > 44 U/L) and fatty liver disease detected by ultrasonography (USG).1919 Schwimmer JB, Newton KP, Awai HI, Choi LJ, Garcia MA, Ellis LL, et al. Paediatric gastroenterology evaluation of overweight and obese children referred from primary care for suspected non-alcoholic fatty liver disease. Aliment Pharmacol Ther. 2013;38:1267-77. Patients with other causes of fatty liver disease, such as Wilson disease, α-1 antitrypsin deficiency, auto-immune hepatitis, and viral hepatitis, were excluded. The non-NAFLD group (n = 85) included obese patients without NAFLD (normal ALT levels and USG imaging of liver), having similar anthropometric measurements, insulin resistance, and lipid profile as the NAFLD group. None of the patients in the study underwent liver biopsy. Patients with genetic, endocrine, or metabolic diseases that might cause obesity were not included in the study. In addition, none of the patients had any co-morbid proinflammatory diseases such as inflammatory bowel disease.
The study was performed after receiving approval from the local ethics committee (Registry Url: 2015/27; Identifier: Trabzon Kanuni Training and Research Hospital Clinical Research Ethics Committee) and informed parental consent, in accordance with the Declaration of Helsinki.
All participants were subjected to physical examination. Height was measured to the nearest centimetre using a Harpenden stadiometer (Holtain Limited - Crymych, Dyfed, United Kingdom). Weight was measured unclothed to the nearest 0.1 kg using a calibrated balance scale. Body mass index (BMI) was calculated using the formula: weight (kg)/height (m2). Z-scores for BMI were calculated using the reference values for Turkish children.2020 Neyzi O, Bundak R, Gökçay G, Günöz H, Furman A, Darendeliler F, et al. Reference values for weight, height, head circumference, and body mass index in Turkish children. J Clin Res Pediatr Endocrinol. 2015;7:280-93. Body fat ratio was calculated with the bioelectrical impedance analysis (BIA) method on a Tanita BC 418 (Tanita Corporation - Tokyo, Japan) device. Waist and hip circumference measurements were obtained using a non-stretch tape measure while the patient stood upright with the feet close together (12 -15 cm) and arms by the side. The waist-hip ratio was calculated by dividing the waist measurement by the hip measurement.
After a ten-hour fast, peripheral venous blood samples were obtained to determine the levels of insulin (Beckman Coulter DXI 800 - California, United States), high-density lipoprotein (HDL), low-density lipoprotein (LDL), triglycerides, total cholesterol, ALT, aspartate aminotransferase (AST), gamma glutamyltransferase (GGT), and glucose (Beckman Coulter AU5821 - California, United States). The homeostatic model assessment of insulin resistance (HOMA-IR) value was calculated using the formula: glucose × insulin (µU/mL)/405.2121 Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412-9.
All examinations were performed by two radiologists with more than ten years of experience in paediatric abdominal imaging and liver steatosis, and the results were determined by consensus. The radiologists were blinded to the clinical findings and laboratory results of the patients. The ultrasound machine used was an Aplio 500 (Toshiba Medical Systems - Otawara, Japan) with linear 4 -9 MHz transducers. The patients were evaluated in the dorsal decubitus position with the right arm at maximum abduction. The patients were asked to fast for four hours prior to the examination. Longitudinal images of the right liver lobe and the ipsilateral kidney were obtained, including the sagittal hepatic sections. Semi-quantitative grading of fatty changes was performed using the USG findings of fatty liver, vascular blurring, and deep attenuation with liver-kidney contrast.2222 Fu JF, Shi HB, Liu LR, Jiang P, Liang L, Wang CL, et al. Non-alcoholic fatty liver disease: an early mediator predicting metabolic syndrome in obese children?. World J Gastroenterol. 2011;17:735-42.
DNA was isolated from the peripheral blood using the automatic QuickGene device. Target areas were amplified using PCR with primary pairs: for MCP1 (2518 A/G) polymorphism, F: 5′ CTTTCCCTTGTGTGTCCCC 3′, R: 5′ TTACTCCTTTTCTCCCCAACC 3′; for CCR-2 rs1799864 polymorphism, F: 5′ ATTTCCCCAGTACATCCACAAC 3′, R: 5′ CCCACAATGGGAGAGTAATAAG 3′; for ABCA1rs4149313 polymorphism, F: 5′ GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 3′, R: 5′ AGAAAGGCAGGAGACAT CGCTT 3′; and for IL-17A rs2275913 polymorphism, F: 5′ AACAAGTAAGAATGAAAAGAGGACATGGT 3′, R: 5′ CCCCCAATGAGGTCATAGAAGAATC 3′.
Sectioning was performed using Pvull (Vivantis) restriction enzymes for MCP1 (-2518 A/G) genotype assignment, FokL (Vivantis) restriction enzymes for CCR-2 rs1799864 genotype assignment, Econl (Vivantis) restriction enzymes for ABCA1 rs4149313 genotype assignment, and BstENI restriction enzymes for IL-17A rs2275913 genotype assignment. After cutting by 2% agarose gel electrophoresis, analysis was performed according to the product size. For control, accuracy was confirmed by 10% random sequence analysis from both groups.
The data were evaluated using SPSS 13.0 (SPSS Inc. - Chicago, IL, United States) statistics software. Descriptive data were presented as mean ± standard deviation (SD). The analysis of the results was performed using percentage distribution for qualitative data and median interquartile range (IQR) or mean (standard deviation) for quantitative data. For comparison between two groups, Student's t-test for independent paired samples was used for variables showing normal distribution and the Mann -Whitney U-test was used for those not distributed normally. In case of more than two groups, the ANOVA test was used for variables showing normal distribution and the Kruskal -Wallis test was used for those not showing normal distribution. The chi-squared test was used for comparing categorical variables. Genotypic association and the odds ratio (OR) with 95% confidence interval (CI) were estimated by binary logistic regression analysis. In all cases, p-values less than 0.05 were considered statistically significant. Power analysis was performed using normal approximation with the continuity correction method of Open Epi (3.01 version).
Results
The demographic characteristics, anthropometric measurements, and laboratory data of the patients are shown in Table 1. No differences were found between the groups in terms of age and gender, BMI, waist/hip ratio, or body fat ratio. In addition to ALT, AST and GGT concentrations were also found to be significantly higher in the NAFLD group than the non-NAFLD group (p < 0.05).
No differences were observed between the groups in terms of genotype and allele frequency for MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 polymorphisms (Table 2). Among the four variants, only IL-17A rs2275913 was found to be associated with NAFLD. The percentage of IL-17A rs2275913 AA genotypes was significantly higher in the NAFLD group than the non-NAFLD group (p = 0.02, OR: 2.05, 95% CI: 1.12 -3.77). The frequency of the A allele of IL-17A rs2275913 was significantly higher in the NAFLD group than the non-NAFLD group (p = < 0.01). The power of the study was calculated as 53%. For this power (alpha error: 0.05 and Df: 1), the effect size was calculated as 0.15.
Genotypic and allelic frequency of the MCP-1 rs1024611, CCR-2 rs1799864, ABCA1 rs4149313, and IL-17A rs2275913 polymorphisms in patients, and logistic regression analysis of predictive factors for NAFLD.
Univariate logistic regression analysis showed that patients with the IL-17A rs2275913 AA genotype had a 3.00 (95% CI: 1.37 -6.58; p ≤ 0.01) times greater chance of having NAFLD than patients with the GG genotype (Table 3).
The clinical and biochemical characteristics of the groups, with respect to the IL-17A rs2275913 genotype, are shown in Table 4. There were significant differences in AST and ALT concentrations between the three groups (p = 0.04 and p = 0.04, respectively). The serum ALT and AST concentrations were highest in the AA genotype and lowest in the GG genotype.
Discussion
This study evaluated the effect of four polymorphisms in the development of NAFLD in obese children. The AA genotype of the IL-17A gene was found more frequently in obese children with NAFLD than in obese children without NAFLD. However, no significant differences were found in MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 gene polymorphisms between obese Turkish children with and without NAFLD, suggesting that these polymorphisms had no role in the development of NAFLD in obese children.
The balance between pro-inflammatory and anti-inflammatory mechanisms is of critical importance for the development and progression of NAFLD. Stimulation of pro-inflammatory macrophages by pro-inflammatory mediators such as interferon-γ and lipopolysaccharides stimulates the secretion of pro-inflammatory cytokines such as TNFα, IL-6, IL-17, and IL-23, which in turn causes hepatic and metabolic damages.2323 Fujisaka S, Usui I, Bukhari A, Ikutani M, Oya T, Kanatani Y, et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes. 2009;58:2574-82.,2424 Vonghia L, Magrone T, Verrijken A, Michielsen P, Van Gaal L, Jirillo E, et al. Peripheral and hepatic vein cytokine levels in correlation with non-alcoholic fatty liver disease (NAFLD)-related metabolic, histological, and haemodynamic features. PLoS ONE. 2015;10:e0143380. In contrast, regulatory T-cells (Treg) prevent the production of pro-inflammatory cytokines such as IL-17 by expressing anti-inflammatory cytokines such as IL-10, thus controlling inflammation.2525 Wang Y, Lıu XP, Zhao ZB, Chen JH, Yu CG. Expression of CD4+ forkhead box P3 (FOXP3)+ regulatory T cells in inflammatory bowel disease. J Dig Dis. 2011;12:286-94. In experimental studies, the activation of the IL-17 pathway has been shown to play a significant role in the development of NAFLD, progression of steatosis, and formation of fibrosis.2626 Paquissi FC. Immune imbalances in non-alcoholic fatty liver disease: from general biomarkers and neutrophils to interleukin-17 axis activation and new therapeutic targets. Front Immunol. 2016;7:490.
The IL-17A rs2275913 polymorphism is known to be strongly associated with IL-17 secretion from T-cells. In an in vitro study by Espinoza et al., a higher level of IL-17 secretion was observed in stimulated T-cells of subjects with the IL-17A rs2275913 AA allele than in subjects without it.2727 Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS ONE. 2011;6:e26229. Differential binding of the allelic variants of the IL-17A rs2275913 polymorphism to the nuclear factor activated T-cells (NFAT) was proposed to be responsible for the differences in IL-17A secretion.2727 Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS ONE. 2011;6:e26229. Several inflammatory diseases have been found to be clinically associated with the IL-17A rs2275913 polymorphism. The rs2275913 AA homozygote was found to be associated with increased risk of susceptibility to rheumatoid arthritis in Caucasian populations and ulcerative colitis in Japanese populations.2828 Nordang GB, Viken MK, Hollis-Moffatt JE, Merriman TR, Helgetveit K, et al. Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand. Rheumatology (Oxf). 2009;48:367-70.,2929 Hayashi R, Tahara T, Shiroeda H, Saito T, Nakamura M, Tsutsumi M, et al. Influence of IL17A polymorphisms (rs2275913 and rs3748067) on the susceptibility to ulcerative colitis. Clin Exp Med. 2013;13:239-44.
In the present study, it was found that the IL-17A rs2275913 polymorphism was more frequent in obese children with NAFLD than in those without NAFLD. A previous study has also reported an association between IL-17 concentration and ALT concentration in patients with chronic hepatitis B virus infection, reflecting the degree of liver damage.3030 Zhang JY, Zhang Z, Lin F, Zou ZS, Xu RN, Jin L, et al. Interleukin-17-producing CD4(+)T cells increase with severity of liver damage in patients with chronic hepatitis B. Hepatology. 2010;51:81-91. Consistent with these observations, serum ALT as well as serum AST concentrations significantly differed among the IL-17 rs2275913 allele groups (AA, AG, and GG). Serum ALT and AST concentrations were highest in the AA genotype and lowest in the GG genotype. These findings suggested that the AA genotype could be a risk factor for the development of NAFLD in obese patients.
No significant differences were found in MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 gene polymorphisms between obese children with and without NAFLD, indicating that these polymorphisms did not appear to play a role in the development of NAFLD. However, these polymorphisms may well be related to the development of steatohepatitis in obese children, as it was not possible to assess the degree of hepatic fibrosis and inflammation in these patients.
This study has some limitations. First, the study population was relatively small. The frequency of the studied polymorphisms is known to vary among races. The ethnic structure of the population could affect the prevalence of the polymorphisms. Therefore, these results cannot be generalized to other populations. Second, NAFLD was diagnosed by ultrasonography and by measuring elevated transaminases levels, which are regarded as imperfect tools for detecting steatosis. None of the patients in this study underwent liver biopsy or fibroscan. Therefore, neither fibrosis nor liver inflammation could be assessed in the participants. Consequently, the association between the polymorphisms and the degree of fibrosis and inflammation could not be examined. Third, the effect of the IL-17A rs2275913 polymorphism on gene transcription was not investigated.
In conclusion, the results of this study showed that the AA genotype of the IL-17A gene may be associated with NAFLD development. This polymorphism may serve as a predictor for liver steatosis and provide useful insights for identifying potential therapeutic targets for treating liver diseases in obese patients. Unlike IL-17A (-197 G/A) (rs2275913), no relation was found between the MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), and ABCA1 (883 G/A) (rs4149313) polymorphisms and NAFLD in obese Turkish children. Further large-scale studies on the association between these polymorphisms and NAFLD, as well as fibrosis, need to be performed in different ethnicities in order to confirm these findings.
-
☆
Please cite this article as: Akbulut UE, Emeksiz HC, Citli S, Cebi AH, Korkmaz HA, Baki G. IL-17A, MCP-1, CCR-2, and ABCA1 polymorphisms in children with non-alcoholic fatty liver disease. J Pediatr (Rio J). 2019;95:350 -7.
-
FundingThis work was supported by the Kanuni Training and Research Hospital.
-
Ethics committee approvalEthics committee approval was received for this study from the ethics committee of Kanuni Training and Research Hospital.
References
-
1Vos MB, Abrams SH, Barlow SE, Caprio S, Daniels SR, Kohli R, et al. NASPGHAN clinical practice guideline for the diagnosis and treatment of nonalcoholic fatty liver disease in children: recommendations from the Expert Committee on NAFLD (ECON) and the North American Society of Pediatric Gastroenterology, Hepatology and Nutrition (NASPGHAN). J Pediatr Gastroenterol Nutr. 2017;64:319-34.
-
2Nobili V, Donati B, Panera N, Vongsakulyanon A, Alisi A, Dallapiccola B, et al. A 4-polymorphism risk score predicts steatohepatitis in children with nonalcoholic fatty liver disease. J Pediatr Gastroenterol Nutr. 2014;58:632-6.
-
3Feldstein AE, Charatcharoenwitthaya P, Treeprasertsuk S, Benson JT, Enders FB, Angulo P. The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years. Gut. 2009;58:1538-44.
-
4Lin YC, Chang PF, Hu FC, Yang WS, Chang MH, Ni YH. A common variant in the PNPLA3 gene is a risk factor for non-alcoholic fatty liver disease in obese Taiwanese children. J Pediatr. 2011;158:740-4.
-
5Hernaez R. Genetic factors associated with the presence and progression of nonalcoholic fatty liver disease: a narrative review. Gastroenterol Hepatol. 2012;35:32-41.
-
6Harigai M, Hara M, Yoshimura T, Leonard EJ, Inoue K, Kashiwazaki S. Monocyte chemoattractant protein-1 (MCP-1) in inflammatory joint diseases and its involvement in the cytokine network of rheumatoid synovium. Clin Immunol Immunopathol. 1993;69:83-91.
-
7Moon JY, Jeong L, Lee S, Jeong K, Lee T, Ihm CG, et al. Association of polymorphisms in monocyte chemoattractant protein-1 promoter with diabetic kidney failure in Korean patients with type 2 diabetes mellitus. Korean Med Sci. 2007;22:810-4.
-
8Hwang SY, Cho ML, Park B, Kim JY, Kim YH, Min DJ, et al. Allelic frequency of the MCP-1 promoter -2518 polymorphism in the Korean population and in Korean patients with rheumatoid arthritis, systemic lupus erythematosus and adult onset Still's disease. Eur J Immunogenet. 2002;29:413-6.
-
9Singh V, Srivastava N, Srivastava P, Mittal RD. Impact of CCL2 and its receptor CCR2 gene polymorphism in North Indian population: a comparative study in different ethnic groups worldwide. Indian J Clin Biochem. 2013;28:259-64.
-
10Zhang C, Guo L. Interaction of polymorphisms of monocyte chemoattractant protein-1 receptor CCR2 gene 190A/G, nicotinamide adenine dinucleotide phosphate oxidase subunit p22phox gene C242T and cigarette smoking increases the risk of nonalcoholic fatty liver disease. Wei Sheng Yan Jiu. 2015;44:730-7.
-
11Vega-Badillo J, Gutiérrez-Vidal R, Hernández-Pérez HA, Villamil-Ramírez H, León-Mimila P, Sánchez-Muñoz F, et al. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016;36:1383-91.
-
12Ma KL, Ruan XZ, Powis SH, Chen Y, Moorhead JF, Varghese Z. Inflammatory stress exacerbates lipid accumulation in hepatic cells and fatty livers of apolipoprotein E knockout mice. Hepatology. 2008;48:770-8.
-
13Puel A, Doffinger R, Natividad A, Chrabieh M, Barcenas-Morales G, Picard C, et al. Autoantibodies against IL-17A, IL-17F, and IL-22 in patients with chronic mucocutaneous candidiasis and autoimmune polyendocrine syndrome type I. J Exp Med. 2010;207:291-7.
-
14Zhao L, Qiu D, Ma X. Th17 cells: the emerging reciprocal partner of regulatory T cells in the liver. J Dig Dis. 2010;11:126-33.
-
15Ye C, Li WY, Zheng MH, Chen YP. T-helper 17 cell: a distinctive cell in liver diseases. Hepatol Res. 2011;41:22-9.
-
16Hammerich L, Heymann F, Tacke F. Role of IL-17 and Th17 cells in liver diseases. Clin Dev Immunol. 2011;2011:345803.
-
17Arisawa T, Tahara T, Shibata T, Nagasaka M, Nakamura M, Kamiya Y, et al. The influence of polymorphisms of interleukin-17A and interleukin-17F genes on the susceptibility to ulcerative colitis. J Clin Immunol. 2008;28:44-9.
-
18WHO Multicentre Growth Reference Study Group. WHO Child Growth Standards: length/height-for-age, weight-for-age, weight-for-length, weight-for-height and body mass index-for-age: methods and development. Geneva: World Health Organization; 2006.
-
19Schwimmer JB, Newton KP, Awai HI, Choi LJ, Garcia MA, Ellis LL, et al. Paediatric gastroenterology evaluation of overweight and obese children referred from primary care for suspected non-alcoholic fatty liver disease. Aliment Pharmacol Ther. 2013;38:1267-77.
-
20Neyzi O, Bundak R, Gökçay G, Günöz H, Furman A, Darendeliler F, et al. Reference values for weight, height, head circumference, and body mass index in Turkish children. J Clin Res Pediatr Endocrinol. 2015;7:280-93.
-
21Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412-9.
-
22Fu JF, Shi HB, Liu LR, Jiang P, Liang L, Wang CL, et al. Non-alcoholic fatty liver disease: an early mediator predicting metabolic syndrome in obese children?. World J Gastroenterol. 2011;17:735-42.
-
23Fujisaka S, Usui I, Bukhari A, Ikutani M, Oya T, Kanatani Y, et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes. 2009;58:2574-82.
-
24Vonghia L, Magrone T, Verrijken A, Michielsen P, Van Gaal L, Jirillo E, et al. Peripheral and hepatic vein cytokine levels in correlation with non-alcoholic fatty liver disease (NAFLD)-related metabolic, histological, and haemodynamic features. PLoS ONE. 2015;10:e0143380.
-
25Wang Y, Lıu XP, Zhao ZB, Chen JH, Yu CG. Expression of CD4+ forkhead box P3 (FOXP3)+ regulatory T cells in inflammatory bowel disease. J Dig Dis. 2011;12:286-94.
-
26Paquissi FC. Immune imbalances in non-alcoholic fatty liver disease: from general biomarkers and neutrophils to interleukin-17 axis activation and new therapeutic targets. Front Immunol. 2016;7:490.
-
27Espinoza JL, Takami A, Nakata K, Onizuka M, Kawase T, Akiyama H, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS ONE. 2011;6:e26229.
-
28Nordang GB, Viken MK, Hollis-Moffatt JE, Merriman TR, Helgetveit K, et al. Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand. Rheumatology (Oxf). 2009;48:367-70.
-
29Hayashi R, Tahara T, Shiroeda H, Saito T, Nakamura M, Tsutsumi M, et al. Influence of IL17A polymorphisms (rs2275913 and rs3748067) on the susceptibility to ulcerative colitis. Clin Exp Med. 2013;13:239-44.
-
30Zhang JY, Zhang Z, Lin F, Zou ZS, Xu RN, Jin L, et al. Interleukin-17-producing CD4(+)T cells increase with severity of liver damage in patients with chronic hepatitis B. Hepatology. 2010;51:81-91.
Publication Dates
-
Publication in this collection
01 July 2019 -
Date of issue
May-Jun 2019
History
-
Received
17 Jan 2018 -
Accepted
23 Mar 2018 -
Published
5 May 2018