SciELO - Scientific Electronic Library Online

 
vol.40 issue2THE CONTROL OF ANOPHELINE MOSQUITOS BY THE SPRAYING OF DELTAMETHRIN ON RAFFIA CURTAINS USED IN MINERS' HUTS IN AREAS ENDEMIC FOR MALARIAHemorrhagic syndrome and Acute renal failure in a pregnant woman after contact with Lonomia caterpillars: a case report author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • English (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Revista do Instituto de Medicina Tropical de São Paulo

On-line version ISSN 1678-9946

Rev. Inst. Med. trop. S. Paulo vol. 40 no. 2 São Paulo Mar. 1998

http://dx.doi.org/10.1590/S0036-46651998000200009 

THE USE OF OLIGONUCLEOTIDE PROBES FOR MENINGOCOCCAL SEROTYPE CHARACTERIZATION

 

Claudio Tavares SACCHI (1), Ana Paula Silva de LEMOS (1), Anne M. Whitney (2), Carmo Elias A. MELLES (1), Claude André SOLARI (3), Carl E. FRASCH (4) & Leonard W. MAYER (2)

 

 

SUMMARY
In the present study we examine the potential use of oligonucleotide probes to characterize Neisseria meningitidis serotypes without the use of monoclonal antibodies (MAbs). Antigenic diversity on PorB protein forms the bases of serotyping method. However, the current panel of MAbs underestimated, by at least 50% the PorB variability, presumably because reagents for several PorB variable regions (VRs) are lacking, or because a number of VR variants are not recognized by serotype-defining MAbs12. We analyzed the use of oligonucleotide probes to characterize serotype 10 and serotype 19 of N. meningitidis. The porB gene sequence for the prototype strain of serotype 10 was determined, aligned with 7 other porB sequences from different serotypes, and analysis of individual VRs were performed. The results of DNA probes 21U (VR1-A) and 615U (VR3-B) used against 72 N. meningitidis strains confirm that VR1 type A and VR3 type B encode epitopes for serotype-defined MAbs 19 and 10, respectively. The use of probes for characterizing serotypes possible can type 100% of the PorB VR diversity. It is a simple and rapid method specially useful for analysis of large number of samples.
KEYWORDS: Neisseria meningitidis; Serotyping, Class 3 protein; porB gene.

 

 

INTRODUCTION

Most epidemiological investigations of meningococcal disease utilize classification schemes based on differences among meningococcal cell envelope molecules. Those classifications has increased our understanding on the dynamic of Neisseria meningitidis infections4,11,13,14. All meningococci express either a class 2 or 3 protein, and most strains also express a class 1 outer membrane protein (OMP)7,16. Those predominant proteins in the outer membrane function as porins, and antibodies against them are bactericidal3,7. Antigenic diversity among these proteins, forms the basis of serotyping and serosubtyping classification7,10. There are approximately 20 different serotypes within serogroups B and C and epitopes for 11 of these serotypes are expressed on class 3 protein (PorB).

Sequence analysis of porB genes (PorB typing) has shown four regions of variability, designated variable region (VR) 1 through 4. These are located in surface-exposed loops I, V, VI, and VII, respectively1,3,6,18. Comparison of PorB amino acid sequences and serological results permitted a rational re-assignment of serotype designation as well as a determination of probable epitope location for serotype-defining MAbs12. Serotype characterization of an unknown meningococcal strain include determination of epitope reactivity at regions VR1, VR2, VR3, and VR4 when MAbs are available for those epitopes12. Since serotyping becomes a sommation of up to 4 results, the definition of serotype has changed to include the immunological characterization of all 4 VRs. Therefore, the epitope location of serotype-defining MAbs are located on specific VRs12.

The goal of this study was to examine the potential use of oligonucleotide probes to characterize N. meningitidis serotypes without to use MAbs. These probes represent porB VR sequences that encode for the surface-exposed serotype-defining epitopes on PorB protein. We examined the use of probes for serotypes 10 and 19 on a collection of meningococcal strains isolated in Brazil during 1994.

 

MATERIAL AND METHODS

Meningococcal strains. We selected 72 N. meningitidis strains according to their serotypes for analysis (Table 1). These strains were recovered from blood or cerebrospinal fluid samples from patients with systemic disease in Brazil. All selected N. meningitidis strains were serogrouped as described previously13, serotyped and serosubtyped by dot-blotting of whole-cell suspensions as described by Wedege et al., 1990. MAbs for serotype 15, 16, 19, and serosubtypes P1.2, P1.3, P1.16 were provided by W.D. Zollinger. MAbs for serosubtype P1.9 was provided by J.T. Poolman, Bilthoven, Netherlands, and mAbs for serotypes 2a, 2b, 4, 10, 17 and serosubtypes P1.4, P1.7, P1.14, P1.15 were produced in Adolfo Lutz Institute.

Table 1
Characteristics of the 72 Neisseria meningitidis strains used in this study

Strain
number
Serogroup:
serotype
Serosubtype Probe Strain
number
Serogroup:
serotype
Serosubtype Probe
VR1-A
21U
VR3-B
615U
VR1-A
21U
VR3-B
615U
N. 243/94 B:4 P1.15 - - N.925/94 B:17 nt - -
N.678/94 B:4 P1.15 - - N.1053/94 B:17 P1.16 - -
N.630/94 B:4 P1.15 - - N.240/94 B:17,10 P1.9 - +
N.722/94 B:4 P1.15 - - N.742/94 B:17,10 P1.16 - +
N.921/94 B:4 P1.7 - - N.627/94 B:19 nt + -
N.230/94 B:4 P1.7 - - N.29/94 B:19 P1.15 + -
N.334/94 B:4 P1.15 - - N.1007/94 B:19 P1.15 + -
N.365/94 B:4 P1.15 - - N.434/94 B:19 P1.15 + -
N.770/94 B:4 P1.15 - - N.901/93 B:19 P1.9 + -
N.145/94 B:4 P1.15 - - N.154/94 B:19 P1.14 + -
N.51/94 B:4 P1.7 - - N.40/94 B:19 P1.14 + -
N.404/94 B:4 P1.15 - - N.405/94 B:19 nt + -
N.950/93 B:4 P1.9 - - N.438/94 B:19 nt + -
N.454/94 B:4 P1.7 - - N.453/94 B:19 nt + -
N.200/94 B:4 P1.15 - - N.621/94 B:19 P1.15 + -
N.555/94 B:4 P1.15 - - N.622/94 B:19 P1.14 + -
N.413/94 B:4 P1.15 - - N.651/94 B:19 nt + -
N.513/94 B:4,10 P1.9 - + N.666/94 B:19 nt + -
N.288/94 B:4,10 P1.9 - + N.729/94 B:19 P1.7 + -
N.665/94 B:4,10 P1.9 - + N.780/94 B:19 nt + -
N.922/94 B:4,10 nta - + N.947/94 B:19 P1.14 + -
N.25/94 B:4,10 nt - + N.34/94 B:19,10 P1.4 + +
N.539/94 B:4,10 P1.9 - + N.525/94 B:19,10 P1.16 + +
N.480/94 B:4,10 P1.9 - + N.113/94 B:19,10 P1.16 + +
N.363/94 B:4,10 P1.15 - + N.91/94 B:19,10 P1.9 + +
N.388/94 B:4,10 nt - + N.149/94 B:19,10 P1.16 + +
N.1002/94 B:4,10 P1.2 - + N.415/94 B:19,10 P1.15 + +
N.734/94 B:4,10 P1.9 - + N.347/94 B:19,10 P1.16 + +
N.771/94 B:4,10 P1.9 - + N.1119/94 B:19,10 P1.15 + +
N.420/94 B:4,10 P1.9 - + N.1124/94 B:19,10 P1.14 + +
N.676/94 B:4,10 P1.9 - + N.1092/94 B:19,10 nt + +
N.527/94 B:4,10 nt - + N.528/94 B:19,10 P1.9 + +
N.716/94 B:4,10 P1.9 - + N.163/94 B:19,10 nt + +
N.862/94 B:4,10 P1.9 - + N.497/94 B:19,10 P1.15 + +
N.348/94 B:17 P1.14 - - N.292/94 B:19,10 P1.15 + +
N.671/94 B:17 P1.16 - - N.544/94 B:19,10 P1.15 + +

a nt, non-serosubtypeable.

 

porB gene analysis. To identify PorB amino acid sequences associated with serotype-defining MAbs, from 10 and 19 we selected 7 porB genes sequences obtained from GenBank for serotype reference strains that reacted with those MAbs, and sequenced the porB gene of the serotype 10 prototype strain (N.34/94), (Table 2). Primers NMP27 (5'-ttgtacggtacaattaaagcaggcgt) and NMP28 (5'-ttagaatttgtgacgcagaccaac) were used to amplify the porB gene of N.34/94 5. Purification of the PCR product was performed with QIAquick-spin PCR Purification Kit (QIAGEN). Eight oligonucleotide primers [NMP27, F651 (5'-ggcggtgcctataaaagacat), F731 (5'-cgacaatgatgccctgtac) and the reverse strands NMP28, R202 (5'-gttaccgaggtcttcttggcc), R439 (5'-gtagcgtacggaaatgaggcg), R714 (5'-ggtgaatctggtatttctcaat) and, C3RVR1 (5'-cggtttgagagttgtgcg) 19] were used to sequence the porB gene using the Taq Dye-deoxy terminator cycle sequencing kit of Applied Biosystems. The primers were designed to be complement to any to the conserved regions of porB gene. The sequencing reactions were purified by using Centri-Sep spin columns (Princeton Separations) and resolved on a 5% acrylamide/8 M urea gel using an ABI model 373A automated DNA sequencing system. DNA sequences obtained from these reactions were aligned, edited and the consensus sequence determined with the University of Winsconsin Genetics Computer Group (GCG) package. The porB gene of N.34/94 strain amplification and sequencing were repeated twice, and no variability was found.

Table 2
Variable region characteristics of the N. meningitidis serotype reference strains and their reactivity with oligonucleotide probes.

Straina

ACCb

Serotype

VRsc

Probes

1

2

3

4

VR1-A
21U

VR3-B
615U

M1080

X65530

19,1

A

A

A

C

+

-

126E

U07191

19,10

A

A

B

A

+

+

M978

U07189

19,10

A

B

B

A

+

+

S3032

X65534

19,7

A

C

A

D

+

-

S3446

U07188

19,14

A

D

C

B

+

-

190I

U07192

19,10

A

B

B

A

+

+

6940

U11030

19,10

A

A

B

A

+

+

N.34/94

U34194

19,10

A

D

B

E

+

+

a Meningococcal serotype reference strains.
b [ACC] GenBank accession number of porB genes.
c Variable regions of porB gene.

 

Oligonucleotide probes. To verify the correlation between VRs and serotype epitopes 10 and 19 we designed two different VR oligonucleotide probes. Probe 21U represents the VR1-A (5'-cgtagctcacaatggagctcaggcggct) and probe 615U the VR3-B (5'-cgaaattggctttgccaaacgaca). The probes were synthesized on an Applied Biosystems 380B DNA synthesizer and 5'end digoxigenin-labeled according to a standard protocol for digoxigenin-labeling.

Dot blots and hybridization assays. DNA extraction and purification have been previously described 1. DNA from 21 prototype serotype strains and 72 Brazilian N. meningitidis strains was applied to positively charged nylon membranes (Boehringer Mannheim Biochemicals) in 1 mg dots and fixed by UV cross-linking. Filters were stored in plastic bags at -20 ºC or used immediately. After prehybridization for 1 h, the probes were added, and hybridization for 16 h was performed at temperatures of 50 ºC and 60 ºC for the 21U and 615U probes, respectively. The prehybridizations were done at the same temperatures. The Genius kit was used for detection as described above.

 

RESULTS AND DISCUSSION

The predicted PorB protein sequence of prototype strains N34/94 (for serotype 10), and 6940 (for serotype 19) were aligned with 6 other predicted PorB proteins from prototype reference strains for serotyping (Table 2). Different VR sequences for each VR were identifyed by letters as previously described 12, therefore 1, 4, 3, and 5 different amino acid VR sequences (or types) were defined for VRs 1, 2, 3, and 4 respectively (Table 2).

The predicted PorB protein sequences for N.34/94 strain was characterized as VR1 type A (VR1-A), also present in the other 7 strains and VR2 type D (VR2-D). The VR3 sequence was identical to VR3 type B (VR3-B), also found in strains 126E, M978, 190I, and 6940. In VR4, one unique sequence was found and called as VR type E (VR4-E). For

serotype 19 strain (6940) the VR1 was also type A (VR1-A), the VR2 was type A (VR2-A) as the strains M 1080 and 126E. The VR3 was type B (VR3-B) as the strains 126E, M978, 190I and N.34/94. The VR4 was type A (VR4-A) as the strains M126E, M978, and 190I. All these VR sequences are presented in Table 2 and 3. The VR sequences of PorB protein are located in areas corresponding to predicted outer exposed loops when the protein is folded by using the model for neisserial porin proteins described by van der Ley et al., 1991. The protein sequence of each VR is represented in Table 3.

Table 3
Nucleic acid and amino acid sequences for each porB gene and PorB protein variable region (VR) type.

VRs

VR
Type

DNA sequence

Amino acid sequence

Accession Number

VR1

A

121                                                                                         156
GTAGCTCACAATGGAGCTCAGGCGGCTAGCGTTGAA
VAHNGAQAASVE

X65534

VR2

A

610                                                           633
CATCAAGTGCAAGAGAACGTGAAT
HQVQENVN

X65530

 

B

CATCAAGTACAAGAGGACTTGAAT

HQVQEDLN

U07189

 

C

CATCGAGTGCAAGAGGACATAAAT

HRVQEDIN

X65534

 

D

CAGAATGTG --- GATAACGTGAAG

QNV.DNVK

U34194

VR3

A

724                                       741
TTGGTT --- GAAGAAAATTA
LV.EENY

X65534

 

B

TTTGGCTTTGCCAAACCGACAAT LALPNDN

U07189

 

C

CTGGTT ------- AAAGACAAT LV..KDN

U07188

VR4

A

829                                                                                            864
AAAGGCTCGTTTGATGATGCAGACTTAAGCAACGAT

KGSFDDADLSND

U07189

 

B

AAAGGCTCGTTTGATGATGCAGACTACACCAACGAT

KGSFDDADYTND

U07188

 

C

AAAGGCTCGTTTGATGCTACAAACTACAACAACGAT

KGSFDATNYNND

X65530

 

D

AAAGGCTCAGTTGATGATGCAAAACGCGACAATACT

KGSVDDAKRDNT

X67934

 

E

AAAGGTTTGGTTGATAGTGCAGACTTAAGCAACGAT

KGLVDSADLSND

U34194

We analyzed VR sequences from 7 porB genes obtained from GenBank and the new N.34/94 porB sequence. The numbers above the sequences refer to the nucleotid position equivalent to the porB sequence of S3032 strain (GenBank X65534). Different sequences at the same VR were designated by letters on alphabetic order (VR types). The sequence aligment in this table does not correspond exactly to the VR sequences previously described (Bash et al., 1995). Symbols: -, nucleotide deletion; ., amino acid deletion.

 

The probes 615U (VR3-B), and 21U (VR1-A) were hybridized with dot blots containing 1mg of genomic DNA from each of the 72 strains described in Table 1 and the 8 strains on Table 2. The probes hybridized with every serotype 10 and/or 19, confirming that epitope 10 is related with VR3-B while epitope 19 is related with VR1-A. These vRs were refered as VR1-19 and VR3-10 by Sacchi et al. 199812.

Serotype is the most practical method to screening large numbers of samples during epidemic, or in field situations, however, the current panel of mAbs underestimate by at least 50% the PorB variability because reagents for several VRs are lacking, or because a number of VR variants are not recognized by serotype-defining MAbs. The sequencing of porB gene (VR typing), is important to characterize the precise structure of VR epitopes on PorB molecules and can type 100% of the PorB VR diversity, however, VR typing is not practical for analysis of large numbers of samples. Our hybridization results were concordant with PorB VR analysis and MAb reactivity previously described 12. Using this method it is possible to characterize 100% of VR amino acid sequences (serotype epitopes), even when MAbs are not available for those epitopes.

 

 

RESUMO

O uso de sondas de oligonucleotídeos para caracterização de sorotipos de meningococo
No presente trabalho nós examinamos o uso potencial de sondas de oligonucleotídeos para caracterizar sorotipos de Neisseria meningitidis sem o uso de anticorpos mono-clonais (MAbs). A diversidade antigênica da proteína PorB forma a base do método de sorotipagem, todavia, o atual painel de MAbs utilizados, sub-estima em no mínimo 50% a diversidade desta proteína devido a falta de reagentes para as várias regiões variáveis (VRs) da proteína PorB ou porque várias variantes das VRs não são reagentes com os MAbs disponíveis. Nós analisamos o uso de sondas de oligonucleotídeos para caracterizar os sorotipos 10 e 19 de N. meningitidis. O gene porB da cepa protótipo do sorotipo 10 foi sequenciado e alinhado com outras 7 sequências de diferentes sorotipos, e as individuais VRs foram então analisadas. Os resultados com as sondas 21U (VR1-A) e 615U (VR3-B) contra 72 cepas de N. meningitidis confirmaram que VR1-A e VR3-B codificam epítopos para os MAbs 19 e 10 respectivamente. É possível o uso de sondas para a caracterização dos sorotipos e podemos tipar 100% da diversidade da VR do gene porB. Trata-se de um método simples, rápido, e especialmente útil para a análise de um grande número de amostras.

 

 

ACKNOWLEDGEMENTS

The authors are grateful to Dr. W. D. Zollinger for providing the MAb 19.

 

REFERENCES

1. BASH, M.C.; LESIAK, K.B; BANKS, S.D. & FRASCH, C.E. - Analysis of Neisseria meningitidis class 3 other membrane protein gene variable regions and type identification using genetic techniques. Infect. Immun., 63: 1484-1490, 1995.         [ Links ]

2. BROOKS, J.L.; ROSENQVIST, E.; BJUNE, G.; LAMBDEN, P.R. & HECKELS, J.E. -Comparation of the class-1 outer membrane protein from B:15:P1.16 Neisseria meningitidis strains isolated from patients previously immunized with a serogroup B outer membrane protein vaccine in Norway. Microb. Pathog., 17: 425-430, 1994.         [ Links ]

3. BUTCHER, S.; SARVAS, M. & RUNEBERG-NYMAAN, K. - Class-3 porin protein of Neisseria meningitidis: cloning and structure of the gene. Gene, 105: 125-128, 1991.         [ Links ]

4. CAUGANT, D.A.; FROHOLM, L.O.; BOVRE, K. et al. - Intercontinental spread of a genetically distinctive complex of clones of Neisseria meningitidis causing epidemic disease. Proc. nat. Acad. Sci (Wash.), 83: 4927-4931, 1986.         [ Links ]

5. CRUZ, C.; PAVEZ, G.; AGUILAR, E. et al. - Serotype-specific outbreak of group B meningococcal disease in Iquique, Chile. Epidem. Infect., 105: 119-126, 1990.         [ Links ]

6. FEAVERS, I.M.; SUKER, J.; McKENNA, A.J.; HEATH, A.B. & MAIDEN, M.C.J. - Molecular analysis of the serotyping antigens of Neisseria meningitidis. Infect. Immun.,60: 3620-3629, 1992.         [ Links ]

7. FRASCH, C.E.; ZOLLINGER, W.D. & POOLMAN, J.T. - Serotype antigens of Neisseria meningitidis and a proposed scheme for designation of serotypes. Rev. infect. Dis., 7: 504-510, 1985.         [ Links ]

8. JONES, D.M. & ELDRIDGE, J. - Meningococcal disease in England and Wales 1978-79. A change in the serotype pattern. J. Infect., 3: 134-139, 1981.         [ Links ]

9. POOLMAN, J.T. - Development of a meningococcal vaccine. Infect. Agents Dis., 4: 13-28, 1995.         [ Links ]

10. POOLMAN, J.T.; HOPMAN, C.T.P. & ZANEN, H.C. - Immunochemical characterization of Neisseria meningitidis serotype antigens by immunodiffusion and SDS-polyacrylamide gel electrophoresis immunoperoxidase techniques and the distribution of serotypes among the cases and carriers. J. gen. Microbiol., 116: 465-473, 1980.         [ Links ]

11. SACCHI, C.T.; LEMOS, A.P.S.; GORLA, M.C.O. & FRASCH, C.E. - Monoclonal antibody to serotype 17 of Neisseria meningitidis and their prevalence in Brazilian states. Rev. Inst. Med. trop. S. Paulo, 37: 1-5, 1995.         [ Links ]

12. SACCHI, C.T.; LEMOS, A.P.S.; WHITNEY, A.M. et al. - Correlation between serological and sequencing analyses of the PorB outer membrane protein in the Neisseria meningitidis serotyping system. Clin. Diagn. Lab. Immunol., 5: 348-354, 1998.         [ Links ]

13. SACCHI, C.T.; PESSOA, L.L.; RAMOS, S.R. et al - Ongoing group B Neisseria meningitidis epidemic in São Paulo, Brazil, due to increased prevalence of a single clone of the ET-5 complex. J. clin. Microbiol., 30: 1734-1738, 1992.         [ Links ]

14. SACCHI, C.T.; ZANELLA, R.C.; CAUGANT, D.A. et al. - Emergence of a new clone of serogroup C Neisseria meningitidis in São Paulo, Brazil. J. clin. Microbiol., 30: 1282-1286, 1992.         [ Links ]

15. TSAI, C.M.; FRASCH, C.E. & MOCCA, L.F. - Five structural classes of major outer membrane proteins in Neisseria meningitidis. J. Bact., 146: 69-78, 1981.         [ Links ]

16. VAN DER LEY, P.; HECKELS, J.E.; VIRJI, M.; HOOGERHOUT, P. & POOLMAN, J.T. -Topology of outer membrane porins in pathogenic Neisseria ssp. Infect. Immun., 59: 2963-2971, 1991.         [ Links ]

17. WARD, M.J.; LAMBDEN, P.R. & HECKELS, J.E. - Sequence analysis and relationships between meningococcal class 3 serotype and other porins from pathogenic and nonpathogenic Neisseria species. FEMS Microbiol. Lett., 94: 283-290, 1992.         [ Links ]

18. WEDEGE, E.; HOIBY, E.A.; ROSENQVIST, E. & FROHOLM, L.O. - Serotyping and subtyping of Neisseria meningitidis isolates by co-agglutination, dot-blotting and ELISA. J. med. Microbiol., 31: 195-201, 1990.         [ Links ]

19. ZAPATA, G.A.; VANN, W.F.; RUBINSTEIN, Y. & FRASCH, C.E. - Identification of variable region differences in Neisseria meningitidis class 3 protein sequences among five group B serotypes. Molec. Microbiol., 6: 3493-3499, 1992.         [ Links ]

 

 

(1) Bacteriology Division, Adolfo Lutz Institute, São Paulo, Brazil.
(2) Division of Bacterial and Mycotic Diseases, National Centers for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia, USA.
(3) Bacteriology Department, Fundação Oswaldo Cruz, Rio de Janeiro, Brazil.
(4) Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA.

Correspondence to: Claudio T. Sacchi. Bacteriology Division, Adolfo Lutz Institute, Av. Dr. Arnaldo 351, 01246-902 São Paulo, SP, Brazil. Phone 3061-0111 Extention 2055.
e-mail: sacchi@usp.br 

Recebido para publicação em 11/11/1997
Aceito para publicação em 05/01/1998

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License