SciELO - Scientific Electronic Library Online

 
vol.72 issue1Etiology of hearing impairment in children and adolescents of a reference center APADA in the city of Salvador, state of BahiaGlottic configuration in wind instrument players author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

Share


Revista Brasileira de Otorrinolaringologia

Print version ISSN 0034-7299

Rev. Bras. Otorrinolaringol. vol.72 no.1 São Paulo Jan./Feb. 2006

http://dx.doi.org/10.1590/S0034-72992006000100007 

ARTIGO ORIGINAL

 

Efeito da mitomicina C em polipose nasossinusal eosinofílica, in vivo: dosagem de IL5 e GM-CSF, RT-PCR

 

 

Mirian Cabral Moreira de CastroI; Evaldo AssunçãoII; Mariana Moreira de CastroIII; Ricardo Nascimento AraújoIV; Roberto Eustáquio GuimarãesV; Flávio Barbosa NunesVI

IMestranda em cirurgia na Faculdade de Medicina/UFMG Professora da Faculdade de Medicina da Ciências Médicas, Preceptora da residência médica do Hospital das Clínicas da UFMG e Santa Casa de Misericórdia
IILivre-docente, Professor adjunto do departamento de parasitologia da Universidade Federal de Minas Gerais
IIIResidente de Otorrinolaringologia do Hospital das Clínicas da UFMG
IVDoutor em parasitologia - UFMG, Pós-doutorando em parasitologia pela UFMG
VLivre-Docente, Professor adjunto do departamento de oftalmologia, otorrinolaringologia e fonoaudiologia da Universidade Federal de Minas Gerais
VIMestre em Otorrinolaringologia pela Escola Paulista de Medicina, Preceptor da residência médica do Hospital das Clínicas da UFMG

Endereço para correspondência

 

 


RESUMO

A polipose nasossinusal eosinofílica (PNS) é manifestação de uma doença inflamatória crônica na mucosa do nariz e nos seios paranasais caracterizada por infiltração de granulócitos eosinófilos. O fator responsável pela eosinofilia e manutenção dessas células com a perpetuação do processo inflamatório e formação polipóide é objeto constante de estudos. As citocinas como IL5 (interleucina 5) e GM-CSF (fator estimulador de colônia granulócito macrófago) aumentam a sobrevida dos eosinófilos e prolongam a sua presença no tecido polipóide, diminuindo o índice de apoptose eosinofílica.
OBJETIVO: Avaliar o efeito da mitomicina C - MMC - por meio de aplicação tópica em pacientes portadores de PNS eosinofílica quanto à presença de IL5 e GM-CSF.
CASUÍSTICA E MÉTODOS: Quinze pacientes portadores de PNS eosinofílica foram submetidos à aplicação tópica de MMC na concentração de 0,5mg/ml, 1ml, durante cinco minutos, na cavidade nasal direita, e submetidos à biópsia para RT-PCR 24hs após. O grupo-controle foi a cavidade nasal esquerda. O perfil de citocinas foi analisado para IL5 e GM-CSF.
RESULTADOS: A comparação dos resultados de GM-CSF pré e pós-uso de MMC quando usamos o teste t pareado apresenta p=0,041. A comparação para IL5 resulta em p < 0,001.
CONCLUSÃO: O uso de MMC em pacientes com PNS mostra redução com significância estatística par GM-CSF e importante significância para IL5.

Palavras-chave: polipose nasossinusal, eosinófilos, mitomicina c, interleucina 5, GM-CSF.


 

 

INTRODUÇÃO

A polipose nasossinusal - PNS eosinofílica - é uma afecção inflamatória crônica proliferativa que se manifesta na mucosa do nariz e nos e seios paranasais e caracteriza-se por degeneração polipóide benigna (Figura 1). Geralmente é bilateral, tem maior incidência na quarta década de vida e acomete 2,7 % da população, com predomínio de 2,2/1 no sexo masculino. Está fortemente associada à asma; 1/3 dos pacientes portadores de PNS eosinofílica tem asma, portanto, o exame completo do aparelho respiratório deve ser rotina. Associa-se também à NARES (rinite eosinofílica não-alérgica), intolerância aspirínica, sinusite fúngica alérgica e síndrome de Churg-Strauss1,2.

 

 

Histologicamente caracteriza-se por infiltração de granulócitos eosinófilos, cujo mecanismo patogênico não é totalmente conhecido, além de alterações morfológicas como a hiperplasia da membrana basal, irregularidade de distribuição glandular, metaplasia escamosa e edema (Figura 2)3,4.

 

 

Embora tenha sido atribuída à hipersensibilidade mediada por IgE, ou alergia nasal, estudos mostram que a alergia é apenas uma possível causa ou um fator contribuinte5-7. Os eosinófilos e as células estruturais dos pólipos secretam citocinas que mantêm o processo contínuo de inflamação e acúmulo de eosinófilos8. Citocinas como IL5 e GM-CSF aumentam a sobrevida dos eosinófilos e prolongam sua presença no tecido polipóide, diminuindo o índice de apoptose dessas células9-12.

Os eosinófilos expressam receptor CD40 para produção autócrina de GM-CSF e CD40L é expresso por células T CD4 que estão presentes na PNS eosinofílica13.

A alta concentração de IL5 encontrada na PNS eosinofílica sugere um efeito autócrino para essa citocina na ativação dos eosinófilos, existindo ainda forte relação entre IL5 e ECP (proteína catiônica eosinofílica)10,14. Esse aumento das citocinas está relacionado com aspecto genético das células da PNS eosinofílica5.

A maioria dos tratamentos tem como base o uso de corticóide sistêmico por curto período de tempo e tópico por tempo prolongado, além do tratamento cirúrgico15.

A MMC é um agente antineoplásico produzido por Streptomyces caespitosus que tem sido usada como agente antiproliferativo na concentração de 0,4mg/ml. Sua ação em fibroblastos leva à diminuição de formação de tecido cicatricial quando aplicada após procedimentos cirúrgicos. Tem ação tempo dependente e sua aplicação por cinco minutos tem efeito mensurável na proliferação e morfologia celular por até 36 dias in vitro16.

O mecanismo de ação da MMC baseia-se na indução seletiva da síntese de DNA, recombinação e troca de cromatinas irmãs. Sua associação com outras drogas antitumorais leva ao aumento do efeito citotóxico da mesma pelo crescimento da indução da apoptose17-19.

Crosara et al. (2004) demonstraram que a MMC é eficaz na indução de apoptose em eosinófilos presentes em estroma de pólipos nasais eosinofílicos in vitro. Realizaram estudo pareado em nove amostras cultivadas. Os pólipos receberam tratamento de 0,4mg/ml durante cinco minutos e foram corados com hematoxilina eosina15.

Em aplicação tópica, essa droga tem sido usada em oftalmologia, otologia e laringologia sem toxicidade sistêmica, sendo, portanto, considerada segura. Não provoca sangramento, necrose ou infecção quando utilizada em dacriocistorrinostomia externa ou lesões ciliares permanentes em concentração de até 1mg/ml16,18,20-27.

Este estudo tem como objetivo avaliar a ação da MMC, in vivo, em portadores de PNS eosinofílica por meio da análise de IL5 e GM-CSF, pré e 24hs pós-aplicação utilizando-se de RT-PCR (transcrição reversa em reação de cadeia da polimerase).

 

CASUÍSTICA E MÉTODOS

Esta pesquisa compôs-se de pacientes portadores de PNS eosinofílica que concordaram em participar do estudo, após aprovação do Comitê de Ética em Pesquisa. As variáveis constituíram-se do perfil de GM-CSF e IL5. Foram estudados quinze pacientes, seis do sexo feminino e nove do sexo masculino. A faixa etária variou de 30 a 57 anos.

Como critério de inclusão, adotou-se: presença de PNS eosinofílica e ausência de intolerância aspirínica. Considerou-se pólipo eosinofílico quando a eosinofilia tecidual foi maior do que 30% dentre as células inflamatórias, determinada pelo encontro de pelo menos quatro eosinófilos em cada campo microscópico de grande aumento28. Pacientes com história prévia de intolerância aspirínica, submetidos à cirurgia prévia, ou portadores de asma grave corticóide dependentes foram excluídos.

Os pacientes selecionados foram submetidos à aplicação de MMC sobre os pólipos da cavidade nasal direita, na concentração de 0,5mg/ml em algodão embebido em 1 ml da droga, onde permaneceu durante cinco minutos. A cavidade nasal esquerda não manipulada foi o grupo-controle, considerado como pré-aplicação.

Biópsia para PCR - Após 24 horas da aplicação da MMC, realizaram-se biópsias na cavidade direita e, em seguida, na cavidade esquerda. Os tecidos colhidos que apresentavam tamanho médio de 10mm foram imediatamente conduzidos ao Laboratório de Imunologia da UFMG, onde permaneceram a 80 graus negativos.

O perfil de citocinas foi pesquisado no tecido polipóide por meio de transcrição reversa em reação de cadeia da polimerase (RT-PCR) para IL5 e GM-CSF.

Sequência de iniciadores utilizados nas PCRs

Gene Forward Reverse

GM-CSF AGAAATGTTTGACCTCCAGGA TTGCACAGGAAGTTTCCG

IL 5 CTGAGGATTCCTGTTCCTGT CAACTTTCTATTATCCACTC

Os produtos da PCR foram analisados por eletroforese em gel de poliacrilamida 8% corado pela prata. Os géis foram fotografados utilizando o sistema de foto-documentação AlphaDigiDoc 1201, e as bandas resultantes da PCR para cada amostra foram analisadas por densitometria utilizando o programa AlphaEaseFC software versão 3.3.0 (Alphalnnotech) (Figura 3). Esse programa calcula o valor integrado de densidade (IDV - integrated density value) para cada banda que é definida com a intensidade dos pixels da região delimitada pela banda subtraída da intensidade dos pixels da coloração de fundo da coluna da banda no gel.

 

 

RESULTADOS

Em relação aos valores obtidos para IL5, na Figura 4 observa-se o gráfico box-plot da distribuição pré e pós-aplicação de MMC. Constata-se que 75% (parte superior da caixa) dos valores de IL5 pós estão abaixo de 3.000 enquanto quase 100% (linha inferior do Gráfico pré) dos valores de IL5 pré estão acima desse valor.

 

 

A comparação da média de IL5 pré e pós, usando o teste t pareado, apresentou p<0,001, indicando uma importante significância estatística.

Em relação aos valores de GM-CSF na Figura 5, observa-se o gráfico box-plot da distribuição dos valores de GM-CSF pré e pós- aplicação de MMC e constata-se que 75% (parte superior da caixa) dos valores de GM-CSF pós estão abaixo de 15.000 enquanto apenas 50% dos valores de GM-CSF pré estão abaixo desse valor (linha do meio do Gráfico pré).

 

 

A comparação da média de GM-CSF pré e pós, usando o teste t pareado, apresentou p =0,041, concluindo-se que a diferença observada tem significância estatística.

Na Figura 6, observa-se o gráfico box-plot da distribuição dos valores da redução percentual de GM-CSF e IL5. Podemos observar que praticamente mais de 75% dos pacientes tiveram uma redução de IL5 maior que 60%, pois a primeira linha da caixa está pouco abaixo desse valor, e que 75% dos pacientes apresentaram redução de GM-CSF menor que 60%, pois a linha superior da caixa está pouco abaixo desse valor.

 

 

Na Tabela1 são apresentados os valores do coeficiente de correlação de Pearson para a comparação da porcentagem de variação da IL5 e GMCSF com as variáveis contínuas.

 

 

Não foi observada nenhuma correlação com significância estatística, ou seja, a variação na porcentagem de redução na IL5 e GMCSF não foi acompanhada pela variação de nenhuma das outras variáveis.

 

DISCUSSÃO

A participação de polimorfonucleares na interface epitelial da mucosa nasal e em outras doenças rinológicas está bem estabelecida. A concentração aumentada de citocinas demonstra sua natureza inflamatória. Os eosinófilos são fontes de interleucinas que têm efeito autócrino e modulador de função de outras células14. A continuidade da resposta inflamatória presente na PNS eosinofílica está relacionada com citocinas como IL5 e GM-CSF que aumentam a sobrevida e diminuem o índice de apoptose dos eosinófilos7,8,10-12. Portanto, regulam a proliferação e ativação celular ampliando a resposta imune local e formação de pólipos. Os eosinófilos expressam IL5 em todas as PNS eosinofílicas e, aproximadamente 30% dos eosinófilos apresentam expressão genética para GM-CSF, com evidências de efeito autócrino dessas citocinas14. O clearance dos eosinófilos seria um mecanismo para diminuição do processo inflamatório. A produção das citocinas está relacionada com o fenótipo das células teciduais, e vários estudos demonstraram a participação-chave de IL5 e GM-CSF na manutenção da atividade inflamatória. Portanto, o bloqueio dessas citocinas seria uma forma terapêutica para melhora de tal afecção. Uma única aplicação de MMC durante cinco minutos tem efeito mensurável na proliferação e na morfologia celular por até 36 dias in vitro16.

Crossara et al. demonstraram que a MMC é eficaz na indução da apoptose em eosinófilos presentes em estroma de pólipos nasais eosinofílicos. Foi feito estudo pareado de nove amostras cultivadas e observou-se que culturas tratadas com MMC apresentaram índice de apoptose em 12 horas significativamente maior em relação ao grupo-controle (p<0,001)15.

A MMC mostrou ação inibitória da síntese de DNA com inibição da proliferação de muitas linhas celulares. Kim et al. demonstraram que seu efeito antifibroblastos humanos cultivados pode ser mediado não só pela ação antiproliferativa, mas também pelo grau de apoptose induzida21.

Nosso objetivo neste trabalho é demonstrar a ação da MMC na redução da concentração das principais citocinas que atuam na manutenção do processo inflamatório da PNS eosinofílica, trabalho não encontrado ainda na literatura médica.

O teste t-pareado mostrou que os valores de GM-CSF pós MMC foram significativamente menores que os valores pré (p=0,041). Comparando-se os valores de IL5 pré e pós MMC, encontramos importante redução, ou seja, a medicação foi eficaz na redução dessas substâncias. Comparando-se a porcentagem com as outras variáveis, não foi identificada nenhuma variável que apresentasse uma correlação significativa.

A MMC pode ser uma opção para tratamento pós-cirúrgico da PNS eosinofílica. Outros estudos são necessários para melhor uso dessa droga nessa afecção.

 

CONCLUSÃO

Em relação à ação da MMC nas principais citocinas envolvidas no processo inflamatório da formação da PNS e em relação à idade e percentagem dos eosinófilos, conclui-se que:

1. Os valores de IL5 pós-aplicação de MMC foram menores que os valores pré-uso da MMC com importante significância estatística;

2. Os valores de GM-CSF pós-aplicação de Mitomicina C foram menores que os valores pré-uso da MMC com significância estatística.

 

REFERÊNCIAS BIBLIOGRÁFICAS

1. Berstein JM. Pólipos Nasais: determinando a Causa Estabelecendo o Tratamento. J Respir Diseases 1998;2: 4-9.        [ Links ]

2. Settipane GA. Nasal polyps and systemic diseases In: Schatz M, Zeiger RS, Settipane GA. Nasal manifestations of systemic diseases Providence: Oceanside Publ 1991a; 43-51.        [ Links ]

3. Coste A, Rateau JG, Roudot-Thoraval F, Chapelin C, Gilain L, Poron F, Peyègre R, Bernaudin J, Escudier E. Increased epithelial cell proliferation in nasal polyps. Arch Otolaryngol Head Neck Surg 1996 ;122: 432-6.        [ Links ]

4. Pawankar R. Nasal polyposis: An update. Curr Opin Allergy Clin Immunol 2003;3:1-6.        [ Links ]

5. Bernstein JM, Gorfien J, Noble B. Role of allergy in nasal polyposis: a review. Otolaryngol Head Neck Surg 1995;113: 724-32.        [ Links ]

6. Sánchez-Segura A, Brieva JA, Rodríguez C. Regulation of immunoglobulin secretion by plasma cells infiltrating nasal polyps Laryngoscope 2000;110: 1183-8.        [ Links ]

7. Hirschberg A, Jókúti A, Darvas Z, Almay K, Répássy G, Falus A. The pathogenesis of nasal polyposis by immunoglobulin E and interleukin-5 is completed by transforming growth factor-beta1. Laryngoscope 2003;11(1)3: 120-4.        [ Links ]

8. Shin SH, Lee SH, Jeong HS, Kita H. The effect of nasal polyp epithelial cells on eosinophil activation. Laryngoscope 2003;113:1374-7.        [ Links ]

9. Jamal A, Marant AGD. Atopy and nasal polyposis. J Laryngol Otol 1987;101: 355-8.        [ Links ]

10. Allen JS, Eisma R, Leonard G, Kreutzer D. Interleukin-3 interleukin-5 and granulocyte-macrophage colony-stimulating factor expression in nasal polyps. Am J Otolaryngol 1997;18: 239-46.        [ Links ]

11. Bachert C, Genmann M, Hauser U, Rudack C. IL-5 synthesis is upregulated in human nasal polyp tissue. J Allergy Clin Immunol 1997;99: 837-42.        [ Links ]

12. Gevaert P, Bachert C, Holtappels G, Novo CP, van der Heyden J, Fransen L, Depraetere S, Walter H, van Cauwenberge P, Tavernier J. Enhanced soluble interleukin-5 receptor alpha expression in nasal polyposis. Allergy 2003;58: 371-9.        [ Links ]

13. Walsh GM. Eosinophil apoptosis: mechanisms and clinical relevance in asthmatic and allergic inflammation. Br J Haematol 2000;111: 61-7.        [ Links ]

14. Jankowski R. Eosinophils in the pathophysiology of nasal polyposis. Acta Otolaryngol 1996;116:160-3.        [ Links ]

15. Crossara PFTB, Nascimento E, Sobrinho SC, Vasconcelos AC, Guimarães RES, Becker HMG, Calosimo EA, Nunes FB. Efeito da mitomicina C em cultura de estroma de pólipos nasais eosinofílicos: indução de apoptose em eosinófilos. Rev Bras Otorrinolaringol 2004;70:658-63.        [ Links ]

16. Ingrams DR, Volk MS, Biesman BS, Pankratov MM, Shapshay SM. Sinus surgery: does mitomycin C reduce stenosis? Laryngoscope 1998;108: 883-6.        [ Links ]

17. Stream SA, Vanlleuwen RN. Use of mitomycin-C for maintaining myringotomy patency. Otolaryngol Head Neck Surg 2000;122:8-10.        [ Links ]

18. Iliev ME, van der Zypen E, Frankhauser F, England C. Transconjunctival application of mitomycin C in combination with laser sclerostomy ab interno: a long term morphological study of the post operative healing process. Exp Eye Res 1997;64:1013-26.        [ Links ]

19. Kraut A, Drnovsek-Olup B. Instillation of mytomicin C after recurrent pterygium surgery. Eur J Ophtalmol 1996;6: 264-7.        [ Links ]

20. Khaw PT, Doyle JW, Sherwood MB, Grierson I, Schultz G, McGorray S. Prolonged localized tissue effects from 5-minute exposures to fluorouracil and mitomycin C Arch Ophtalmol 1993;111: 263-7.        [ Links ]

21. Kim J, Kim S, Song I, Kim I. Mitomycin C-induced apoptosis in cultured human tenon’s capsule fibroblasts. Korean J Ophthalmol 1999;13:7-15.        [ Links ]

22. Schwartz GK, Haimovitz-Friedman A, Dhupar SK, Ehleiter D, Maslak P, Lai L, Loganzo F, Kelsen DP, Fuks Z, Albino AP. Potentiation of apoptosis by treatment with the protein kinase C-specific inhibitor safingol in mitomycin C- Treated gastric cancer cells. J Nat Cancer Inst 1995;87:1394-9.        [ Links ]

23. Becker CG. Tratamento cirúrgico da otite média com efusão: tubo de ventilação versus aplicação tópica de mitomicina C. Tese (doutorado). Faculdade de Medicina Universidade Federal de Minas Gerais; 2003.        [ Links ]

24. Rahal A, Peloquin L, Ahmarani C. Mitomycin C in sinus surgery: preliminary results in a rabbit model. J Otolaryngol 2001;30:1-5.        [ Links ]

25. Chung JH, Cosenza MJ, Rahbar R, Metson RB. Mitomycin C for the prevention of adhesion formation after endoscopic sinus surgery: a randomized controlled study. Otolaryngol Head Neck Surg 2002;126:468-74.        [ Links ]

26. Holland BW, McGuirt WF. Surgical management of choanal atresia: improved outcome using mitomycin. Arch Otolaryngol Head Neck Surg 2001;127:1375-80.        [ Links ]

27. Liao SL, Kao SC, Tseng JH, Chen MS, Hou PK. Results of intraoperative mitomycin C application in dacryocystorhinostomy. Br J Ophthalmol 2000;84:903-6.        [ Links ]

28. Ingels V, Durdurez JP, Cuvelier C, Cauwenberge PV. Nasal biopsy is superior to nasal smear for finding eosinophils in nonallergic rhinitis. Allergy 1997;52:338-41.        [ Links ]

 

 

Endereço para correspondência:
Mirian Cabral Moreira de Castro
Rua Padre Rolim 515 8º andar Bairro Funcionários
Belo Horizonte MG 30130-090
Telfax: (0xx31) 3241-2451
E-mail: miriancabralmc@hotmail.com

Este artigo foi submetido no SGP (Sistema de Gestão de Publicações) da RBORL em 21 de agosto de 2005.
Artigo aceito em 23 de setembro de 2005.

 

 

Trabalho premiado no IV Congresso Triológico de 2005
Departamento de Oftalmologia, Otorrinolaringologia e Fonoaudiologia da Universidade Federal de Minas Gerais. Laboratório de Imunologia: Prof. Evaldo Nascimento.