INTRODUCTION

After obtaining the entomological evidence present in a corpse, taxonomic identification is the first step (^{Wells & Sperling, 2001}; ^{Yusseff, 2006}; ^{Saigusa et al., 2009}) and is considered the most important procedure performed in entomological forensic analysis (^{Wells et al., 2001}; ^{Zehner et al., 2004}). The correct taxonomic identification makes possible to obtain biological and ecological data useful to determine the post-mortem interval (PMI). That is why forensic entomologists must ensure that each specimen found in a crime scene, either larva, pupa or adult, to be properly identified up to the species level.

Within the entomofauna that participates in the processes of cadaverous putrefaction, the family Calliphoridae is of particular interest because their carrion habits makes it one of the main decomposers groups (^{Segura et al., 2009}). In Colombia, ^{Amat et al., 2008} recorded 12 genera and 29 species of blowflies (not including Mesembrinellidae). Of which at least 13 species represent medico legal importance (^{Pape et al., 2004}; ^{Florez & Wolff, 2009}) and the identification by morphological characters has had in recent years significant advances. Unfortunately, in many cases the morphological identification is very difficult or impossible to perform due to lack of experience in a given taxonomical group, or by the high degree of similarity between species of the same genus, or even by loss of morphological characters during procedures of collection, preservation and packaging the entomological samples. In such circumstances, the molecular identification is particularly important because it allows identifying species from fragments of adult individuals, immatures and even empty pupae (^{Benecke, 1998}; ^{Harvey et al., 2003}).

This methodological alternative is already being used in several countries from all continents (^{Cainé et al., 2009}; ^{Meiklejohn et al., 2011}; ^{Park et al., 2009}). In Latin America however, the progress of forensic entomology is slow and although we can highlight the achievements of countries like Brazil or Colombia (^{Buenaventura et al., 2009}; ^{Carvalho & Mello-Patiu, 2008}), the fact is that there is a lag generalized. In Colombia for example, only until 2011 (^{Giraldo et al., 2011}) published the first work that uses mitochondrial genes as potential use for the identification of species with forensic relevance.

Among the major genes used for identifying insects, mitochondrial genes are widely accepted. Of these, the Cytochrome Oxidase I (COI) is by far the most used gene (^{Hebert et al., 2003}; ^{Tuccia et al., 2016}). However, authors like (^{Wells et al., 2007}) and (^{Whitworth et al., 2007}) warn about possible errors and even the inability of the COI gene to identify species of forensic interest mainly from the family Calliphoridae. Under these circumstances, the same authors point out the need to evaluate mitochondrial regions differents from COI, like COII or ND5.

Given the importance of molecular studies for identification of forensic interest species and lack of studies of this kind in Colombia, the objective of this work is to determine the molecular variability of a segment of mitochondrial gene COII like an alternative to identify six species of the family Calliphoridae with forensic interest present in Bogotá, Colombia.

MATERIAL AND METHODS

PCR AMPLIFICATION AND SEQUENCING

Oligonucleotides primers (TCTTCCACGATCATGCACTT) and (GAGACCAGTACTTGCTTTCAGTCA) were designed to amplify a region of 656 bp of the mitochondrial gene COII. The PCR reaction was carried out under the following conditions: 1.5 uL of each primer (0.5 uM), 2.4 mL of dNTPs (0.8 mM), 2.1 mL of MgCl2 (3.5 mM), 0.2 mL of Taq polymerase (1U) 3 uL of stabilizer buffer (1x) and 4 uL of DNA adjusted to a final volume of 30 uL. The amplification program had an initial denaturation step at 98°C for three minutes, followed by 40 cycles of 96°C for 30 seconds, 54°C for one minute and 72°C for a minute. A final extension step was added for five minutes at 72°C. The PCR products were evaluated on agarose gels dyed with 1% ethidium bromide and subsequently sequenced with ABI PRISM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit version 3.1 (Applied Biosystems, Foster City, CA, USA).

RESULTS

The species Calliphora nigribasis Macquart, Calliphora vicina Robineau-Desvoidy, Compsomyopsis verena (Walker), Sarconesiopsis magellanica (Le Guillou), Chrysomia albiceps (Wiedemann) and Roraimomusca roraima Townsend, are into the principal entomofauna with forensic interest present in Bogotá, Colombia (^{Camacho, 2005}; ^{Segura et al., 2009}). For these, the extraction protocol yielded good DNA quality with concentrations between 50 ng/uL to 200 ng/uL. That DNA was used to obtain 18 sequences available for identifying and differentiate these six species based in their genetics distances (Table 1).

Comparison of the sequences in BLAST tool allowed verify their similarity with previously reported sequences from COII gene in Calliphoridae. The segment has 599 base pairs and is located in the region 3,104-3,702 from complete mitochondrial genome of Chrysomia albiceps (JX913736.1). The nucleotide sequence composition present the normal pattern described for mitochondrial genes in insects (^{Junqueira et al., 2004}; ^{Oliveira et al., 2008}), where thymine and adenine have over 70% of total base pairs (Table 2).

The distance matrix for COII gene (Table 3) reveals intraspecific variation ranging from 0.1% to 1.8%; while interspecific variation reach values ranging from 3.7% to 14.3%. From the fragments sequenced in this study, the higher intraspecific variability occurs in the sequences of C. nigribasis with 1.3%, representing a variation of eight nucleotides between 599 obtained. Unlike these, sequences obtained for C. verena and C. vicina present no nucleotide change. Chrysomia albiceps and R. roraima presents changes in two nucleotides, and S. magellanica have variability in six nucleotides.

Regarding interspecific relationships, the highest percentages of variation are present for the comparision of all species againts R. roraima, being the largest difference is between R. roraima and C. nigribasis with 14.3%. Conversely, the lower values occur between C. vicina and C. nigribasis with maximum percentages 5.3%, which means changes in 33 of the 599 nucleotides sequenced. The comparison of the sequences obtained with those reported in others study for the same gene, show intraspecific differences of 1.8% between the C. vicina, and 2.0% between the C. albiceps. Intraspecific variation between C. verena and C. callipes is 3.7% and between C. nigribasis and C. nigribarbis is 3.8% (Table 3).

The topological representation of genetic distance shows taxonomic relationships of the species compared in this study (Fig. 1). In a level of genus, Compsomyiops includes species C. callipes and C. verena in one group; Calliphora grouped species C. vicina, C. nibribasis and C. nigribarbi, while Chrysomya contains all three individuals of C. albiceps. Roraimomusca, Sarconesiopsis and Cochliomya are located in separated taxonomic groups.

FIGURE 1 Phenogram distances created under the maximum likelihood model (ML). 

DISCUSSION

In addition to the phylogenetic reconstruction, genetic distance analyses have become an important mechanism for taxonomic identification when using molecular data (^{Desmyter & Gosselin, 2009}). The Barcode initiative (^{Hebert et al., 2003}) focused the attention to use a segment of COI gene; however, in some cases - not only in forensic entomology -, this gene has shown some problems to identify species (^{Elias et al., 2007}; ^{Wells & Stevens, 2008}). These difficulties have made it necessary to use alternative genes in the procedures of identification and phylogeny. In the case of forensic entomology, the COII, ND1, ND5 and CYTB genes are being used (^{Alessandrini et al., 2008}; ^{Wells & Stevens, 2008}; ^{Zehner et al., 2004}).

In this research, the use of mitochondrial gene COII fragment allowed taxonomically identification of six species from the family Calliphoridae forensic interest present in Bogotá. This fragment of mitochondrial genome can be used for identify not just adult stages but also larvae or pupae stages as proposed by ^{Boehme et al., 2010}.

^{Hebert et al., 2003} and ^{Meiklejohn et al., 2011} indicates that rates of genetic diversity of 3% are sufficient for identifying species using the COI gene, however ^{Boehme et al., 2012} and ^{Nelson et al., 2007} discovered lower interspecific variation than 3% for segments COI in species of Lucilla and Chrysomya. In this research, the values of diversity in gene COII are in all cases higher than 3% and reach peak levels of 14.3% with 86 nucleotide changes. These results could indicate the importance of COII gene for differentiating species of forensic interest that are closely related and which are difficult to identify using COI.

Intraspecific differences shown in Table 3, never exceed interspecific values. For C. albiceps, the comparison between the newly obtained and the previously sequenced GenBank shows the highest values of the entire table (2.3%). This variability may be indicative of the presence of different haplotypes within the same species that respond to the geographical distance between individuals of whom are from the sequences (Colombia and Austrália).

CONCLUSSION

Six species of the family Calliphoridae with forensic interest present in Bogotá were identified from a 599 bp fragment of the mitochondrial gene COII. For all the six species analyzed the percentages of intraspecific and interspecific variability show that this fragment of COII gene can be used as alternative for identifying species of Calliphoridae.